CINXE.COM

Cannabidiol interactions with voltage-gated sodium channels - PMC

<!DOCTYPE html> <html lang="en" > <head > <meta charset="UTF-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge" /> <meta name="HandheldFriendly" content="True" /> <meta name="MobileOptimized" content="320" /> <meta name="viewport" content="width=device-width, initial-scale=1.0" /> <link rel="stylesheet" href="/static/assets/style-b3a36f11.css" /> <script type="module" crossorigin="" src="/static/assets/base_style-d4f8bd56.js"></script> <link rel="stylesheet" href="/static/assets/style-ef962842.css" /> <link rel="stylesheet" href="/static/assets/style-3ade8b5c.css" /> <script type="module" crossorigin="" src="/static/assets/article_style-d757a0dd.js"></script> <style> @media screen and (min-width: 64em) { div.pmc-wm { background: repeat-y; background-image: url("data:image/svg+xml,%3Csvg xmlns='http://www.w3.org/2000/svg' width='20' height='350' xmlns:xlink='http://www.w3.org/1999/xlink'%3E%3Cdefs%3E%3Cfilter x='-.02' y='0' width='1.05' height='1' id='c'%3E%3CfeFlood flood-color='%23FFF'/%3E%3CfeComposite in='SourceGraphic'/%3E%3C/filter%3E%3Ctext id='b' font-family='Helvetica' font-size='11pt' style='opacity:1;fill:%23005ea2;stroke:none;text-anchor:middle' x='175' y='14'%3E%3C/text%3E%3Cpath id='a' style='fill:%23005ea2' d='M0 8h350v3H0z'/%3E%3C/defs%3E%3Cuse xlink:href='%23a' transform='rotate(90 10 10)'/%3E%3Cuse xlink:href='%23b' transform='rotate(90 10 10)' filter='url(%23c)'/%3E%3C/svg%3E"); padding-left: 3rem; } } </style> <link rel="apple-touch-icon" sizes="180x180" href="/static/img/favicons/apple-touch-icon.png" /> <link rel="icon" type="image/png" sizes="48x48" href="/static/img/favicons/favicon-48x48.png" /> <link rel="icon" type="image/png" sizes="32x32" href="/static/img/favicons/favicon-32x32.png" /> <link rel="icon" type="image/png" sizes="16x16" href="/static/img/favicons/favicon-16x16.png" /> <link rel="manifest" href="/static/img/favicons/site.webmanifest" /> <link rel="mask-icon" href="/static/img/favicons/safari-pinned-tab.svg" color="#0071bc" /> <meta name="msapplication-config" content="/static/img/favicons/browserconfig.xml" /> <meta name="theme-color" content="#ffffff" /> <title> Cannabidiol interactions with voltage-gated sodium channels - PMC </title> <!-- Logging params: Pinger defaults --> <meta name="ncbi_app" content="cloudpmc-viewer" /> <meta name="ncbi_db" content="pmc" /> <meta name="ncbi_phid" content="993C01197B3014730D01190012A345D2.m_1" /> <!-- Logging params: Pinger custom --> <meta name="ncbi_pdid" content="article" /> <link rel="preconnect" href="https://www.google-analytics.com" /> <link rel="preconnect" href="https://cdn.ncbi.nlm.nih.gov" /> <!-- Include USWDS Init Script --> <script src="/static/assets/uswds-init.js"></script> <meta name="ncbi_domain" content="elife"> <meta name="ncbi_type" content="fulltext"> <meta name="ncbi_pcid" content="journal"> <meta name="ncbi_feature" content="associated_data"> <link rel="canonical" href="https://pmc.ncbi.nlm.nih.gov/articles/PMC7641581/"> <meta name="robots" content="INDEX,NOFOLLOW,NOARCHIVE"> <meta name="citation_journal_title" content="eLife"> <meta name="citation_title" content="Cannabidiol interactions with voltage-gated sodium channels"> <meta name="citation_author" content="Lily Goodyer Sait"> <meta name="citation_author_institution" content="Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom"> <meta name="citation_author" content="Altin Sula"> <meta name="citation_author_institution" content="Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom"> <meta name="citation_author" content="Mohammad-Reza Ghovanloo"> <meta name="citation_author_institution" content="Department of Biomedical Physiology and Kinesiology, Simon Fraser University, Burnaby, Canada"> <meta name="citation_author" content="David Hollingworth"> <meta name="citation_author_institution" content="Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom"> <meta name="citation_author" content="Peter C Ruben"> <meta name="citation_author_institution" content="Department of Biomedical Physiology and Kinesiology, Simon Fraser University, Burnaby, Canada"> <meta name="citation_author" content="BA Wallace"> <meta name="citation_author_institution" content="Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom"> <meta name="citation_publication_date" content="2020 Oct 22"> <meta name="citation_volume" content="9"> <meta name="citation_firstpage" content="e58593"> <meta name="citation_doi" content="10.7554/eLife.58593"> <meta name="citation_pmid" content="33089780"> <meta name="citation_abstract_html_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC7641581/"> <meta name="citation_fulltext_html_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC7641581/"> <meta name="citation_pdf_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC7641581/pdf/elife-58593.pdf"> <meta name="description" content="Voltage-gated sodium channels are targets for a range of pharmaceutical drugs developed for the treatment of neurological diseases. Cannabidiol (CBD), the non-psychoactive compound isolated from cannabis plants, was recently approved for treatment ..."