CINXE.COM

<!DOCTYPE html> <html lang="en" dir="ltr"> <head>  <script async src="https://www.googletagmanager.com/gtag/js?id=G-P63WKM1TM1"></script> <script> window.dataLayer = window.dataLayer || []; function gtag(){dataLayer.push(arguments);} gtag('js', new Date()); gtag('config', 'G-P63WKM1TM1'); </script>  <script type="text/javascript" > (function(m,e,t,r,i,k,a){m[i]=m[i]||function(){(m[i].a=m[i].a||[]).push(arguments)}; m[i].l=1*new Date(); for (var j = 0; j < document.scripts.length; j++) {if (document.scripts[j].src === r) { return; }} k=e.createElement(t),a=e.getElementsByTagName(t)[0],k.async=1,k.src=r,a.parentNode.insertBefore(k,a)}) (window, document, "script", "https://mc.yandex.ru/metrika/tag.js", "ym"); ym(55165297, "init", { clickmap:false, trackLinks:true, accurateTrackBounce:true, webvisor:false }); </script> <noscript><div><img src="https://mc.yandex.ru/watch/55165297" style="position:absolute; left:-9999px;" alt="" /></div></noscript>    <title>Search results for: Helicoverpa armigera (Noctuidae: Lepidoptera)</title> <meta name="description" content="Search results for: Helicoverpa armigera (Noctuidae: Lepidoptera)"> <meta name="keywords" content="Helicoverpa armigera (Noctuidae: Lepidoptera)"> <meta name="viewport" content="width=device-width, initial-scale=1, minimum-scale=1, maximum-scale=1, user-scalable=no"> <meta charset="utf-8"> <link href="https://cdn.waset.org/favicon.ico" type="image/x-icon" rel="shortcut icon"> <link href="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/css/bootstrap.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/plugins/fontawesome/css/all.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/css/site.css?v=150220211555" rel="stylesheet"> </head> <body> <header> <div class="container"> <nav class="navbar navbar-expand-lg navbar-light"> <a class="navbar-brand" href="https://waset.org"> <img src="https://cdn.waset.org/static/images/wasetc.png" alt="Open Science Research Excellence" title="Open Science Research Excellence" /> </a> <button class="d-block d-lg-none navbar-toggler ml-auto" type="button" data-toggle="collapse" data-target="#navbarMenu" aria-controls="navbarMenu" aria-expanded="false" aria-label="Toggle navigation"> <span class="navbar-toggler-icon"></span> </button> <div class="w-100"> <div class="d-none d-lg-flex flex-row-reverse"> <form method="get" action="https://waset.org/search" class="form-inline my-2 my-lg-0"> <input class="form-control mr-sm-2" type="search" placeholder="Search Conferences" value="Helicoverpa armigera (Noctuidae: Lepidoptera)" name="q" aria-label="Search"> <button class="btn btn-light my-2 my-sm-0" type="submit"><i class="fas fa-search"></i></button> </form> </div> <div class="collapse navbar-collapse mt-1" id="navbarMenu"> <ul class="navbar-nav ml-auto align-items-center" id="mainNavMenu"> <li class="nav-item"> <a class="nav-link" href="https://waset.org/conferences" title="Conferences in 2024/2025/2026">Conferences</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/disciplines" title="Disciplines">Disciplines</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/committees" rel="nofollow">Committees</a> </li> <li class="nav-item dropdown"> <a class="nav-link dropdown-toggle" href="#" id="navbarDropdownPublications" role="button" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"> Publications </a> <div class="dropdown-menu" aria-labelledby="navbarDropdownPublications"> <a class="dropdown-item" href="https://publications.waset.org/abstracts">Abstracts</a> <a class="dropdown-item" href="https://publications.waset.org">Periodicals</a> <a class="dropdown-item" href="https://publications.waset.org/archive">Archive</a> </div> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/page/support" title="Support">Support</a> </li> </ul> </div> </div> </nav> </div> </header> <main> <div class="container mt-4"> <div class="row"> <div class="col-md-9 mx-auto"> <form method="get" action="https://publications.waset.org/abstracts/search"> <div id="custom-search-input"> <div class="input-group"> <i class="fas fa-search"></i> <input type="text" class="search-query" name="q" placeholder="Author, Title, Abstract, Keywords" value="Helicoverpa armigera (Noctuidae: Lepidoptera)"> <input type="submit" class="btn_search" value="Search"> </div> </div> </form> </div> </div> <div class="row mt-3"> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Commenced</strong> in January 2007</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Frequency:</strong> Monthly</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Edition:</strong> International</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Paper Count:</strong> 73</div> </div> </div> </div> <h1 class="mt-3 mb-3 text-center" style="font-size:1.6rem;">Search results for: Helicoverpa armigera (Noctuidae: Lepidoptera)</h1> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">73</span> Fecundity and Egg Laying in Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae): Model Development and Field Validation</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Noor%20Ul%20Ane">Muhammad Noor Ul Ane</a>, <a href="https://publications.waset.org/abstracts/search?q=Dong-Soon%20Kim"> Dong-Soon Kim</a>, <a href="https://publications.waset.org/abstracts/search?q=Myron%20P.%20Zalucki"> Myron P. Zalucki</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Models can be useful to help understand population dynamics of insects under diverse environmental conditions and in developing strategies to manage pest species better. Adult longevity and fecundity of Helicoverpa armigera (Hübner) were evaluated against a wide range of constant temperatures (15, 20, 25, 30, 35 and 37.5ᵒC). The modified Sharpe and DeMichele model described adult aging rate and was used to estimate adult physiological age. Maximum fecundity of H. armigera was 973 egg/female at 25ᵒC decreasing to 72 eggs/female at 37.5ᵒC. The relationship between adult fecundity and temperature was well described by an extreme value function. Age-specific cumulative oviposition rate and age-specific survival rate were well described by a two-parameter Weibull function and sigmoid function, respectively. An oviposition model was developed using three temperature-dependent components: total fecundity, age-specific oviposition rate, and age-specific survival rate. The oviposition model was validated against independent field data and described the field occurrence pattern of egg population of H. armigera very well. Our model should be a useful component for population modeling of H. armigera and can be independently used for the timing of sprays in management programs of this key pest species. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cotton%20bollworm" title="cotton bollworm">cotton bollworm</a>, <a href="https://publications.waset.org/abstracts/search?q=life%20table" title=" life table"> life table</a>, <a href="https://publications.waset.org/abstracts/search?q=temperature-dependent%20adult%20development" title=" temperature-dependent adult development"> temperature-dependent adult development</a>, <a href="https://publications.waset.org/abstracts/search?q=temperature-dependent%20fecundity" title=" temperature-dependent fecundity"> temperature-dependent fecundity</a> </p> <a href="https://publications.waset.org/abstracts/87308/fecundity-and-egg-laying-in-helicoverpa-armigera-hubner-lepidoptera-noctuidae-model-development-and-field-validation" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/87308.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">151</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">72</span> Studies on Phylogeny of Helicoverpa armigera Populations from North Western Himalaya Region with Help of Cytochromeoxidase I Sequence</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=R.%20M.%20Srivastava">R. M. Srivastava</a>, <a href="https://publications.waset.org/abstracts/search?q=Subbanna%20A.R.N.S"> Subbanna A.R.N.S</a>, <a href="https://publications.waset.org/abstracts/search?q=Md%20Abbas%20Ahmad"> Md Abbas Ahmad</a>, <a href="https://publications.waset.org/abstracts/search?q=S.%20P.More"> S. P.More</a>, <a href="https://publications.waset.org/abstracts/search?q=Shivashankar"> Shivashankar</a>, <a href="https://publications.waset.org/abstracts/search?q=B.%20Kalyanbabu">B. Kalyanbabu</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The similar morphology associated with high genetic variability poses problems in phylogenetic studies of Helicoverpa armigera (Hubner). To identify genetic variation of North Western Himalayan population’s, partial (Mid to terminal region) cytochrome c oxidase subunit I (COX-1) gene was amplified and sequenced for three populations collected from Pantnagar, Almora, and Chinyalisaur. The alignment of sequences with other two populations, Nagpur representing central India population and Anhui, China representing complete COX-1 sequence revealed unanimity in middle region with eleven single nucleotide polymorphisms (SNPs) in Nagpur populations. However, the consensus is missing when approaching towards terminal region, which is associated with 15 each SNPs and pair base substitutions in Chinyalisaur populations. In minimum evolution tree, all the five populations were majorly separated into two clades, one comprising of only Nagpur population and the other with rest. Amongst, North Western populations, Chinyalisaur one is promising by farming a separate clade. The pairwise genetic distance ranges from 0.025 to 0.192 with the maximum between H. armigera populations of Nagpur and Chinyalisaur. This genetic isolation of populations can be attributed to a key role of topological barriers of weather and mountain ranges and temporal barriers due to cropping patterns. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cytochrome%20c%20oxidase%20subunit%20I" title="cytochrome c oxidase subunit I">cytochrome c oxidase subunit I</a>, <a href="https://publications.waset.org/abstracts/search?q=northwestern%20Himalayan%20population" title=" northwestern Himalayan population"> northwestern Himalayan population</a>, <a href="https://publications.waset.org/abstracts/search?q=Helicoverpa%20armigera%20%28Noctuidae%3A%20Lepidoptera%29" title=" Helicoverpa armigera (Noctuidae: Lepidoptera)"> Helicoverpa armigera (Noctuidae: Lepidoptera)</a>, <a href="https://publications.waset.org/abstracts/search?q=phylogenetic%20relationship" title=" phylogenetic relationship"> phylogenetic relationship</a>, <a href="https://publications.waset.org/abstracts/search?q=genetic%20variation" title=" genetic variation"> genetic variation</a> </p> <a href="https://publications.waset.org/abstracts/71872/studies-on-phylogeny-of-helicoverpa-armigera-populations-from-north-western-himalaya-region-with-help-of-cytochromeoxidase-i-sequence" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/71872.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">309</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">71</span> Helicoverpa armigera Hubner (Lepidoptera: Noctuidae) Susceptibility to Bacillus thuringiensis Crystal Toxins</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Jawad%20Saleem">Muhammad Jawad Saleem</a>, <a href="https://publications.waset.org/abstracts/search?q=Faisal%20Hafeez"> Faisal Hafeez</a>, <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Arshad"> Muhammad Arshad</a>, <a href="https://publications.waset.org/abstracts/search?q=Afifa%20Naeem"> Afifa Naeem</a>, <a href="https://publications.waset.org/abstracts/search?q=Ayesha%20Iftekhar"> Ayesha Iftekhar</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Bacillus thuringiensis is a gram-positive spore-forming bacterium that belongs to the Bacillus cereus group of Bacilli and it produces ICP (insecticidal crystal protein) Cry toxins or Cysts toxins. Spores are produced as parasporal crystalline inclusions bodies (also known as endotoxins) at the onset of sporulation during the stationary growth phase. During vegetative growth that does not form crystals and is called vegetative insecticidal proteins (VIP) and secreted an insecticidal protein (SIP). Bacillus thuringiensis (Bt) is important for pest management either in the form of insecticides or through incorporated in the gene of the crop. Bioassays were conducted on the F2 generation of 1st instar larvae of H. armigera by the diet incorporation method to determine the susceptibility to Bt Cry toxins (Cry1Ac, Cry2Ab, Cry2A). The median lethal concentration (LC₅₀) of Cry1Ac, Cry2Ab, Cry2A ranged from 0.11 to 1.06 µg/ml and moult inhibitory concentration (MIC₅₀) of Cry1Ac, Cry2Ab, Cry2A ranged from 0.05 to 0.25 µg/ml. Cry1Ac was found most toxic to 1st instar larvae of H. armigera as compared to other Bt Cry toxins (Cry1Ac, Cry2Ab, Cry2A). The experimental results are important to policy-makers and technology providers to develop strategies for the exploitation of transgenic Bt cotton varieties as a component of integrated pest management. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Bt%20toxin" title="Bt toxin">Bt toxin</a>, <a href="https://publications.waset.org/abstracts/search?q=Cry1Ac" title=" Cry1Ac"> Cry1Ac</a>, <a href="https://publications.waset.org/abstracts/search?q=Cry2Ab" title=" Cry2Ab"> Cry2Ab</a>, <a href="https://publications.waset.org/abstracts/search?q=Cry2A" title=" Cry2A"> Cry2A</a>, <a href="https://publications.waset.org/abstracts/search?q=susceptibility" title=" susceptibility"> susceptibility</a>, <a href="https://publications.waset.org/abstracts/search?q=Helicoverpa%20armigera" title=" Helicoverpa armigera"> Helicoverpa armigera</a> </p> <a href="https://publications.waset.org/abstracts/97825/helicoverpa-armigera-hubner-lepidoptera-noctuidae-susceptibility-to-bacillus-thuringiensis-crystal-toxins" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/97825.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">178</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">70</span> Insecticidal Effects of the Wettable Powder Formulations of Plant Extracts on Cotton Bollworm, Helicoverpa armigera (Lep. Noctuidae)</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Reza%20Sadeghi">Reza Sadeghi</a>, <a href="https://publications.waset.org/abstracts/search?q=Maryam%20Nazarahari"> Maryam Nazarahari</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Due to the numerous side effects of chemical pesticides, in this research, to provide the practical use of herbal compounds, the extracts of the two plants of thyme and eucalyptus were extracted by using water, 70% ethanol, and n-hexane solvents via percolation method and then formulated as wettable powders. The mortality rates of cotton bollworm (Helicoverpa armigera) were investigated under different concentrations of ethanolic, hexanic, and aqueous extracts of thyme and eucalyptus and their formulations in laboratory conditions. The results showed that the used concentrations, types of solvents, and sorts of formulations significantly affected the mortality rates of cotton bollworm larvae during the exposure period of 24 h. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cotton%20bollworm" title="cotton bollworm">cotton bollworm</a>, <a href="https://publications.waset.org/abstracts/search?q=eucalyptus" title=" eucalyptus"> eucalyptus</a>, <a href="https://publications.waset.org/abstracts/search?q=formulation" title=" formulation"> formulation</a>, <a href="https://publications.waset.org/abstracts/search?q=thyme" title=" thyme"> thyme</a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity" title=" toxicity"> toxicity</a> </p> <a href="https://publications.waset.org/abstracts/173002/insecticidal-effects-of-the-wettable-powder-formulations-of-plant-extracts-on-cotton-bollworm-helicoverpa-armigera-lep-noctuidae" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/173002.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">85</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">69</span> Toxicity of Cry1ac Bacillus thuringiensis against Helicoverpa armigera (Hubner) on Artificial Diet under Laboratory Conditions</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Tahammal%20Hussain">Tahammal Hussain</a>, <a href="https://publications.waset.org/abstracts/search?q=Khuram%20Zia"> Khuram Zia</a>, <a href="https://publications.waset.org/abstracts/search?q=Mumammad%20Jalal%20Arif"> Mumammad Jalal Arif</a>, <a href="https://publications.waset.org/abstracts/search?q=Megha%20Parajulee"> Megha Parajulee</a>, <a href="https://publications.waset.org/abstracts/search?q=Abdul%20Hakeem"> Abdul Hakeem</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The Bioassay on neonate, 2nd and 3rd instar larvae of Helicoverpa armigera (Hubner) were conducted against Bacillus thuringiensis proteins Cry1Ac. Cry1Ac was incorporated into an artificial diet and was serially diluted with distilled water and then mixed with diet at an appropriate temperature of diet. Toxins incorporated prepared diet was poured into Petri-dishes. For controls, distilled water was mixed with the diet. Five toxin doses 0.25, 0.5, 1, 2, and 4 ug / ml and one control were used for each instars of H. armigera 20 larvae were used in each replication and each treatment is replicated four times. LC50 of Cry1Ac against neonate, 2nd and 3rd instar larvae of H. armigera were 0.34, 0.81 and 1.46 ug / ml. So Cry1Ac is more effective against neonate larvae of H .armigera as compared to 2nd and 3rd instar larvae under laboratory conditions. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=B.%20thuringiensis" title="B. thuringiensis">B. thuringiensis</a>, <a href="https://publications.waset.org/abstracts/search?q=Cry1Ac" title=" Cry1Ac"> Cry1Ac</a>, <a href="https://publications.waset.org/abstracts/search?q=H.%20armigera" title=" H. armigera"> H. armigera</a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity" title=" toxicity"> toxicity</a> </p> <a href="https://publications.waset.org/abstracts/71388/toxicity-of-cry1ac-bacillus-thuringiensis-against-helicoverpa-armigera-hubner-on-artificial-diet-under-laboratory-conditions" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/71388.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">413</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">68</span> Efficacy of Some Plant Extract against Larvae and Pupae of American Bollworm (Helicoverpa armigera) including the Effect on Peritropme Membrane</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Deepali%20Lal">Deepali Lal</a>, <a href="https://publications.waset.org/abstracts/search?q=Sudha%20Summerwar"> Sudha Summerwar</a>, <a href="https://publications.waset.org/abstracts/search?q=Jyoutsna%20Pandey"> Jyoutsna Pandey</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The resistance of pesticide by the pest is an important matter of concern.The pesticide of plant origin having nontoxic biodegradable and environmentally friendly qualities. The frequent spraying of toxic chemicals is developing resistance to the pesticide. Leaf powder of the plants like Argimone mexicana and Calotropis procera is prepared, Different doses of these plant extracts are given to the Fourth in star stages of Helicoverpa armigera through feeding methods, to find their efficacy the experimental findings will be put under analysis using various parameters. The effect on paritrophic membrane is also studied. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=distillation%20plant" title="distillation plant">distillation plant</a>, <a href="https://publications.waset.org/abstracts/search?q=acetone" title=" acetone"> acetone</a>, <a href="https://publications.waset.org/abstracts/search?q=alcohol" title=" alcohol"> alcohol</a>, <a href="https://publications.waset.org/abstracts/search?q=pipette" title=" pipette"> pipette</a>, <a href="https://publications.waset.org/abstracts/search?q=castor%20leaves" title=" castor leaves"> castor leaves</a>, <a href="https://publications.waset.org/abstracts/search?q=grams%20pods" title=" grams pods"> grams pods</a>, <a href="https://publications.waset.org/abstracts/search?q=larvae%20of%20helicoverpa%20armigera" title=" larvae of helicoverpa armigera"> larvae of helicoverpa armigera</a>, <a href="https://publications.waset.org/abstracts/search?q=plant%20extract" title=" plant extract"> plant extract</a>, <a href="https://publications.waset.org/abstracts/search?q=vails" title=" vails"> vails</a>, <a href="https://publications.waset.org/abstracts/search?q=jars" title=" jars"> jars</a>, <a href="https://publications.waset.org/abstracts/search?q=cotton" title=" cotton"> cotton</a> </p> <a href="https://publications.waset.org/abstracts/48194/efficacy-of-some-plant-extract-against-larvae-and-pupae-of-american-bollworm-helicoverpa-armigera-including-the-effect-on-peritropme-membrane" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/48194.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">319</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">67</span> Insecticidal Effects of Plant Extract-Based Formulations on the Cotton Bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae)</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Reza%20Sadeghi">Reza Sadeghi</a>, <a href="https://publications.waset.org/abstracts/search?q=Maryam%20Nazarahari"> Maryam Nazarahari</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Considering the effectiveness of botanical pesticides in pest management, these compounds have garnered attention as a sustainable approach to reducing pest-induced damage in agriculture while preserving the environment. Botanical pesticides enable farmers to cultivate higher-quality crops by minimizing the use of chemical pesticides. In this study, plant extracts obtained using n-hexane as a solvent from two botanical sources, thyme and eucalyptus, were evaluated under laboratory conditions for their effectiveness in controlling the cotton bollworm (Helicoverpa armigera). The mortality rate of bollworm larvae was assessed across various concentrations of the hexane-based formulations. The results revealed that the hexane-based formulations of thyme and eucalyptus extracts significantly reduced the population of bollworm larvae after 24 hours of exposure. Thyme extract, in particular, demonstrated high effectiveness as a botanical pesticide, suggesting its potential as an efficient alternative to chemical pesticides in pest management. These findings underscore that botanical pesticides can mitigate the environmental consequences of chemical pesticides and provide innovative solutions for sustainable agriculture by leveraging the active compounds present in plant extracts. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cotton%20bollworm" title="cotton bollworm">cotton bollworm</a>, <a href="https://publications.waset.org/abstracts/search?q=thyme" title=" thyme"> thyme</a>, <a href="https://publications.waset.org/abstracts/search?q=eucalyptus" title=" eucalyptus"> eucalyptus</a>, <a href="https://publications.waset.org/abstracts/search?q=extract%20formulation" title=" extract formulation"> extract formulation</a>, <a href="https://publications.waset.org/abstracts/search?q=" title=" "> </a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity" title=" toxicity"> toxicity</a> </p> <a href="https://publications.waset.org/abstracts/195201/insecticidal-effects-of-plant-extract-based-formulations-on-the-cotton-bollworm-helicoverpa-armigera-hubner-lepidoptera-noctuidae" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/195201.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">4</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">66</span> Investigating the Insecticidal Effects of the Hexanic Extracts of Thymus spp. and Eucalyptus spp. on Cotton Bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae)</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Reza%20Sadeghi">Reza Sadeghi</a>, <a href="https://publications.waset.org/abstracts/search?q=Maryam%20Nazarahari"> Maryam Nazarahari</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Considering the effectiveness of plant pesticides in pest control, this group of pesticides can provide an efficient way to reduce the damage caused by pests in agriculture and maintain environmental health. Plant pesticides allow farmers to cultivate their crops by lowering the use of chemical pesticides and help improve the quality of agricultural products. In this research, various plant compounds were extracted from two different sources, thyme and eucalyptus, by using n-hexane solvent and investigated to control cotton bollworm in laboratory conditions. The mortality rates of cotton bollworm (Helicoverpa armigera) caused by different concentrations of hexanic extract formulations were evaluated. The results showed that the varied concentrations of the hexanic extract formulations of thyme and eucalyptus had significant effects on the mortality rates of cotton bollworm larvae during a 24-h exposure period. The hexanic extract of thyme as a plant pesticide can be an effective alternative in agriculture and plant pest control. The use of pesticides in agriculture can help the environment and reduce the problems related to chemical toxins. Also, this research revealed that the types and compounds of plant pesticides can be effective in pest control and help to develop more efficient agricultural strategies. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cotton%20bollworm" title="cotton bollworm">cotton bollworm</a>, <a href="https://publications.waset.org/abstracts/search?q=thyme" title=" thyme"> thyme</a>, <a href="https://publications.waset.org/abstracts/search?q=eucalyptus" title=" eucalyptus"> eucalyptus</a>, <a href="https://publications.waset.org/abstracts/search?q=extract%20formulation" title=" extract formulation"> extract formulation</a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity" title=" toxicity"> toxicity</a> </p> <a href="https://publications.waset.org/abstracts/174044/investigating-the-insecticidal-effects-of-the-hexanic-extracts-of-thymus-spp-and-eucalyptus-spp-on-cotton-bollworm-helicoverpa-armigera-hubner-lepidoptera-noctuidae" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/174044.