> <meta name="og:title" content="Cannabidiol interactions with voltage-gated sodium channels"> <meta name="og:type" content="article"> <meta name="og:site_name" content="PubMed Central (PMC)"> <meta name="og:description" content="Voltage-gated sodium channels are targets for a range of pharmaceutical drugs developed for the treatment of neurological diseases. Cannabidiol (CBD), the non-psychoactive compound isolated from cannabis plants, was recently approved for treatment ..."> <meta name="og:url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC7641581/"> <meta name="og:image" content="https://cdn.ncbi.nlm.nih.gov/pmc/cms/images/pmc-card-share.jpg?_=0"> <meta name="twitter:card" content="summary_large_image"> <meta name="twitter:site" content="@ncbi"> </head> <body > <a class="usa-skipnav " href="#main-content"> Skip to main content </a> <section class="usa-banner " aria-label="Official website of the United States government" > <div class="usa-accordion"> <header class="usa-banner__header"> <div class="usa-banner__inner"> <div class="grid-col-auto"> <img aria-hidden="true" class="usa-banner__header-flag" src="/static/img/us_flag.svg" alt="" /> </div> <div class="grid-col-fill tablet:grid-col-auto" aria-hidden="true"> <p class="usa-banner__header-text"> An official website of the United States government </p> <span class="usa-banner__header-action">Here's how you know</span> </div> <button type="button" class="usa-accordion__button usa-banner__button " aria-expanded="false" aria-controls="gov-banner-default" data-testid="storybook-django-banner" > <span class="usa-banner__button-text">Here's how you know</span> </button> </div> </header> <div class="usa-banner__content usa-accordion__content" id="gov-banner-default" hidden> <div class="grid-row grid-gap-lg"> <div class="usa-banner__guidance tablet:grid-col-6"> <img class="usa-banner__icon usa-media-block__img" src="/static/img/icon-dot-gov.svg" alt="" aria-hidden="true" /> <div class="usa-media-block__body"> <p> <strong>Official websites use .gov</strong> <br /> A <strong>.gov</strong> website belongs to an official government organization in the United States. </p> </div> </div> <div class="usa-banner__guidance tablet:grid-col-6"> <img class="usa-banner__icon usa-media-block__img" src="/static/img/icon-https.svg" alt="" aria-hidden="true" /> <div class="usa-media-block__body"> <p> <strong>Secure .gov websites use HTTPS</strong> <br /> A <strong>lock</strong> ( <span class="icon-lock"> <svg xmlns="http://www.w3.org/2000/svg" width="52" height="64" viewBox="0 0 52 64" class="usa-banner__lock-image" role="graphics-symbol" aria-labelledby="banner-lock-description" focusable="false"> <title id="banner-lock-title">Lock</title> <desc id="banner-lock-description"> Locked padlock icon </desc> <path fill="#000000" fill-rule="evenodd" d="M26 0c10.493 0 19 8.507 19 19v9h3a4 4 0 0 1 4 4v28a4 4 0 0 1-4 4H4a4 4 0 0 1-4-4V32a4 4 0 0 1 4-4h3v-9C7 8.507 15.507 0 26 0zm0 8c-5.979 0-10.843 4.77-10.996 10.712L15 19v9h22v-9c0-6.075-4.925-11-11-11z" /> </svg> </span>) or <strong>https://</strong> means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. </p> </div> </div> </div> </div> </div> </section> <div class="usa-overlay"> </div> <header class="usa-header usa-header--extended usa-header--wide" data-testid="header" data-header > <div class="ncbi-header"> <div class="ncbi-header__container"> <a class="ncbi-header__logo-container" href="https://www.ncbi.nlm.nih.gov/"> <img alt=" NCBI home page " class="ncbi-header__logo-image" src="/static/img/ncbi-logos/nih-nlm-ncbi--white.svg" /> </a> <!-- Mobile menu hamburger button --> <button type="button" class="usa-menu-btn ncbi-header__hamburger-button " aria-label="Show menu" data-testid="navMenuButton" > <svg aria-hidden="true" class="ncbi-hamburger-icon" fill="none" focusable="false" height="21" viewBox="0 0 31 21" width="31" xmlns="http://www.w3.org/2000/svg"> <path clip-rule="evenodd" d="M0.125 20.75H30.875V17.3333H0.125V20.75ZM0.125 12.2083H30.875V8.79167H0.125V12.2083ZM0.125 0.25V3.66667H30.875V0.25H0.125Z" fill="#F1F1F1" fill-rule="evenodd" /> </svg> </button> <!-- Desktop buttons--> <div class="ncbi-header__desktop-buttons"> <!-- Desktop search button --> <button type="button" class="usa-button usa-button--unstyled ncbi-header__desktop-button " aria-expanded="false" aria-controls="search-field-desktop-navigation" aria-label="Show search overlay" data-testid="toggleSearchPanelButton" data-toggle-search-panel-button > <svg class="usa-icon " role="graphics-symbol" aria-hidden="true" > <use xlink:href="/static/img/sprite.svg#search" /> </svg> Search </button> <!-- Desktop login dropdown --> <div class="ncbi-header__login-dropdown"> <button type="button" class="usa-button usa-button--unstyled ncbi-header__desktop-button ncbi-header__login-dropdown-button " aria-expanded="false" aria-controls="login-dropdown-menu" aria-label="Show login menu" data-testid="toggleLoginMenuDropdown" data-desktop-login-button > <svg class="usa-icon " role="graphics-symbol" aria-hidden="true" > <use xlink:href="/static/img/sprite.svg#person" /> </svg> <span data-login-dropdown-text>Log in</span> <!-- Dropdown icon pointing up --> <svg class="usa-icon ncbi-header__login-dropdown-icon ncbi-header__login-dropdown-icon--expand-less ncbi-header__login-dropdown-icon--hidden" role="graphics-symbol" aria-hidden="true" data-login-dropdown-up-arrow> <use xlink:href="/static/img/sprite.svg#expand_less" /> </svg> <!-- Dropdown icon pointing down --> <svg class="usa-icon ncbi-header__login-dropdown-icon ncbi-header__login-dropdown-icon--expand-more ncbi-header__login-dropdown-icon--hidden" role="graphics-symbol" aria-hidden="true" data-login-dropdown-down-arrow> <use xlink:href="/static/img/sprite.svg#expand_more" /> </svg> </button> <!-- Login dropdown menu --> <ul class="usa-nav__submenu ncbi-header__login-dropdown-menu" id="login-dropdown-menu" data-desktop-login-menu-dropdown hidden> <li class="usa-nav__submenu-item"> <!-- Uses custom style overrides to render external and document links. --> <a href="https://www.ncbi.nlm.nih.gov/myncbi/" class="usa-link " > Dashboard </a> </li> <li class="usa-nav__submenu-item"> <!-- Uses custom style overrides to render external and document links. --> <a href="https://www.ncbi.nlm.nih.gov/myncbi/collections/bibliography/" class="usa-link " > Publications </a> </li> <li class="usa-nav__submenu-item"> <!-- Uses custom style overrides to render external and document links. --> <a href="https://www.ncbi.nlm.nih.gov/account/settings/" class="usa-link " > Account settings </a> </li> <li class="usa-nav__submenu-item"> <button type="button" class="usa-button usa-button--outline ncbi-header__login-dropdown-logout-button " data-testid="desktopLogoutButton" data-desktop-logout-button > Log out </button> </li> </ul> </div> </div> </div> </div> <!-- Search panel --> <div class="ncbi-search-panel ncbi--show-only-at-desktop" data-testid="searchPanel" data-header-search-panel hidden> <div class="ncbi-search-panel__container"> <form action="https://www.ncbi.nlm.nih.gov/search/all/" aria-describedby="search-field-desktop-navigation-help-text" autocomplete="off" class="usa-search usa-search--big ncbi-search-panel__form" data-testid="form" method="GET" role="search"> <label class="usa-sr-only" data-testid="label" for="search-field-desktop-navigation"> Search… </label> <input class="usa-input" data-testid="textInput" id="search-field-desktop-navigation" name="term" placeholder="Search NCBI" type="search" value="" /> <button type="submit" class="usa-button " data-testid="button" > <span class="usa-search__submit-text"> Search NCBI </span> </button> </form> </div> </div> <nav aria-label="Primary navigation" class="usa-nav"> <p class="usa-sr-only" id="primary-navigation-sr-only-title"> Primary site navigation </p> <!-- Mobile menu close button --> <button type="button" class="usa-nav__close ncbi-nav__close-button " aria-label="Close navigation menu" data-testid="navCloseButton" > <img src="/static/img/usa-icons/close.svg" alt="Close" /> </button> <!-- Mobile search component --> <form class="usa-search usa-search--small ncbi--hide-at-desktop margin-top-6" role="search"> <label class="usa-sr-only" for="search-field"> Search </label> <input class="usa-input" id="search-field-mobile-navigation" type="search" placeholder="Search NCBI" name="search" /> <button type="submit" class="usa-button " > <!-- This SVG should be kept inline and not replaced with a link to the icon as otherwise it will render in the wrong color --> <img src="data:image/svg+xml;base64,PHN2ZyB4bWxucz0iaHR0cDovL3d3dy53My5vcmcvMjAwMC9zdmciIGhlaWdodD0iMjQiIHZpZXdCb3g9IjAgMCAyNCAyNCIgd2lkdGg9IjI0Ij48cGF0aCBkPSJNMCAwaDI0djI0SDB6IiBmaWxsPSJub25lIi8+PHBhdGggZmlsbD0iI2ZmZiIgZD0iTTE1LjUgMTRoLS43OWwtLjI4LS4yN0E2LjQ3MSA2LjQ3MSAwIDAgMCAxNiA5LjUgNi41IDYuNSAwIDEgMCA5LjUgMTZjMS42MSAwIDMuMDktLjU5IDQuMjMtMS41N2wuMjcuMjh2Ljc5bDUgNC45OUwyMC40OSAxOWwtNC45OS01em0tNiAwQzcuMDEgMTQgNSAxMS45OSA1IDkuNVM3LjAxIDUgOS41IDUgMTQgNy4wMSAxNCA5LjUgMTEuOTkgMTQgOS41IDE0eiIvPjwvc3ZnPg==" class="usa-search__submit-icon" alt="Search" /> </button> </form> <!-- Primary navigation menu items --> <!