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">91</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">65</span> Geographic Variation in the Baseline Susceptibility of Helicoverpa armigera (Hubner) (Noctuidae: Lepidoptera) Field Populations to Bacillus thuringiensis Cry Toxins for Resistance Monitoring</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Arshad">Muhammad Arshad</a>, <a href="https://publications.waset.org/abstracts/search?q=M.%20Sufian"> M. Sufian</a>, <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20D.%20Gogi"> Muhammad D. Gogi</a>, <a href="https://publications.waset.org/abstracts/search?q=A.%20Aslam"> A. Aslam</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The transgenic cotton expressing Bacillus thuringiensis (Bt) provides an effective control of Helicoverpa armigera, a most damaging pest of the cotton crop. However, Bt cotton may not be the optimal solution owing to the selection pressure of Cry toxins. As Bt cotton express the insecticidal proteins throughout the growing seasons, there are the chances of resistance development in the target pests. A regular monitoring and surveillance of target pest’s baseline susceptibility to Bt Cry toxins is crucial for early detection of any resistance development. The present study was conducted to monitor the changes in the baseline susceptibility of the field population of H. armigera to Bt Cry1Ac toxin. The field-collected larval populations were maintained in the laboratory on artificial diet and F1 generation larvae were used for diet incorporated diagnostic studies. The LC₅₀ and MIC₅₀ were calculated to measure the level of resistance of population as a ratio over susceptible population. The monitoring results indicated a significant difference in the susceptibility (LC₅₀) of H. armigera for first, second, third and fourth instar larval populations sampled from different cotton growing areas over the study period 2016-17. The variations in susceptibility among the tested insects depended on the age of the insect and susceptibility decreased with the age of larvae. The overall results show that the average resistant ratio (RR) of all field-collected populations (FSD, SWL, MLT, BWP and DGK) exposed to Bt toxin Cry1Ac ranged from 3.381-fold to 7.381-fold for 1st instar, 2.370-fold to 3.739-fold for 2nd instar, 1.115-fold to 1.762-fold for 3rd instar and 1.141-fold to 2.504-fold for 4th instar, depicting maximum RR from MLT population, whereas minimum RR for FSD and SWL population. The results regarding moult inhibitory concentration of H. armigera larvae (1-4th instars) exposed to different concentrations of Bt Cry1Ac toxin indicated that among all field populations, overall Multan (MLT) and Bahawalpur (BWP) populations showed higher MIC₅₀ values as compared to Faisalabad (FSD) and Sahiwal (SWL), whereas DG Khan (DGK) population showed an intermediate moult inhibitory concentrations. This information is important for the development of more effective resistance monitoring programs. The development of Bt Cry toxins baseline susceptibility data before the widespread commercial release of transgenic Bt cotton cultivars in Pakistan is important for the development of more effective resistance monitoring programs to identify the resistant H. armigera populations. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Bt%20cotton" title="Bt cotton">Bt cotton</a>, <a href="https://publications.waset.org/abstracts/search?q=baseline" title=" baseline"> baseline</a>, <a href="https://publications.waset.org/abstracts/search?q=Cry1Ac%20toxins" title=" Cry1Ac toxins"> Cry1Ac toxins</a>, <a href="https://publications.waset.org/abstracts/search?q=H.%20armigera" title=" H. armigera"> H. armigera</a> </p> <a href="https://publications.waset.org/abstracts/99006/geographic-variation-in-the-baseline-susceptibility-of-helicoverpa-armigera-hubner-noctuidae-lepidoptera-field-populations-to-bacillus-thuringiensis-cry-toxins-for-resistance-monitoring" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/99006.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">141</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">64</span> Screening the Best Integrated Pest Management Treatments against Helicoverpa armigera</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ajmal%20Khan%20Kassi">Ajmal Khan Kassi</a>, <a href="https://publications.waset.org/abstracts/search?q=Humayun%20Javed"> Humayun Javed</a>, <a href="https://publications.waset.org/abstracts/search?q=Tariq%20Mukhtar"> Tariq Mukhtar</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The research was conducted to screen out resistance and susceptibility of okra varieties against Helicoverpa armigera under field conditions 2016. In this experiment, the different management practices viz. release Trichogramma chilonis, hoeing, and weeding, clipping, and lufenuron were tested individually and with all possible combinations for the controlling of American bollworm at 3 diverse localities viz. University research farm Koont, National Agriculture Research Centre (NARC) and farmer field Taxila by using resistant variety Arka Anamika. All the treatment combinations regarding damage of shoot and fruit showed significant results. The minimum fruit infestation, i.e., 3.20% and 3.58% was recorded with combined treatment (i.e., T. chilonis + hoeing + weeding + lufenuron) in two different localities. The minimum shoot infestation, i.e., 7.18%, 7.08%, and 6.85% was also observed with (T. chilonis + hoeing + weeding + lufenuron) combined treatment at all three different localities. The above-combined treatment (T. chilonis + hoeing + weeding + lufenuron) also resulted in maximum yield at NARC and Taxila, i.e., 57.67 and 62.66 q/ha respectively. On the basis of combined treatment (i.e., T. chilonis + hoeing + weeding + lufenuron) in three different localities, Arka Anamika variety proved to be comparatively resistant against H. armigera. So this variety is recommended for the cultivation in Pothwar region to get maximum yield and minimum losses against H. armigera. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=okra" title="okra">okra</a>, <a href="https://publications.waset.org/abstracts/search?q=screening" title=" screening"> screening</a>, <a href="https://publications.waset.org/abstracts/search?q=combine%20treatment" title=" combine treatment"> combine treatment</a>, <a href="https://publications.waset.org/abstracts/search?q=Helicoverpa%20armigera" title=" Helicoverpa armigera"> Helicoverpa armigera</a> </p> <a href="https://publications.waset.org/abstracts/107520/screening-the-best-integrated-pest-management-treatments-against-helicoverpa-armigera" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/107520.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">155</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">63</span> Insecticidal Effect of Nanoparticles against Helicoverpa armigera Infesting Chickpea</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Shabistana%20Nisar">Shabistana Nisar</a>, <a href="https://publications.waset.org/abstracts/search?q=Parvez%20Qamar%20Rizvi"> Parvez Qamar Rizvi</a>, <a href="https://publications.waset.org/abstracts/search?q=Sheeraz%20Malik"> Sheeraz Malik</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The potential advantage of nanotechnology is comparably marginal due to its unclear benefits in agriculture and insufficiency in public opinion. The nanotech products might solve the pesticide problems of societal concern fairly at acceptable or low risk for consumers and environmental applications. The deleterious effect of chemicals used on crops can be compacted either by reducing the existing active ingredient to nanosize or by plummeting the metals into nanoform. Considering the above facts, an attempt was made to determine the efficacy of nanoelements viz., Silver, Copper Manganese and Neem seed kernel extract (NSKE) for effective management of gram pod borer, Helicoverpa armigera infesting chickpea, being the most damaging pest of large number of crops, gram pod borer was selected as test insect to ascertain the impact of nanoparticles under controlled conditions (25-27 ˚C, 60-80% RH). The respective nanoformulations (0.01, 0.005, 0.003, 0.0025, 0.002, 0.001) were topically applied on 4th instar larvae of pod borer. In general, nanochemicals (silver, copper, manganese, NSKE) produced relatively high mortality at low dilutions (0.01, 0.005, 0.003). The least mortality was however recorded at 0.001 concentration. Nanosilver proved most efficient producing significantly highest (f₄,₂₄=129.56, p < 0.05) mortality 63.13±1.77, 83.21±2.02 and 96.10±1.25 % at 0.01 concentration after 2nd, 4th and 6th day, respectively. The least mortality was however recorded with nanoNSKE. The mortality values obtained at respective days were 21.25±1.50%, 25.20±2.00%, and 56.20±2.25%. Nanocopper and nanomanganese showed slow rate of killing on 2nd day of exposure, but increased (79.20±3.25 and 65.33±1.25) at 0.01 dilution on 3rd day, followed by 83.00±3.50% and 70.20±2.20% mortality on 6thday. The sluggishness coupled with antifeedancy was noticed at early stage of exposure. The change in body colour to brown due to additional melanisation in copper, manganese, and silver treated larvae and demalinization in nanoNSKE exposed larvae was observed at later stage of treatment. Thus, all the nanochemicals applied, produced the significant lethal impact on Helicoverpa armigera and can be used as valuable tool for its effective management. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=chickpea" title="chickpea">chickpea</a>, <a href="https://publications.waset.org/abstracts/search?q=helicoverpa%20armigera" title=" helicoverpa armigera"> helicoverpa armigera</a>, <a href="https://publications.waset.org/abstracts/search?q=management" title=" management"> management</a>, <a href="https://publications.waset.org/abstracts/search?q=nanoparticles" title=" nanoparticles"> nanoparticles</a> </p> <a href="https://publications.waset.org/abstracts/70269/insecticidal-effect-of-nanoparticles-against-helicoverpa-armigera-infesting-chickpea" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/70269.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">358</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">62</span> Density and Relationships Between the Assassin Bugs Sycanus Falleni Stal and Sycanus Croceovittatus Dohrn (Hemiptera: Reduviidae) and Their Prey (Noctuidae: Lepidoptera) on Corn Biomass in the Hoa Binh Province in Northwest Vietnam</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Truong%20Xuan%20Lam">Truong Xuan Lam</a>, <a href="https://publications.waset.org/abstracts/search?q=Nguyen%20Th%E1%BB%8B%20Phuong%20Lien"> Nguyen Thị Phuong Lien</a>, <a href="https://publications.waset.org/abstracts/search?q=Nguyen%20Quang%20Cuong"> Nguyen Quang Cuong</a>, <a href="https://publications.waset.org/abstracts/search?q=Tran%20Th%E1%BB%8B%20Ngat"> Tran Thị Ngat</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Introduction: Corn biomass is a feed for livestock including dairy cows. The Spodoptera frugiperda, Agrotis ypsilon, Heliothis armigera, Mythimna loreyi (Lepidoptera: Noctuidae) are key pests and very dangerous to Corn biomass crops. These pest species are very difficult to control in the field because of genetic resistance to insecticides. Furthermore, corn biomass is feed for livestock so the use of pesticides is always limited to the lowest level. In Vietnam, the assassin bug species Sycanus falleni and Sycanus croceouittatus (Hemiptera: Reduviidae) are the common predators on trees agricultural ecosystems. The reduviid S. falleni and S. croceouittatus have the potential for biological control of pest insects in cotton, corn and vegetable plants as this species attacks many lepidopteran larvae. Moreover, the nymphal instars and adults of S. falleni and S. croceouittatus can be easily reared in the laboratory by the rice meal moth Corcyra cephalonica (Stainton). To conserve the species S. falleni and S. croceouittatus in Corn biomass field in Northwest Vietnam. The results of this study report on the roles and relationships between S. falleni Stal and S. croceovittatus and their prey (key pests and dangerous to Corn) on Corn biomass to provide the basis for using and conserving the species S. falleni and S. croceouittatus as biological control agents on Corn biomass growing areas in Vietnam. Methods: The survey site is at the field of Corn biomass growing in Hoa Binh Province, Northwest Vietnam. The survey of the density of the assassin bugs species and their prey were conducted in 4 Corn biomass fields (each field = 10,000 m2), each point has an area of 1 m2. The survey was conducted every 10 days (3 times/month). The unit of measurement is individual/m2. The relationship between the density of assassin bug species and their prey is expressed through the correlation coefficient R Results: On Corn biomass in Northwest Vietnam, the S. falleni and S. croceouittatus species are such potential candidates for biocontrol of the fall armyworm S. frugiperda, black cutworm A. ypsilon, cotton bollworm H. armigera Hübner, maize caterpillar M. loreyi. Six species of assassin bugs belonging to the family Reduviidae were recorded on Corn biomass, of which S. falleni and S. croceovittatus were common. The relationship between the density of the group of assassin bugs and species S. fallen and S. croceovittatus had a close relationship with each other. The relationship between the density of the group of assassin bugs and the density of their prey in the Winter crops and Summer-Fall crops was a close relationship with each other. The relationship between the density of the S. falleni and S. croceovittatus species and the density of their prey on the Corn biomass were a close relationship in the Summer-Fall crops and the Winter crops. The S. falleni and S. croceouittatus species are such potential biocontrol of the pests on Corn. Possible to conserve and use them for biological control of the dangerous pests S. frugiperda, A. ypsilon, H. armigera , M. loreyi on Corn in Vietnam. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=corn%20biomass" title="corn biomass">corn biomass</a>, <a href="https://publications.waset.org/abstracts/search?q=prey" title=" prey"> prey</a>, <a href="https://publications.waset.org/abstracts/search?q=biocontrol" title=" biocontrol"> biocontrol</a>, <a href="https://publications.waset.org/abstracts/search?q=relationship" title=" relationship"> relationship</a> </p> <a href="https://publications.waset.org/abstracts/189848/density-and-relationships-between-the-assassin-bugs-sycanus-falleni-stal-and-sycanus-croceovittatus-dohrn-hemiptera-reduviidae-and-their-prey-noctuidae-lepidoptera-on-corn-biomass-in-the-hoa-binh-province-in-northwest-vietnam" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/189848.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">35</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">61</span> Species Composition of Lepidoptera (Insecta: Lepidoptera) Inhabited on the Saxaul (Chenopodiáceae: Haloxylon spp.) in the Desert Area of South-East Kazakhstan</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=N.%20Tumenbayeva">N. Tumenbayeva</a> </p> <p class="card-text"><strong>Abstract:</strong></p> At the present time in Kazakhstan, the area for saxaul growing is strongly depopulateddue to anthropogenic and other factors. To prevent further reduction of natural haloxylon forest area their artificial crops are offered. Seed germination and survival of young plants in such haloxylon crops are very low. Insects, as one of the most important nutrient factors have appreciable effect on seed germination and saxaul productivity at the all stages of its formation. Insects, feeding on leaves, flowers, seeds and developing inside the trunk, branches, twigs, roots have a change in its formation and influence on the lifespan of saxaul. Representatives of Lepidoptera troop (Lepidopteraare the most harmful pests forsaxaul. As a result of our research we have identified 15 species of Lepidoptera living on haloxylon which display very different cycles and different types of food relations. It allows them to inhabit a variety of habitats, and feeding on various parts of saxaul. Some of them cause significant and sometimes very heavy damage for saxaul. There are 17identified species of Lepidoptera from the Coleophoridaefamily - 1, Gelechidae - 5, Pyralidae - 4, Noctuidae - 4, Lymantridae- 1, Cossidae - 2 species. At the same time we found 8 species for the first time, which have not been mentioned in the literature before. According to food specialization they are divided into monophages (2 types), oligophages (6 species) and polyphages (3 species). By affinity to plant parts, leaves and seeds are fed by 8 species, shoots by 1 specie, scions by 5 species, flowers, scions, seeds by 1, and 2species damage the roots and trunks. In whole installed seasonal groups of Lepidoptera - saxaul pests in the desert area, confined to the certain parts of the year, as well as certain parts of the plant for feeding. Harmfulness, depending on their activity appear during the growing season is also different. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=saxaul" title="saxaul">saxaul</a>, <a href="https://publications.waset.org/abstracts/search?q=Lepidoptera" title=" Lepidoptera"> Lepidoptera</a>, <a href="https://publications.waset.org/abstracts/search?q=insecta" title=" insecta"> insecta</a>, <a href="https://publications.waset.org/abstracts/search?q=haloxylon" title=" haloxylon"> haloxylon</a> </p> <a href="https://publications.waset.org/abstracts/33307/species-composition-of-lepidoptera-insecta-lepidoptera-inhabited-on-the-saxaul-chenopodiaceae-haloxylon-spp-in-the-desert-area-of-south-east-kazakhstan" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/33307.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">323</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">60</span> Occurrence of the fall armyworm, Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae), on Maize in Katsina State, Nigeria and preliminary study of its Developmental Characteristics under Laboratory Conditions</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ibrahim%20Sani">Ibrahim Sani</a>, <a href="https://publications.waset.org/abstracts/search?q=Suleiman%20Mohammed."> Suleiman Mohammed.</a>, <a href="https://publications.waset.org/abstracts/search?q=Salisu%20Sulaiman"> Salisu Sulaiman</a>, <a href="https://publications.waset.org/abstracts/search?q=Aminu%20Musa"> Aminu Musa</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The fall army worm (FAW), Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae) has recently become one of the major threats to maize production in the world. It is native to tropical and subtropical America and began to spread to many African and a few Asian Countries. A survey for the observation of infestation and collection of fall armyworm was conducted in field planted with maize in the northern part of Katsina state. Eggs and immature stages were collected, place in a plastic container and brought to the laboratory for observation and study of developmental stages. FAW was identified based on the morphological characteristics, i.e. the “Y” inverted shape on the head capsule and the patterns of black spots on the abdominal segments (square and trapezoidal forms). Different growing stage of maize are affected by fall armyworm, but the damage is greatest during the early growing phase of corn. Heavy infestation on the leaves also cause defoliation. Four developmental stages (eggs larvae, pupae and adults) of the FAW were studied when fed with young corn under laboratory conditions. Furthermore, effective scouting or monitoring of FAW could be practice at early stage of growth of maize. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=infestation" title="infestation">infestation</a>, <a href="https://publications.waset.org/abstracts/search?q=katsina" title=" katsina"> katsina</a>, <a href="https://publications.waset.org/abstracts/search?q=maize" title=" maize"> maize</a>, <a href="https://publications.waset.org/abstracts/search?q=fall%20armyworm" title=" fall armyworm"> fall armyworm</a> </p> <a href="https://publications.waset.org/abstracts/180992/occurrence-of-the-fall-armyworm-spodoptera-frugiperda-j-e-smith-lepidoptera-noctuidae-on-maize-in-katsina-state-nigeria-and-preliminary-study-of-its-developmental-characteristics-under-laboratory-conditions" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/180992.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">74</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">59</span> Insecticidal and Antifeedant Activity of Rosemary´s (Rosmarinus Officinalis L.) Different Extracts on Cotton Bollworm Helicoverpa Armigera Hubner</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Monireh%20Movahedi">Monireh Movahedi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Considering undesirable effects of chemical insecticides on environment and human health, most studies focused on insecticidal effects of plant materials. Here, the insecticidal effects of methanol, ethylacetat and n-Hexan extracts of Rosmarinus officinalis L. on larval stage of the cotton bollworm were studied. From each extract, six concentrations, including 5, 10, 20, 40 and 60 mg/ml were prepared and added on larval artificial diet. Moreover, solution of distilled water and tween 2% considered as check treatment. All experiments were done in laboratory temperature of 25±3 ºC, RH =50±10% and natural photoperiod during growing season. Each treatment had four replications and each replication carried out on 10 first instar larva with <24h age. Larval mortality was recorded 3 and 7 days after treat. Based on results, LC50 of methanol, ethylacetat and n-Hexan extracts of R. officinalis were 2.78, 15.87 and 15.70 ml/mg, respectively. On the other hand, antifeedant effect of methanol, ethylacetat and n-Hexan for R. officinalis estimated as 43.13%, 55.11% and 9.19%, respectively. All the obtained results revealed that methanol and ethylacetat extracts of R. officinalis are effective extracts for controlling the cotton bollworm population. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Helocoverpa%20armigera" title="Helocoverpa armigera">Helocoverpa armigera</a>, <a href="https://publications.waset.org/abstracts/search?q=Rosemarinus%20officinalis" title=" Rosemarinus officinalis"> Rosemarinus officinalis</a>, <a href="https://publications.waset.org/abstracts/search?q=extract" title=" extract"> extract</a>, <a href="https://publications.waset.org/abstracts/search?q=methanol" title=" methanol"> methanol</a>, <a href="https://publications.waset.org/abstracts/search?q=ethylacetat" title=" ethylacetat"> ethylacetat</a>, <a href="https://publications.waset.org/abstracts/search?q=n-Hexan" title=" n-Hexan"> n-Hexan</a> </p> <a href="https://publications.waset.org/abstracts/122787/insecticidal-and-antifeedant-activity-of-rosemarys-rosmarinus-officinalis-l-different-extracts-on-cotton-bollworm-helicoverpa-armigera-hubner" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/122787.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">171</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">58</span> Variation in Carboxylesterase Activity in Spodoptera litura Fabricious (Noctuidae: Lepidoptera) Populations from India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=V.%20Karuppaiah">V. Karuppaiah</a>, <a href="https://publications.waset.org/abstracts/search?q=J.%20C.%20Padaria"> J. C. Padaria</a>, <a href="https://publications.waset.org/abstracts/search?q=C.%20Srivastava"> C. Srivastava</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura Fab (Lepidoptera: Noctuidae) is a polyphagous pest various field and horticulture crops in India. Pest had virtually developed resistance to all commonly used insecticides. Enhanced detoxification is the prime mechanism that is dictated by detoxification different enzymes and carboxylesterase is one of the major enzyme responsible development of resistance. In India, insecticide resistance studies on S. litura are mainly deployed on detoxification enzymes activity and investigation at gene level alteration i.e. at nucleotide level is very merger. In the present study, we collected the S. litura larvae from three different cauliflower growing belt viz., IARI, New Delhi (Delhi), Palari, Sonepat (Haryana) and Varanasi (Uttar Pradesh) to study the role of carboxylesterase activity and its gene level variation The CarE activity was measured using UV-VIS spectrophotometer with 3rd instar larvae of S. litura. The elevated activity of CarE was observed in Sonepat strain (28.09 ± 0.09 µmol/min/mg of protein) followed by Delhi (26.72 ± 0.04 µmol/min/mg of protein) and Varanasi strain (10.00 ± 0.44 µmol/min/mg of protein) of S. litura. The genomic DNA was isolated from 3rd instar larvae and CarE gene was amplified using a primer sequence, F:5’tccagagttccttgtcaggcac3’; R:5’ctgcatcaagcatgtctc3. CarE gene, about 500bp was partially amplified, sequenced and submitted to NCBI (Accession No. KF835886, KF835887 and KF835888). The sequence data revealed polymorphism at nucleotide level in all the three strains and gene found to have 88 to 97% similarity with previous available nucleotide sequences of S. litura, S. littoralis and S. exiqua. The polymorphism at the nucleotide level could be a reason for differential activity of carboxylesterase enzymes among the strains. However, investigation at gene expression level would be useful to analyze the overproduction of carboxylesterase enzyme. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=carboxylesterase" title="carboxylesterase">carboxylesterase</a>, <a href="https://publications.waset.org/abstracts/search?q=CarE%20gene" title=" CarE gene"> CarE gene</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide%20polymorphism" title=" nucleotide polymorphism"> nucleotide polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a> </p> <a href="https://publications.waset.org/abstracts/13619/variation-in-carboxylesterase-activity-in-spodoptera-litura-fabricious-noctuidae-lepidoptera-populations-from-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/13619.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">922</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">57</span> Antifeedant Activity of Methanol and Hexane Extracts of Datura Innoxia (Mill.) (Solanaceae) in the Management of Spodoptera Litura (F.) (Lepidoptera: Noctuidae) Larvae </h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Vagisha%20Rawal">Vagisha Rawal</a>, <a href="https://publications.waset.org/abstracts/search?q=Anupam%20V.%20Sharma"> Anupam V. Sharma</a>, <a href="https://publications.waset.org/abstracts/search?q=Tarun%20Kumar%20Vats"> Tarun Kumar Vats</a>, <a href="https://publications.waset.org/abstracts/search?q=Ashok%20Kumar%20Singh"> Ashok Kumar Singh</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The antifeedant activity of methanol and hexane extract of leaves and seeds of Datura innoxia (Mill.) (Solanaceae) was evaluated against the 5th instar Spodoptera litura (F.) (Lepidoptera: Noctuidae) larvae in choice and no-choice leaf disc bioassays under laboratory conditions. These larvae when given a choice between the ‘control’ and ‘treated’ leaf discs in choice bioassays, consumed significantly (p ˂ 0.05) greater area of the ‘control’ leaf discs compared to those treated with the crude extracts of leaves and seeds of D. innoxia. The Antifeedant Index (AFI) for 5% concentration of the hexane extract of Datura seeds (DSHE) was 43.3% and 38.5% for methanol extract of Datura seeds (DSME). On the other hand, these values were 34.1% for the hexane extract of Datura leaves (DLHE), and 31.0% for the methanol extract of Datura leaves (DLME), respectively. In no-choice bioassays also, there was a significant (p˂0.05) reduction in the larval consumption of ‘treated’ leaf discs compared to the ‘control’ leaf discs. Maximum AFI was recorded at 5% concentration of the extracts of both the leaves and seeds with 47.7% for DSHE against 40.0% (DSME) and 39.4% for DLHE compared with 38.4% (DLME). Moreover, DSHE was found to have the maximum antifeedant effect irrespective of its concentration in comparison to the other crude extracts of leaves or seeds of D. innoxia. It is evident from these results that the crude methanol and hexane extracts of leaves and seeds of D. innoxia exhibited potent antifeedant activity against the 5th instar S. litura larvae. Also, the use of the bioactive compound(s) present in these extracts can prove to be an effective, eco-friendly, viable and sustainable component that can be integrated in IPM programs for the management of this economically important polyphagous insect pest in the Indian subcontinent. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antifeedant%20activity" title="antifeedant activity">antifeedant activity</a>, <a href="https://publications.waset.org/abstracts/search?q=antifeedant%20index" title=" antifeedant index"> antifeedant index</a>, <a href="https://publications.waset.org/abstracts/search?q=datura%20innoxia" title=" datura innoxia"> datura innoxia</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a> </p> <a href="https://publications.waset.org/abstracts/37846/antifeedant-activity-of-methanol-and-hexane-extracts-of-datura-innoxia-mill-solanaceae-in-the-management-of-spodoptera-litura-f-lepidoptera-noctuidae-larvae" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/37846.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">521</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">56</span> Determination of Biological Efficiency Values of Some Pesticide Application Methods under Second Crop Maize Conditions</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ali%20Bolat">Ali Bolat</a>, <a href="https://publications.waset.org/abstracts/search?q=Ali%20Bayat"> Ali Bayat</a>, <a href="https://publications.waset.org/abstracts/search?q=Mustafa%20Gullu"> Mustafa Gullu</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Maize can be cultivated both under main and second crop conditions in Turkey. Main pests of maize under second crop conditions are Sesamia nonagrioides Lefebvre (Lepidoptera: Noctuidae) and Ostrinia nubilalis Hübner (Lepidoptera: Crambidae). Aerial spraying applications to control these two main maize pests can be carried out until 2006 in Turkey before it was banned due to environmental concerns like drifting of sprayed pestisides and low biological efficiency. In this context, pulverizers which can spray tall maize plants ( > 175 cm) from the ground have begun to be used. However, the biological efficiency of these sprayers is unknown. Some methods have been tested to increase the success of ground spraying in field experiments conducted in second crop maize in 2008 and 2009. For this aim, 6 spraying methods (air assisted spraying with TX cone jet, domestic cone nozzles, twinjet nozzles, air induction nozzles, standard domestic cone nozzles and tail booms) were used at two application rates (150 and 300 l.ha-1) by a sprayer. In the study, biological efficacy evaluations of each methods were measured in each parcel. Biological efficacy evaluations included counts of number of insect damaged plants, number of holes in stems and live larvae and pupa in stems of selected plants. As a result, the highest biological efficacy value (close to 70%) was obtained from Air Assisted Spraying method at 300 l / ha application volume. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=air%20assisted%20sprayer" title="air assisted sprayer">air assisted sprayer</a>, <a href="https://publications.waset.org/abstracts/search?q=drift%20nozzles" title=" drift nozzles"> drift nozzles</a>, <a href="https://publications.waset.org/abstracts/search?q=biological%20efficiency" title=" biological efficiency"> biological efficiency</a>, <a href="https://publications.waset.org/abstracts/search?q=maize%20plant" title=" maize plant"> maize plant</a> </p> <a href="https://publications.waset.org/abstracts/79987/determination-of-biological-efficiency-values-of-some-pesticide-application-methods-under-second-crop-maize-conditions" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/79987.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">213</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">55</span> Autophagy in the Midgut Epithelium of Spodoptera exigua Hübner (Lepidoptera: Noctuidae) Larvae Exposed to Various Cadmium Concentration - 6-Generational Exposure</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Magdalena%20Maria%20Rost-Roszkowska">Magdalena Maria Rost-Roszkowska</a>, <a href="https://publications.waset.org/abstracts/search?q=Alina%20Chachulska-%C5%BByme%C5%82ka"> Alina Chachulska-Żymełka</a>, <a href="https://publications.waset.org/abstracts/search?q=Monika%20Tarnawska"> Monika Tarnawska</a>, <a href="https://publications.waset.org/abstracts/search?q=Maria%20Augustyniak"> Maria Augustyniak</a>, <a href="https://publications.waset.org/abstracts/search?q=Alina%20Kafel"> Alina Kafel</a>, <a href="https://publications.waset.org/abstracts/search?q=Agnieszka%20Babczy%C5%84ska"> Agnieszka Babczyńska</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Autophagy is a form of cell remodeling in which an internalization of organelles into vacuoles that are called autophagosomes occur. Autophagosomes are the targets of lysosomes, thus causing digestion of cytoplasmic components. Eventually, it can lead to the death of the entire cell. However, in response to several stress factors, e.g., starvation, heavy metals (e.g., cadmium) autophagy can also act as a pro-survival factor, protecting the cell against its death. The main aim of our studies was to check if the process of autophagy, which could appear in the midgut epithelium after Cd treatment, can be fixed during the following generations of insects. As a model animal, we chose the beet armyworm Spodoptera exigua Hübner (Lepidoptera: Noctuidae), a well-known polyphagous pest of many vegetable crops. We analyzed specimens at final larval stage (5th larval stage), due to its hyperfagy, resulting in great amount of cadmium assimilate. The culture consisted of two strains: a control strain (K) fed a standard diet, and a cadmium strain (Cd), fed on standard diet supplemented with cadmium (44 mg Cd per kg of dry weight of food) for 146 generations, both strains. In addition, the control insects were transferred to the Cd supplemented diet (5 mg Cd per kg of dry weight of food, 10 mg Cd per kg of dry weight of food, 20 mg Cd per kg of dry weight of food, 44 mg Cd per kg of dry weight of food). Therefore, we obtained Cd1, Cd2, Cd3 and KCd experimental groups. Autophagy has been examined using transmission electron microscope. During this process, degenerated organelles were surrounded by a membranous phagophore and enclosed in an autophagosome. Eventually, after the autophagosome fused with a lysosome, an autolysosome was formed and the process of the digestion of organelles began. During the 1st year of the experiment, we analyzed specimens of 6 generations in all the lines. The intensity of autophagy depends significantly on the generation, tissue and cadmium concentration in the insect rearing medium. In the Ist, IInd, IIIrd, IVth, Vth and VIth generation the intensity of autophagy in the midguts from cadmium-exposed strains decreased gradually according to the following order of strains: Cd1, Cd2, Cd3 and KCd. The higher amount of cells with autophagy was observed in Cd1 and Cd2. However, it was still higher than the percentage of cells with autophagy in the same tissues of the insects from the control and multigenerational cadmium strain. This may indicate that during 6-generational exposure to various Cd concentration, a preserved tolerance to cadmium was not maintained. The study has been financed by the National Science Centre Poland, grant no 2016/21/B/NZ8/00831. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=autophagy" title="autophagy">autophagy</a>, <a href="https://publications.waset.org/abstracts/search?q=cell%20death" title=" cell death"> cell death</a>, <a href="https://publications.waset.org/abstracts/search?q=digestive%20system" title=" digestive system"> digestive system</a>, <a href="https://publications.waset.org/abstracts/search?q=ultrastructure" title=" ultrastructure"> ultrastructure</a> </p> <a href="https://publications.waset.org/abstracts/90369/autophagy-in-the-midgut-epithelium-of-spodoptera-exigua-hubner-lepidoptera-noctuidae-larvae-exposed-to-various-cadmium-concentration-6-generational-exposure" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/90369.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">233</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">54</span> Management of H. Armigera by Using Various Techniques</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ajmal%20Khan%20Kassi">Ajmal Khan Kassi</a>, <a href="https://publications.waset.org/abstracts/search?q=Humayun%20Javed"> Humayun Javed</a>, <a href="https://publications.waset.org/abstracts/search?q=Syed%20Abdul%20Qadeem"> Syed Abdul Qadeem</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The study was conducted to find out the best management practices against American bollworm on Okra variety Arka Anamika during 2016. The three different management practices viz. Release of Trichogramma chilonis, hoeing and weeding, clipping and lufenuron insect growth regulator (IGR) which were tested individually and with all possible combinations for the controlling of American bollworm at 3 diverse areas viz. University Research Farm Koont, NARC and Farmer Field Taxila. All the treatment combinations regarding damage of fruit showed significant results. The minimum fruit infestation i.e. 3.20% and 3.58% was recorded with combined treatment (i.e. T. chilonis + hoeing + weeding + lufenuron) in two different localities. This combined treatment also resulted in maximum yield at NARC and Taxila i.e. 57.67 and 62.66 q/ha respectively. This treatment gave the best results to manage H. armigera. On the basis of different integrated pest management techniques, Arka Anamika variety proved to be comparatively resistant against H. armigera in different localities. So this variety is recommended for the cultivation in Pothwar region to get maximum yield. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=management" title="management">management</a>, <a href="https://publications.waset.org/abstracts/search?q=american%20bollworm" title=" american bollworm"> american bollworm</a>, <a href="https://publications.waset.org/abstracts/search?q=arka%20anamika" title=" arka anamika"> arka anamika</a>, <a href="https://publications.waset.org/abstracts/search?q=okra" title=" okra"> okra</a> </p> <a href="https://publications.waset.org/abstracts/181762/management-of-h-armigera-by-using-various-techniques" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/181762.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">55</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">53</span> The Impact of Three Different Insecticides Against Fall Armyworms on Maize Productivity, in Somalia</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ahmed%20Ali%20Hassan">Ahmed Ali Hassan</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The fall armyworm (FAW) was first identified in 2016 in Africa. FAW is widely distributed in Somalia and severely damages the maize crop. The effect of three different pesticides used to control the autumn armyworm, Spodoptera frugiperda (Noctuidae: Lepidoptera), on maize productivity was investigated in this study. During the 2020–2021 growing season, three insecticides (Malathion 57 EC, Ampligo150 ZC, and Carbryle 85 WP) were evaluated at field demonstration plots. Our result showed that significant mortality of S. frugiperda was observed on the treatment plot treated with Amplico. After spraying, Ampligo resulted in (92.200%) larval death. Compared to Carbaryl, which was less active and only caused 36.367% mortality after application, Malathion had a moderate mortality rate of 53.733%. Consequently, our current finding shows that the three selected insecticides reduced the damage and infestation level of S. frugiperda in the maize field conditions, and the most effective treatment was Amplico. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=maize" title="maize">maize</a>, <a href="https://publications.waset.org/abstracts/search?q=fall%20armyworm" title=" fall armyworm"> fall armyworm</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticides" title=" insecticides"> insecticides</a>, <a href="https://publications.waset.org/abstracts/search?q=mortality" title=" mortality"> mortality</a> </p> <a href="https://publications.waset.org/abstracts/191889/the-impact-of-three-different-insecticides-against-fall-armyworms-on-maize-productivity-in-somalia" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/191889.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">26</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">52</span> A Faunistic Comparative Study of Families Hesperiidae and Nymphalidae (Lepidoptera: Rhopalocera) of Syrian Arab Republic and Republic of Armenia</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=N.%20Zarikian">N. Zarikian</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Comparative analysis of the fauna of two families of butterflies (Lepidoptera: Rhopalocera) – Hesperiidae and Nymphalidae were carried out. In general, 122 species of the families are recorded. among these 33 species belong to Hesperiidae and 89 to Nymphalidae. The numbers by countries are as follows: 72 species are found in Syria (including 24 Hesperiidae and 48 Nymphalidae) and 97 in Armenia (26 and 71 species, respectively). Two species of Hesperiidae are reported for Syrian fauna for the first time and one species is newly recorded for Armenia. From the species above mentioned 38 are common both for Syria and Armenia. For estimation of the similarity of faunas studied were used the Jaccard index. By families the index is rather different, consisting for Hesperiidae 0.5151 and for Nymphalidae 0.337. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Armenia" title="Armenia">Armenia</a>, <a href="https://publications.waset.org/abstracts/search?q=fauna" title=" fauna"> fauna</a>, <a href="https://publications.waset.org/abstracts/search?q=Hesperiidae" title=" Hesperiidae"> Hesperiidae</a>, <a href="https://publications.waset.org/abstracts/search?q=Nymphalidae" title=" Nymphalidae"> Nymphalidae</a>, <a href="https://publications.waset.org/abstracts/search?q=%28Rhopalocera%3A%20Lepidoptera%29" title=" (Rhopalocera: Lepidoptera)"> (Rhopalocera: Lepidoptera)</a>, <a href="https://publications.waset.org/abstracts/search?q=Syria" title=" Syria"> Syria</a> </p> <a href="https://publications.waset.org/abstracts/48129/a-faunistic-comparative-study-of-families-hesperiidae-and-nymphalidae-lepidoptera-rhopalocera-of-syrian-arab-republic-and-republic-of-armenia" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/48129.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">252</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">51</span> Evaluation of the Most Effective Insecticides against the Spodoptera Frugiperda, on the Maize Production</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ahmed%20Ali%20Hassan">Ahmed Ali Hassan</a> </p> <p class="card-text"><strong>Abstract:</strong></p> In 2016, the Fall Armyworm (FAW) was first discovered in Africa. FAW is abundantly present in Somalia and seriously harms the maize crop. This investigation examined the impact on maize productivity of three different pesticides used to combat the autumn armyworm, Spodoptera frugiperda (Noctuidae: Lepidoptera). During the 2020–2021 growing season, three insecticides (Malathion 57 EC, Ampligo150 ZC, and Carbryle 85 WP) were evaluated at field demonstration plots. Our result showed that, significant mortality of S. frugiperda was observed on the treatment plot treated with Amplico. Ampligo caused over 90% larval mortality after application. Malathion had moderate activity, causing 53.733% mortality after application, while Carbaryl was less effective, causing 36.367% mortality after application. Consequently, the current finding shows that the three selected insecticides reduced the damage and infestation level of S. frugiperda in the maize field conditions and the most effective treatment were Amplico. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=pesticides" title="pesticides">pesticides</a>, <a href="https://publications.waset.org/abstracts/search?q=maize%20fall%20army%20worm" title=" maize fall army worm"> maize fall army worm</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticides" title=" insecticides"> insecticides</a>, <a href="https://publications.waset.org/abstracts/search?q=mortality" title=" mortality"> mortality</a>, <a href="https://publications.waset.org/abstracts/search?q=S.%20frugiperda" title=" S. frugiperda"> S. frugiperda</a> </p> <a href="https://publications.waset.org/abstracts/169800/evaluation-of-the-most-effective-insecticides-against-the-spodoptera-frugiperda-on-the-maize-production" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/169800.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">70</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">50</span> Antagonistic Potential of Trichoderma Strains against Colletotrichum musae</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Shah%20Md.%20Asraful%20Islam">Shah Md. Asraful Islam</a>, <a href="https://publications.waset.org/abstracts/search?q=Shabina%20Yeasmin"> Shabina Yeasmin</a>, <a href="https://publications.waset.org/abstracts/search?q=Fatima%20Aktar%20Mousumi"> Fatima Aktar Mousumi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The experiment was conducted to evaluate the antagonistic potential of three commercially available Trichoderma strains viz., T. harzianum (armigera), T. harzianum (Ispahani), and T. viride against Colletotrichum musae isolates from three banana varieties viz., sagar, sobri, and katali. Mycelial growth rates of C. musae isolates were observed, the highest mycelial growth (11.62, 15.75, and 23.12 mm diameter) was observed by C. musae from sagor banana at 1, 2 and 3 days after inoculation, respectively. All the Trichoderma strains were capable of growth inhibition of C. musae isolates. After 4 days of duel culture, the highest mycelial growth reduction (10.33 mm diameter) was observed by the interaction between T. harzianum (armigera) with C. musae from sagor banana. Moreover, the highest growth inhibition (46.29%) was observed by the interaction between T. harzianum (armigera) with C. musae from the sobri banana. All the Trichoderma strains fully affected the viability of all the Colletotrichum isolates. Interestingly, both cultural filtrates and mycelial powders of all the Trichoderma strains showed a very nice inhibitory effect against C. musae isolates, where cultural filtrates were more potential than that of mycelial powders. So, all the tested Trichoderma strains may be used for the control of banana anthracnose disease. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=biological%20control" title="biological control">biological control</a>, <a href="https://publications.waset.org/abstracts/search?q=banana" title=" banana"> banana</a>, <a href="https://publications.waset.org/abstracts/search?q=anthracnose" title=" anthracnose"> anthracnose</a>, <a href="https://publications.waset.org/abstracts/search?q=Trichoderma" title=" Trichoderma"> Trichoderma</a>, <a href="https://publications.waset.org/abstracts/search?q=Colletotrichum" title=" Colletotrichum"> Colletotrichum</a> </p> <a href="https://publications.waset.org/abstracts/114207/antagonistic-potential-of-trichoderma-strains-against-colletotrichum-musae" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/114207.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">148</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">49</span> Activation of Apoptosis in the Midgut Epithelium of Spodoptera exigua Hübner (Lepidoptera: Noctuidae) Exposed to Various Cadmium Concentration</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Magdalena%20Maria%20Rost-Roszkowska">Magdalena Maria Rost-Roszkowska</a>, <a href="https://publications.waset.org/abstracts/search?q=Alina%20Chachulska-%C5%BByme%C5%82ka"> Alina Chachulska-Żymełka</a>, <a href="https://publications.waset.org/abstracts/search?q=Monika%20Tarnawska"> Monika Tarnawska</a>, <a href="https://publications.waset.org/abstracts/search?q=Maria%20Augustyniak"> Maria Augustyniak</a>, <a href="https://publications.waset.org/abstracts/search?q=Alina%20Kafel"> Alina Kafel</a>, <a href="https://publications.waset.org/abstracts/search?q=Agnieszka%20Babczy%C5%84ska"> Agnieszka Babczyńska</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The digestive system of insects is composed of three distinct regions: fore-, mid- and hingut. The middle region (the midgut) is treated as one of the barriers which protects the organism against any stressors which originate from external environment, e.g. toxic metals. Such factors can activate the cell death in epithelial cells to preserve the entire tissue/organs against the degeneration. Different mechanisms involved in homeostasis maintenance have been described, but the studies of animals under field conditions do not give the opportunity to conclude about potential ability of subsequent generation to inherit the tolerance mechanisms. It is possible only by a multigenerational strain of an animal led under laboratory conditions, exposed to a selected toxic factor, present also in polluted ecosystems. The main purpose of the project was to check if changes, which appear in the midgut epithelium after Cd treatment, can be fixed during the following generations of insects with the special emphasis on apoptosis. As the animal for these studies we chose 5th larval stage of the beet armyworm Spodoptera exigua Hübner (Lepidoptera: Noctuidae), which is one of pest of many vegetable crops. Animals were divided into some experimental groups: K, Cd, KCd, Cd1, Cd2, Cd3. A control group (K) fed a standard diet, and was conducted for XX generations, a cadmium group (Cd), fed on standard diet supplemented with cadmium (44 mg Cd per kg of dry weight of food) for XXX generations. A reference Cd group (KCd) has been initiated: control insects were fed with Cd supplemented diet (44 mg Cd per kg of dry weight of food). Experimental groups Cd1, Cd2, Cd3 developed from the control one: 5 mg Cd per kg of dry weight of food, 10 mg Cd per kg of dry weight of food, 20 mg Cd per kg of dry weight of food. We were interested in the activation of apoptosis during following generations in all experimental groups. Therefore, during the 1st year of the experiment, the measurements were done for 6 generations in all experimental group. The intensity and the course of apoptosis have been examined using transmission electron microscope (TEM), confocal microscope and flow cytometry. During apoptosis the cell started to shrink, extracellular spaces appeared between digestive and neighboring cells, the nucleus achieved a lobular shape. Eventually, the apoptotic cells was discharged into the midgut lumen. A quantitative analysis revealed that the number of apoptotic cells depends significantly on the generation, tissue and cadmium concentration in the insect rearing medium. In the following 6 generations, we observed that the percentage of apoptotic cells in the midguts from cadmium-exposed groups decreased gradually according to the following order of strains: Cd1, Cd2, Cd3 and KCd. At the same time, it was still higher than the percentage of apoptotic cells in the same tissues of the insects from the control and multigenerational cadmium strain. The results of our studies suggest that changes caused by cadmium treatment were preserved during 6-generational development of lepidopteran larvae. The study has been financed by the National Science Centre Poland, grant no 2016/21/B/NZ8/00831. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cadmium" title="cadmium">cadmium</a>, <a href="https://publications.waset.org/abstracts/search?q=cell%20death" title=" cell death"> cell death</a>, <a href="https://publications.waset.org/abstracts/search?q=digestive%20system" title=" digestive system"> digestive system</a>, <a href="https://publications.waset.org/abstracts/search?q=ultrastructure" title=" ultrastructure"> ultrastructure</a> </p> <a href="https://publications.waset.org/abstracts/90370/activation-of-apoptosis-in-the-midgut-epithelium-of-spodoptera-exigua-hubner-lepidoptera-noctuidae-exposed-to-various-cadmium-concentration" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/90370.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">214</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">48</span> Moths of Indian Himalayas: Data Digging for Climate Change Monitoring</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Angshuman%20Raha">Angshuman Raha</a>, <a href="https://publications.waset.org/abstracts/search?q=Abesh%20Kumar%20Sanyal"> Abesh Kumar Sanyal</a>, <a href="https://publications.waset.org/abstracts/search?q=Uttaran%20Bandyopadhyay"> Uttaran Bandyopadhyay</a>, <a href="https://publications.waset.org/abstracts/search?q=Kaushik%20Mallick"> Kaushik Mallick</a>, <a href="https://publications.waset.org/abstracts/search?q=Kamalika%20Bhattacharyya"> Kamalika Bhattacharyya</a>, <a href="https://publications.waset.org/abstracts/search?q=Subrata%20Gayen"> Subrata Gayen</a>, <a href="https://publications.waset.org/abstracts/search?q=Gaurab%20Nandi%20Das"> Gaurab Nandi Das</a>, <a href="https://publications.waset.org/abstracts/search?q=Mohd.%20Ali"> Mohd. Ali</a>, <a href="https://publications.waset.org/abstracts/search?q=Kailash%20Chandra"> Kailash Chandra</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Indian Himalayan Region (IHR), due to its sheer latitudinal and altitudinal expanse, acts as a mixing ground for different zoogeographic faunal elements. The innumerable unique and distributional restricted rare species of IHR are constantly being threatened with extinction by the ongoing climate change scenario. Many of which might have faced extinction without even being noticed or discovered. Monitoring the community dynamics of a suitable taxon is indispensable to assess the effect of this global perturbation at micro-habitat level. Lepidoptera, particularly moths are suitable for this purpose due to their huge diversity and strict herbivorous nature. The present study aimed to collate scattered historical records of moths from IHR and spatially disseminate the same in Geographic Information System (GIS) domain. The study also intended to identify moth species with significant altitudinal shifts which could be prioritised for monitoring programme to assess the effect of climate change on biodiversity. A robust database on moths recorded from IHR was prepared from voluminous secondary literature and museum collections. Historical sampling points were transformed into richness grids which were spatially overlaid on altitude, annual precipitation and vegetation layers separately to show moth richness patterns along major environmental gradients. Primary samplings were done by setting standard light traps at 11 Protected Areas representing five Indian Himalayan biogeographic provinces. To identify significant altitudinal shifts, past and present altitudinal records of the identified species from primary samplings were compared. A consolidated list of 4107 species belonging to 1726 genera of 62 families of moths was prepared from a total of 10,685 historical records from IHR. Family-wise assemblage revealed Erebidae to be the most speciose family with 913 species under 348 genera, followed by Geometridae with 879 species under 309 genera and Noctuidae with 525 species under 207 genera. Among biogeographic provinces, Central Himalaya represented maximum records with 2248 species, followed by Western and North-western Himalaya with 1799 and 877 species, respectively. Spatial analysis revealed species richness was more or less uniform (up to 150 species record per cell) across IHR. Throughout IHR, the middle elevation zones between 1000-2000m encompassed high species richness. Temperate coniferous forest associated with 1500-2000mm rainfall zone showed maximum species richness. Total 752 species of moths were identified representing 23 families from the present sampling. 13 genera were identified which were restricted to specialized habitats of alpine meadows over 3500m. Five historical localities with high richness of >150 species were selected which could be considered for repeat sampling to assess climate change influence on moth assemblage. Of the 7 species exhibiting significant altitudinal ascend of >2000m, Trachea auriplena, Diphtherocome fasciata (Noctuidae) and Actias winbrechlini (Saturniidae) showed maximum range shift of >2500m, indicating intensive monitoring of these species. Great Himalayan National Park harbours most diverse assemblage of high-altitude restricted species and should be a priority site for habitat conservation. Among the 13 range restricted genera, Arichanna, Opisthograptis, Photoscotosia (Geometridae), Phlogophora, Anaplectoides and Paraxestia (Noctuidae) were dominant and require rigorous monitoring, as they are most susceptible to climatic perturbations. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=altitudinal%20shifts" title="altitudinal shifts">altitudinal shifts</a>, <a href="https://publications.waset.org/abstracts/search?q=climate%20change" title=" climate change"> climate change</a>, <a href="https://publications.waset.org/abstracts/search?q=historical%20records" title=" historical records"> historical records</a>, <a href="https://publications.waset.org/abstracts/search?q=Indian%20Himalayan%20region" title=" Indian Himalayan region"> Indian Himalayan region</a>, <a href="https://publications.waset.org/abstracts/search?q=Lepidoptera" title=" Lepidoptera"> Lepidoptera</a> </p> <a href="https://publications.waset.org/abstracts/92385/moths-of-indian-himalayas-data-digging-for-climate-change-monitoring" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/92385.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">169</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">47</span> Baseline Data for Insecticide Resistance Monitoring in Tobacco Caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae) on Cole Crops</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Prabhjot%20Kaur">Prabhjot Kaur</a>, <a href="https://publications.waset.org/abstracts/search?q=B.K.%20Kang"> B.K. Kang</a>, <a href="https://publications.waset.org/abstracts/search?q=Balwinder%20Singh"> Balwinder Singh</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae) is an agricultural important pest species. S. litura has a wide host range of approximately recorded 150 plant species worldwide. In Punjab, this pest attains sporadic status primarily on cauliflower, Brassica oleracea (L.). This pest destroys vegetable crop and particularly prefers the cruciferae family. However, it is also observed feeding on other crops such as arbi, Colocasia esculenta (L.), mung bean, Vigna radiata (L.), sunflower, Helianthus annuus (L.), cotton, Gossypium hirsutum (L.), castor, Ricinus communis (L.), etc. Larvae of this pest completely devour the leaves of infested plant resulting in huge crop losses which ranges from 50 to 70 per cent. Indiscriminate and continuous use of insecticides has contributed in development of insecticide resistance in insects and caused the environmental degradation as well. Moreover, a base line data regarding the toxicity of the newer insecticides would help in understanding the level of resistance developed in this pest and any possible cross-resistance there in, which could be assessed in advance. Therefore, present studies on development of resistance in S. litura against four new chemistry insecticides (emamectin benzoate, chlorantraniliprole, indoxacarb and spinosad) were carried out in the Toxicology laboratory, Department of Entomology, Punjab Agricultural University, Ludhiana, Punjab, India during the year 2011-12. Various stages of S. litura (eggs, larvae) were collected from four different locations (Malerkotla, Hoshiarpur, Amritsar and Samrala) of Punjab. Resistance is developed in third instars of lepidopterous pests. Therefore, larval bioassays were conducted to estimate the response of field populations of thirty third-instar larvae of S. litura under laboratory conditions at 25±2°C and 65±5 per cent relative humidity. Leaf dip bioassay technique with diluted insecticide formulations recommended by Insecticide Resistance Action Committee (IRAC) was performed in the laboratory with seven to ten treatments depending on the insecticide class, respectively. LC50 values were estimated by probit analysis after correction to record control mortality data which was used to calculate the resistance ratios (RR). The LC50 values worked out for emamectin benzoate, chlorantraniliprole, indoxacarb, spinosad are 0.081, 0.088, 0.380, 4.00 parts per million (ppm) against pest populations collected from Malerkotla; 0.051, 0.060, 0.250, 3.00 (ppm) of Amritsar; 0.002, 0.001, 0.0076, 0.10 ppm for Samrala and 0.000014, 0.00001, 0.00056, 0.003 ppm against pest population of Hoshiarpur, respectively. The LC50 values for populations collected from these four locations were in the order Malerkotla>Amritsar>Samrala>Hoshiarpur for the insecticides (emamectin benzoate, chlorantraniliprole, indoxacarb and spinosad) tested. Based on LC50 values obtained, emamectin benzoate (0.000014 ppm) was found to be the most toxic among all the tested populations, followed by chlorantraniliprole (0.00001 ppm), indoxacarb (0.00056 ppm) and spinosad (0.003 ppm), respectively. The pairwise correlation coefficients of LC50 values indicated that there was lack of cross resistance for emamectin benzoate, chlorantraniliprole, spinosad, indoxacarb in populations of S. litura from Punjab. These insecticides may prove to be promising substitutes for the effective control of insecticide resistant populations of S. litura in Punjab state, India. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Spodoptera%20litura" title="Spodoptera litura">Spodoptera litura</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticides" title=" insecticides"> insecticides</a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity" title=" toxicity"> toxicity</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance" title=" resistance"> resistance</a> </p> <a href="https://publications.waset.org/abstracts/6194/baseline-data-for-insecticide-resistance-monitoring-in-tobacco-caterpillar-spodoptera-litura-fabricius-lepidoptera-noctuidae-on-cole-crops" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/6194.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">342</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">46</span> Insect Inducible Methanol Production in Plants for Insect Resistance</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Gourav%20Jain">Gourav Jain</a>, <a href="https://publications.waset.org/abstracts/search?q=Sameer%20Dixit"> Sameer Dixit</a>, <a href="https://publications.waset.org/abstracts/search?q=Surjeet%20Kumar%20Arya"> Surjeet Kumar Arya</a>, <a href="https://publications.waset.org/abstracts/search?q=Praveen%20C.