-- This usa-nav__inner wrapper is required to correctly style the navigation items on Desktop --> <div class="ncbi-nav__mobile-login-menu ncbi--hide-at-desktop" data-mobile-login-menu hidden> <p class="ncbi-nav__mobile-login-menu-status"> Logged in as: <strong class="ncbi-nav__mobile-login-menu-email" data-mobile-login-email-text></strong> </p> <ul class="usa-nav__primary usa-accordion"> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/myncbi/" class="usa-link " > Dashboard </a> </li> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/myncbi/collections/bibliography/" class="usa-link " > Publications </a> </li> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/account/settings/" class="usa-link " > Account settings </a> </li> </ul> </div> <button type="button" class="usa-button ncbi-nav__mobile-login-button ncbi--hide-at-desktop " data-testid="mobileLoginButton" data-mobile-login-button > Log in </button> </nav> </header> <section class="pmc-header pmc-header--basic" aria-label="PMC Header with search box"> <div class="pmc-nav-container"> <div class="pmc-header__bar"> <div class="pmc-header__logo"> <a href="/" title="Home" aria-label="PMC Home"></a> </div> <button type="button" class="usa-button usa-button--unstyled pmc-header__search__button" aria-label="Open search" data-ga-category="search" data-ga-action="PMC" data-ga-label="pmc_search_panel_mobile" > <svg class="usa-icon width-4 height-4 pmc-icon__open" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#search"></use> </svg> <svg class="usa-icon width-4 height-4 pmc-icon__close" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#close"></use> </svg> </button> </div> <div class="pmc-header__search"> <form class="usa-search usa-search--extra usa-search--article-right-column pmc-header__search__form" autocomplete="off" role="search"> <label class="usa-sr-only" for="pmc-search">Search PMC Full-Text Archive</label> <span class="autoComplete_wrapper flex-1"> <input class="usa-input width-full maxw-none" required="required" placeholder="Search PMC Full-Text Archive" id="pmc-search" type="search" name="term" data-autocomplete-url="https://pmc.ncbi.nlm.nih.gov/autocomp/search/autocomp/"/> </span> <button class="usa-button" type="submit" formaction="https://www.ncbi.nlm.nih.gov/pmc/" data-ga-category="search" data-ga-action="PMC" data-ga-label="PMC_search_button" > <span class="usa-search__submit-text">Search in PMC</span> <img src="/static/img/usa-icons-bg/search--white.svg" class="usa-search__submit-icon" alt="Search" /> </button> </form> <ul class="pmc-header__search__menu"> <li> <a class="usa-link" href="https://www.ncbi.nlm.nih.gov/pmc/advanced/" data-ga-action="featured_link" data-ga-label="advanced_search"> Advanced Search </a> </li> <li> <a class="usa-link" href="/journals/" data-ga-action="featured_link" data-ga-label="journal list"> Journal List </a> </li> <li> <a class="usa-link" href="/about/userguide/" data-ga-action="featured_link" data-ga-label="user guide"> User Guide </a> </li> </ul> </div> </div> </section> <div class="usa-section padding-top-0 desktop:padding-top-6 pmc-article-section" data-article-db="pmc" data-article-id="7641581"> <div class="grid-container pmc-actions-bar" aria-label="Actions bar" role="complementary"> <div class="grid-row"> <div class="grid-col-fill display-flex"> <div class="display-flex"> <ul class="usa-list usa-list--unstyled usa-list--horizontal"> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex mob"> <button type="button" class="usa-button pmc-sidenav__container__open usa-button--unstyled width-auto display-flex" aria-label="Open resources" data-extra-class="is-visible-resources" data-ga-category="resources_accordion" data-ga-action="click" data-ga-label="mobile_icon" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#more_vert"></use> </svg> </button> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex mob"> <a href="https://doi.org/10.7554/eLife.58593" class="usa-link display-flex usa-tooltip" role="button" target="_blank" rel="noreferrer noopener" title="View on publisher site" data-position="bottom" aria-label="View on publisher site" data-ga-category="actions" data-ga-action="click" data-ga-label="publisher_link_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#launch"></use> </svg> </a> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <a href="pdf/elife-58593.pdf" class="usa-link display-flex usa-tooltip" role="button" title="Download PDF" data-position="bottom" aria-label="Download PDF" data-ga-category="actions" data-ga-action="click" data-ga-label="pdf_download_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> </a> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <button class="usa-button usa-button--unstyled usa-tooltip collections-dialog-trigger collections-button display-flex collections-button-empty" title="Add to Collections" data-position="bottom" aria-label="Save article in MyNCBI