%20Verma"> Praveen C. Verma</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Plant cell wall plays a major role in defence mechanism against biotic and abiotic stress as it constitutes the physical barrier between the microenvironment and internal component of the cell. It is a complex structure composed of mostly carbohydrates among which cellulose and hemicelluloses are most abundant that is embedded in a matrix of pectins and proteins. Multiple enzymes have been reported which plays a vital role in cell wall modification, Pectin Methylesterase (PME) is one of them which catalyses the demethylesterification of homogalacturonans component of pectin which releases acidic pectin and methanol. As emitted methanol is toxic to the insect pest, we use PME gene for the better methanol production. In the current study we showed overexpression of PME gene isolated from Withania somnifera under the insect inducible promoter causes enhancement of methanol production at the time of insect feeds to plants, and that provides better insect resistance property. We found that the 85-90% mortality causes by transgenic tobacco in both chewing (Spodoptera litura larvae and Helicoverpa armigera) and sap-sucking (Aphid, mealybug, and whitefly) pest. The methanol content and emission level were also enhanced by 10-15 folds at different inducible time point interval (15min, 30min, 45min, 60min) which would be analysed by Purpald/Alcohol Oxidase method. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=methanol" title="methanol">methanol</a>, <a href="https://publications.waset.org/abstracts/search?q=Pectin%20methylesterase" title=" Pectin methylesterase"> Pectin methylesterase</a>, <a href="https://publications.waset.org/abstracts/search?q=inducible%20promoters" title=" inducible promoters"> inducible promoters</a>, <a href="https://publications.waset.org/abstracts/search?q=Purpald%2FAlcohol%20oxidase" title=" Purpald/Alcohol oxidase"> Purpald/Alcohol oxidase</a> </p> <a href="https://publications.waset.org/abstracts/67908/insect-inducible-methanol-production-in-plants-for-insect-resistance" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/67908.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">244</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">45</span> Spatio-Temporal Pest Risk Analysis with ‘BioClass’</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Vladimir%20A.%20Todiras">Vladimir A. Todiras</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Spatio-temporal models provide new possibilities for real-time action in pest risk analysis. It should be noted that estimation of the possibility and probability of introduction of a pest and of its economic consequences involves many uncertainties. We present a new mapping technique that assesses pest invasion risk using online BioClass software. BioClass is a GIS tool designed to solve multiple-criteria classification and optimization problems based on fuzzy logic and level set methods. This research describes a method for predicting the potential establishment and spread of a plant pest into new areas using a case study: corn rootworm (Diabrotica spp.), tomato leaf miner (Tuta absoluta) and plum fruit moth (Grapholita funebrana). Our study demonstrated that in BioClass we can combine fuzzy logic and geographic information systems with knowledge of pest biology and environmental data to derive new information for decision making. Pests are sensitive to a warming climate, as temperature greatly affects their survival and reproductive rate and capacity. Changes have been observed in the distribution, frequency and severity of outbreaks of Helicoverpa armigera on tomato. BioClass has demonstrated to be a powerful tool for applying dynamic models and map the potential future distribution of a species, enable resource to make decisions about dangerous and invasive species management and control. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=classification" title="classification">classification</a>, <a href="https://publications.waset.org/abstracts/search?q=model" title=" model"> model</a>, <a href="https://publications.waset.org/abstracts/search?q=pest" title=" pest"> pest</a>, <a href="https://publications.waset.org/abstracts/search?q=risk" title=" risk "> risk </a> </p> <a href="https://publications.waset.org/abstracts/27954/spatio-temporal-pest-risk-analysis-with-bioclass" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/27954.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">282</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">44</span> Differential Expression Analysis of Busseola fusca Larval Transcriptome in Response to Cry1Ab Toxin Challenge</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Bianca%20Peterson">Bianca Peterson</a>, <a href="https://publications.waset.org/abstracts/search?q=Tomasz%20J.%20Sa%C5%84ko"> Tomasz J. Sańko</a>, <a href="https://publications.waset.org/abstracts/search?q=Carlos%20C.%20Bezuidenhout"> Carlos C. Bezuidenhout</a>, <a href="https://publications.waset.org/abstracts/search?q=Johnnie%20Van%20Den%20Berg"> Johnnie Van Den Berg</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Busseola fusca (Fuller) (Lepidoptera: Noctuidae), the maize stem borer, is a major pest in sub-Saharan Africa. It causes economic damage to maize and sorghum crops and has evolved non-recessive resistance to genetically modified (GM) maize expressing the Cry1Ab insecticidal toxin. Since B. fusca is a non-model organism, very little genomic information is publicly available, and is limited to some cytochrome c oxidase I, cytochrome b, and microsatellite data. The biology of B. fusca is well-described, but still poorly understood. This, in combination with its larval-specific behavior, may pose problems for limiting the spread of current resistant B. fusca populations or preventing resistance evolution in other susceptible populations. As part of on-going research into resistance evolution, B. fusca larvae were collected from Bt and non-Bt maize in South Africa, followed by RNA isolation (15 specimens) and sequencing on the Illumina HiSeq 2500 platform. Quality of reads was assessed with FastQC, after which Trimmomatic was used to trim adapters and remove low quality, short reads. Trinity was used for the de novo assembly, whereas TransRate was used for assembly quality assessment. Transcript identification employed BLAST (BLASTn, BLASTp, and tBLASTx comparisons), for which two libraries (nucleotide and protein) were created from 3.27 million lepidopteran sequences. Several transcripts that have previously been implicated in Cry toxin resistance was identified for B. fusca. These included aminopeptidase N, cadherin, alkaline phosphatase, ATP-binding cassette transporter proteins, and mitogen-activated protein kinase. MEGA7 was used to align these transcripts to reference sequences from Lepidoptera to detect mutations that might potentially be contributing to Cry toxin resistance in this pest. RSEM and Bioconductor were used to perform differential gene expression analysis on groups of B. fusca larvae challenged and unchallenged with the Cry1Ab toxin. Pairwise expression comparisons of transcripts that were at least 16-fold expressed at a false-discovery corrected statistical significance (p) ≤ 0.001 were extracted and visualized in a hierarchically clustered heatmap using R. A total of 329,194 transcripts with an N50 of 1,019 bp were generated from the over 167.5 million high-quality paired-end reads. Furthermore, 110 transcripts were over 10 kbp long, of which the largest one was 29,395 bp. BLAST comparisons resulted in identification of 157,099 (47.72%) transcripts, among which only 3,718 (2.37%) were identified as Cry toxin receptors from lepidopteran insects. According to transcript expression profiles, transcripts were grouped into three subclusters according to the similarity of their expression patterns. Several immune-related transcripts (pathogen recognition receptors, antimicrobial peptides, and inhibitors) were up-regulated in the larvae feeding on Bt maize, indicating an enhanced immune status in response to toxin exposure. Above all, extremely up-regulated arylphorin genes suggest that enhanced epithelial healing is one of the resistance mechanisms employed by B. fusca larvae against the Cry1Ab toxin. This study is the first to provide a resource base and some insights into a potential mechanism of Cry1Ab toxin resistance in B. fusca. Transcriptomic data generated in this study allows identification of genes that can be targeted by biotechnological improvements of GM crops. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=epithelial%20healing" title="epithelial healing">epithelial healing</a>, <a href="https://publications.waset.org/abstracts/search?q=Lepidoptera" title=" Lepidoptera"> Lepidoptera</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance" title=" resistance"> resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=transcriptome" title=" transcriptome"> transcriptome</a> </p> <a href="https://publications.waset.org/abstracts/71571/differential-expression-analysis-of-busseola-fusca-larval-transcriptome-in-response-to-cry1ab-toxin-challenge" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/71571.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">203</span> </span> </div> </div> <ul class="pagination"> <li class="page-item disabled"><span class="page-link">&lsaquo;</span></li> <li class="page-item active"><span class="page-link">1</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=Helicoverpa%20armigera%20%28Noctuidae%3A%20Lepidoptera%29&page=2">2</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=Helicoverpa%20armigera%20%28Noctuidae%3A%20Lepidoptera%29&page=3">3</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=Helicoverpa%20armigera%20%28Noctuidae%3A%20Lepidoptera%29&page=2" rel="next">&rsaquo;</a></li> </ul> </div> </main> <footer> <div id="infolinks" class="pt-3 pb-2"> <div class="container"> <div style="background-color:#f5f5f5;" class="p-3"> <div class="row"> <div class="col-md-2"> <ul class="list-unstyled"> About <li><a href="https://waset.org/page/support">About Us</a></li> <li><a href="https://waset.org/page/support#legal-information">Legal</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/WASET-16th-foundational-anniversary.pdf">WASET celebrates its 16th foundational anniversary</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Account <li><a href="https://waset.org/profile">My Account</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Explore <li><a href="https://waset.org/disciplines">Disciplines</a></li> <li><a href="https://waset.org/conferences">Conferences</a></li> <li><a href="https://waset.org/conference-programs">Conference Program</a></li> <li><a href="https://waset.org/committees">Committees</a></li> <li><a href="https://publications.waset.org">Publications</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Research <li><a href="https://publications.waset.org/abstracts">Abstracts</a></li> <li><a href="https://publications.waset.org">Periodicals</a></li> <li><a href="https://publications.waset.org/archive">Archive</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Open Science <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Philosophy.pdf">Open Science Philosophy</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Award.pdf">Open Science Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Society-Open-Science-and-Open-Innovation.pdf">Open Innovation</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Postdoctoral-Fellowship-Award.pdf">Postdoctoral Fellowship Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Scholarly-Research-Review.pdf">Scholarly Research Review</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Support <li><a href="https://waset.org/page/support">Support</a></li> <li><a href="https://waset.org/profile/messages/create">Contact Us</a></li> <li><a href="https://waset.org/profile/messages/create">Report Abuse</a></li> </ul> </div> </div> </div> </div> </div> <div class="container text-center"> <hr style="margin-top:0;margin-bottom:.3rem;"> <a href="https://creativecommons.org/licenses/by/4.0/" target="_blank" class="text-muted small">Creative Commons Attribution 4.0 International License</a> <div id="copy" class="mt-2">© 2024 World Academy of Science, Engineering and Technology</div> </div> </footer> <a href="javascript:" id="return-to-top"><i class="fas fa-arrow-up"></i></a> <div class="modal" id="modal-template"> <div class="modal-dialog"> <div class="modal-content"> <div class="row m-0 mt-1"> <div class="col-md-12"> <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">×</span></button> </div> </div> <div class="modal-body"></div> </div> </div> </div> <script src="https://cdn.waset.org/static/plugins/jquery-3.3.1.min.js"></script> <script src="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/js/bootstrap.bundle.min.js"></script> <script src="https://cdn.waset.org/static/js/site.js?v=150220211556"></script> <script> jQuery(document).ready(function() { /*jQuery.get("https://publications.waset.org/xhr/user-menu", function (response) { jQuery('#mainNavMenu').append(response); });*/ jQuery.get({ url: "https://publications.waset.org/xhr/user-menu", cache: false }).then(function(response){ jQuery('#mainNavMenu').append(response); }); }); </script> </body> </html>