collections." data-ga-category="actions" data-ga-action="click" data-ga-label="collections_button_mobile" data-collections-open-dialog-enabled="false" data-collections-open-dialog-url="https://account.ncbi.nlm.nih.gov/?back_url=https%3A%2F%2Fpmc.ncbi.nlm.nih.gov%2Farticles%2FPMC7641581%2F%23open-collections-dialog" data-in-collections="false" > <svg class="usa-icon width-4 height-4 usa-icon--bookmark-full" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-full.svg#icon"></use> </svg> <svg class="usa-icon width-4 height-4 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-empty.svg#icon"></use> </svg> </button> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <button role="button" class="usa-button usa-button--unstyled usa-tooltip citation-dialog-trigger display-flex" aria-label="Open dialog with citation text in different styles" title="Cite" data-position="bottom" data-ga-category="actions" data-ga-action="open" data-ga-label="cite_mobile" data-all-citations-url="/resources/citations/7641581/" data-citation-style="nlm" data-download-format-link="/resources/citations/7641581/export/" > <svg class="usa-icon width-4 height-4 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#format_quote"></use> </svg> </button> </li> <li class="pmc-permalink display-flex"> <button type="button" class="usa-button usa-button--unstyled usa-tooltip display-flex" title="Permalink" data-position="bottom" aria-label="Show article permalink" aria-expanded="false" aria-haspopup="true" data-ga-category="actions" data-ga-action="open" data-ga-label="permalink_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#share"></use> </svg> </button> <div class="pmc-permalink__dropdown" hidden> <div class="pmc-permalink__dropdown__container"> <h2 class="usa-modal__heading margin-top-0 margin-bottom-2">PERMALINK</h2> <div class="pmc-permalink__dropdown__content"> <input type="text" class="usa-input" value="https://pmc.ncbi.nlm.nih.gov/articles/PMC7641581/" aria-label="Article permalink"> <button class="usa-button display-inline-flex pmc-permalink__dropdown__copy__btn margin-right-0" title="Copy article permalink" data-ga-category="save_share" data-ga-action="link" data-ga-label="copy_link"> <svg class="usa-icon" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span class="margin-left-1">Copy</span> </button> </div> </div> </div> </li> </ul> </div> <button type="button" class="usa-button pmc-sidenav__container__open usa-button--unstyled width-auto display-flex" aria-label="Open article navigation" data-extra-class="is-visible-in-page" data-ga-category="actions" data-ga-action="open" data-ga-label="article_nav_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#list"></use> </svg> </button> </div> </div> </div> <div class="grid-container desktop:padding-left-6"> <div id="article-container" class="grid-row grid-gap"> <div class="grid-col-12 desktop:grid-col-8 order-2 pmc-layout__content"> <div class="grid-container padding-left-0 padding-right-0"> <div class="grid-row desktop:margin-left-neg-6"> <div class="grid-col-12"> <div class="pmc-layout__disclaimer" role="complementary" aria-label="Disclaimer note"> As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health.<br/> Learn more: <a class="usa-link" data-ga-category="Link click" data-ga-action="Disclaimer" data-ga-label="New disclaimer box" href="/about/disclaimer/">PMC Disclaimer</a> | <a class="usa-link" data-ga-category="Link click" data-ga-action="PMC Copyright Notice" data-ga-label="New disclaimer box" href="/about/copyright/"> PMC Copyright Notice </a> </div> </div> </div> <div class="grid-row pmc-wm desktop:margin-left-neg-6"> <!-- Main content --> <main id="main-content" class="usa-layout-docs__main usa-layout-docs grid-col-12 pmc-layout pmc-prose padding-0" > <section class="pmc-journal-banner text-center line-height-none" aria-label="Journal banner"><img src="https://cdn.ncbi.nlm.nih.gov/pmc/banners/logo-elife.png" alt="eLife logo" usemap="#pmc-banner-imagemap" width="500" height="75"><map name="pmc-banner-imagemap"><area alt="Link to eLife" title="Link to eLife" shape="default" href="https://doi.org/10.7554/eLife.58593" target="_blank" rel="noopener noreferrer"></map></section><article lang="en"><section aria-label="Article citation and metadata"><section class="pmc-layout__citation font-secondary font-xs"><div> <div class="display-inline-block"><button type="button" class="cursor-pointer text-no-underline bg-transparent border-0 padding-0 text-left margin-0 text-normal text-primary" aria-controls="journal_context_menu">eLife</button></div>. 2020 Oct 22;9:e58593. doi: <a href="https://doi.org/10.7554/eLife.58593" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">10.7554/eLife.58593</a> </div> <nav id="journal_context_menu" hidden="hidden"><ul class="menu-list font-family-ui" role="menu"> <li role="presentation"><a href="https://www.ncbi.nlm.nih.gov/pmc/?term=%22eLife%22%5Bjour%5D" class="usa-link" role="menuitem">Search in PMC</a></li> <li role="presentation"><a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22eLife%22%5Bjour%5D" lang="en" class="usa-link" role="menuitem">Search in PubMed</a></li> <li role="presentation"><a href="https://www.ncbi.nlm.nih.gov/nlmcatalog?term=%22eLife%22%5BTitle%20Abbreviation%5D" class="usa-link" role="menuitem">View in NLM Catalog</a></li> <li role="presentation"><a href="?term=%22eLife%22%5Bjour%5D" class="usa-link" role="menuitem" data-add-to-search="true">Add to search</a></li> </ul></nav></section><section class="front-matter"><div class="ameta p font-secondary font-xs"> <hgroup><h1>Cannabidiol interactions with voltage-gated sodium channels</h1></hgroup><div class="cg p"> <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Sait%20LG%22%5BAuthor%5D" class="usa-link" aria-describedby="id1"><span class="name western">Lily Goodyer Sait</span></a><div hidden="hidden" id="id1"> <h3><span class="name western">Lily Goodyer Sait</span></h3> <div class="p"> <sup>1</sup>Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Sait%20LG%22%5BAuthor%5D" class="usa-link"><span class="name western">Lily Goodyer Sait</span></a> </div> </div> <sup>1,</sup><sup>†</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Sula%20A%22%5BAuthor%5D" class="usa-link" aria-describedby="id2"><span class="name western">Altin Sula</span></a><div hidden="hidden" id="id2"> <h3><span class="name western">Altin Sula</span></h3> <div class="p"> <sup>1</sup>Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Sula%20A%22%5BAuthor%5D" class="usa-link"><span class="name western">Altin Sula</span></a> </div> </div> <sup>1,</sup><sup>†</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Ghovanloo%20MR%22%5BAuthor%5D" class="usa-link" aria-describedby="id3"><span class="name western">Mohammad-Reza Ghovanloo</span></a><div hidden="hidden" id="id3"> <h3><span class="name western">Mohammad-Reza Ghovanloo</span></h3> <div class="p"> <sup>2</sup>Department of Biomedical Physiology and Kinesiology, Simon Fraser University, Burnaby, Canada</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Ghovanloo%20MR%22%5BAuthor%5D" class="usa-link"><span class="name western">Mohammad-Reza Ghovanloo</span></a> </div> </div> <sup>2,</sup><sup>†</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Hollingworth%20D%22%5BAuthor%5D" class="usa-link" aria-describedby="id4"><span class="name western">David Hollingworth</span></a><div hidden="hidden" id="id4"> <h3><span class="name western">David Hollingworth</span></h3> <div class="p"> <sup>1</sup>Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Hollingworth%20D%22%5BAuthor%5D" class="usa-link"><span class="name western">David Hollingworth</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Ruben%20PC%22%5BAuthor%5D" class="usa-link" aria-describedby="id5"><span class="name western">Peter C Ruben</span></a><div hidden="hidden" id="id5"> <h3><span class="name western">Peter C Ruben</span></h3> <div class="p"> <sup>2</sup>Department of Biomedical Physiology and Kinesiology, Simon Fraser University, Burnaby, Canada</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Ruben%20PC%22%5BAuthor%5D" class="usa-link"><span class="name western">Peter C Ruben</span></a> </div> </div> <sup>2</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Wallace%20BA%22%5BAuthor%5D" class="usa-link" aria-describedby="id6"><span class="name western">BA Wallace</span></a><div hidden="hidden" id="id6"> <h3><span class="name western">BA Wallace</span></h3> <div class="p"> <sup>1</sup>Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Wallace%20BA%22%5BAuthor%5D" class="usa-link"><span class="name western">BA Wallace</span></a> </div> </div> <sup>1,</sup><sup>✉</sup> </div> <div class="cg p">Editors: <span class="name western">Leon D Islas</span><sup>3</sup>, <span class="name western">Olga Boudker</span><sup>4</sup> </div> <ul class="d-buttons inline-list"> <li><button class="d-button" aria-controls="aip_a" aria-expanded="false">Author information</button></li> <li><button class="d-button" aria-controls="anp_a" aria-expanded="false">Article notes</button></li> <li><button class="d-button" aria-controls="clp_a" aria-expanded="false">Copyright and License information</button></li> </ul> <div class="d-panels font-secondary-light"> <div id="aip_a" class="d-panel p" style="display: none"> <div class="p" id="aff1"> <sup>1</sup>Institute of Structural and Molecular Biology, Birkbeck College, University of London, London, United Kingdom</div> <div id="aff2"> <sup>2</sup>Department of Biomedical Physiology and Kinesiology, Simon Fraser University, Burnaby, Canada</div> <div id="aff3"> <sup>3</sup>Universidad Nacional Autónoma de México, Mexico</div> <div id="aff4"> <sup>4</sup>Weill Cornell Medicine, United States</div> <div class="author-notes p"> <div class="fn" id="equal-contrib1"> <sup>†</sup><p class="display-inline">These authors contributed equally to this work.</p> </div> <div class="fn" id="_fncrsp93pmc__"> <sup>✉</sup><p class="display-inline">Corresponding author.</p> </div> </div> <h4 class="font-secondary">Roles</h4> <div class="p"> <strong class="contrib"><span class="name western">Leon D Islas</span></strong>: <span class="role">Reviewing Editor</span> </div> <div> <strong class="contrib"><span class="name western">Olga Boudker</span></strong>: <span class="role">Senior Editor</span> </div> </div> <div id="anp_a" class="d-panel p" style="display: none"><div class="notes p"><section id="historyarticle-meta1" class="history"><p>Received 2020 May 5; Accepted 2020 Oct 15; Collection date 2020.</p></section></div></div> <div id="clp_a" class="d-panel p" style="display: none"> <div>© 2020, Sait et al</div> <p>This article is distributed under the terms of the <a href="http://creativecommons.org/licenses/by/4.0/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Creative Commons Attribution License</a>, which permits unrestricted use and redistribution provided that the original author and source are credited.</p> <div class="p"><a href="/about/copyright/" class="usa-link">PMC Copyright notice</a></div> </div> </div> <div>PMCID: PMC7641581  PMID: <a href="https://pubmed.ncbi.nlm.nih.gov/33089780/" class="usa-link">33089780</a> </div> </div></section></section><section aria-label="Article content"><section class="body main-article-body"><section class="abstract" id="abstract1"><h2>Abstract</h2> <p>Voltage-gated sodium channels are targets for a range of pharmaceutical drugs developed for the treatment of neurological diseases. Cannabidiol (CBD), the non-psychoactive compound isolated from cannabis plants, was recently approved for treatment of two types of epilepsy associated with sodium channel mutations. This study used high-resolution X-ray crystallography to demonstrate the detailed nature of the interactions between CBD and the NavMs voltage-gated sodium channel, and electrophysiology to show the functional effects of binding CBD to these channels. CBD binds at a novel site at the interface of the fenestrations and the central hydrophobic cavity of the channel. Binding at this site blocks the transmembrane-spanning sodium ion translocation pathway, providing a molecular mechanism for channel inhibition. Modelling studies suggest why the closely-related psychoactive compound tetrahydrocannabinol may not have the same effects on these channels. Finally, comparisons are made with the TRPV2 channel, also recently proposed as a target site for CBD. In summary, this study provides novel insight into a possible mechanism for CBD interactions with sodium channels.</p> <section id="kwd-group2" class="kwd-group"><p><strong>Research organism:</strong> None</p></section></section><section id="s1"><h2 class="pmc_sec_title">Introduction</h2> <p>Voltage-gated sodium channels (Navs) specifically enable the passage of sodium ions across cell membranes, contributing to the electrical signalling in cells (<a href="#bib1" class="usa-link" aria-describedby="bib1">Ahern et al., 2016</a>). Nine homologous human sodium channel subtypes, designated hNav1.1-hNav1.9 have been identified, which have different functional characteristics and expression profiles within different tissues (<a href="#bib5" class="usa-link" aria-describedby="bib5">Catterall et al., 2005</a>). Mutations in hNavs have been associated with a range of channelopathies, including pain, epilepsy, and heart disorders, making them major targets for drug development (<a href="#bib2" class="usa-link" aria-describedby="bib2">Bagal et al., 2015</a>; <a href="#bib17" class="usa-link" aria-describedby="bib17">Kaplan et al., 2016</a>).</p> <p>Cannabinoids (including cannabidiol (CBD) and Δ-9-tetrahydrocannabinol (THC)) are hydrophobic compounds produced by the cannabis plant. Whilst THC has been primarily associated with psychoactive drug use (<a href="#bib35" class="usa-link" aria-describedby="bib35">Rosenberg et al., 2015</a>; <a href="#bib32" class="usa-link" aria-describedby="bib32">Pisanti et al., 2017</a>), the non-psychoactive component, CBD, has been shown to have clinical applications as a therapeutic drug for treatment of epileptic conditions (<a href="#bib36" class="usa-link" aria-describedby="bib36">Rosenberg et al., 2017</a>), and was recently approved by the European Medicines Agency and the Federal Drug Administration for use in children for treatment of Dravet Syndrome and Lenox-Gastaut Syndrome (<a href="#bib37" class="usa-link" aria-describedby="bib37">Sarker and Nahar, 2020</a>). Both of these diseases are rare early-onset epilepsies associated with Navs, with Dravet patients often having mutations in the hNav1.1 gene <em>SCN1A</em> (<a href="#bib21" class="usa-link" aria-describedby="bib21">Marini et al., 2011</a>). Despite a significant amount of evidence reporting on the effectiveness of CBD for treating epileptic conditions (<a href="#bib8" class="usa-link" aria-describedby="bib8">Cross et al., 2017</a>; <a href="#bib9" class="usa-link" aria-describedby="bib9">Devinsky et al., 2018</a>), the molecular basis of its target interactions with ion channels and receptors still remains unclear (<a href="#bib44" class="usa-link" aria-describedby="bib44">Watkins, 2019</a>).</p> <p>Functional studies have suggested that CBD both blocks the pore and stabilizes the inactivated states of sodium channels. It inhibits the channel activities of human Nav1.1-Nav1.7 isoforms, as well as those of the prokaryotic Nav homologue NaChBac, with IC<sub>50</sub>s ranging from 1.5 to 3.8 µM, suggesting inhibition occurs at physiologically-relevant concentrations (<a href="#bib31" class="usa-link" aria-describedby="bib31">Patel et al., 2016</a>; <a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a>). This preference for the inactivated state is a characteristic of classic pore blockers (<a href="#bib19" class="usa-link" aria-describedby="bib19">Kuo and Bean, 1994</a>). Furthermore the resurgent and persistent sodium currents of hNav1.2 have been shown to be inhibited at CBD concentrations of 1 µM (<a href="#bib23" class="usa-link" aria-describedby="bib23">Mason and Cummins, 2020</a>). However, to date, the structural basis of the interactions of CBD and Navs has not been identified on a molecular level.</p> <p>In the present study, in order to examine the nature of the interactions of CBD with sodium channels, the high-resolution crystal structure of a complex of CBD with the NavMs voltage-gated sodium channel from <em>M. marinus</em> (<a href="#bib40" class="usa-link" aria-describedby="bib40">Sula et al., 2017</a>) was determined, enabling the binding sites for the CBD molecule to be clearly defined. The NavMs channel has been shown to be an excellent exemplar for hNavs as it exhibits highly similar functional (<a href="#bib3" class="usa-link" aria-describedby="bib3">Bagnéris et al., 2014</a>; <a href="#bib18" class="usa-link" aria-describedby="bib18">Ke et al., 2018</a>), conductance (<a href="#bib42" class="usa-link" aria-describedby="bib42">Ulmschneider et al., 2013</a>), and drug-binding (similar IC<sub>50</sub> values) characteristics (<a href="#bib3" class="usa-link" aria-describedby="bib3">Bagnéris et al., 2014</a>), as well as sequence and structural homologies (<a href="#bib40" class="usa-link" aria-describedby="bib40">Sula et al., 2017</a>; <a href="#bib41" class="usa-link" aria-describedby="bib41">Sula and Wallace, 2017</a>).</p> <p>This high-resolution crystallographic study of a sodium channel-CBD complex, combined with functional studies of CBD on this channel, thus provides the means for both understanding the molecular interactions of CBD and Nav targets, and how these may be related to its use for treatment of epilepsy, and possibly other channelopathies.</p></section><section id="s2"><h2 class="pmc_sec_title">Results</h2> <p>This study utilised the prokaryotic NavMs voltage-gated sodium channel to examine the site of interactions of the naturally-occurring non-psychoactive CBD compound isolated from cannabis plants. NavMs channels are tetramers with each monomer consisting of six transmembrane (TM) helices (4 of which form each of the voltage sensor subdomains and 2 of which form the pore subdomains), whilst all of the hNav channel isoforms are monomers of four similar but not identical domains (each of which also consists of 6 transmembrane helices that are comprised of 4-helical voltage sensor subdomains and 2-helical pore subdomains) plus inter-domain loop regions (which differ considerably between hNavs, but are not involved in the CBD-binding sites).</p> <p>The compelling reason for using crystal structures of NavMs in this study is that they provide the, to date, highest resolution (~2.2–2.5 Å) views of any sodium channel (<a href="#bib29" class="usa-link" aria-describedby="bib29">Naylor et al., 2016</a>; <a href="#bib40" class="usa-link" aria-describedby="bib40">Sula et al., 2017</a>), especially of the TM and drug-binding regions, thus enabling detailed views of the protein molecular structures with drugs bound to them. This, combined with its strong sequence, structural and functional similarities (<a href="#bib40" class="usa-link" aria-describedby="bib40">Sula et al., 2017</a>; <a href="#bib41" class="usa-link" aria-describedby="bib41">Sula and Wallace, 2017</a>) to hNav1.1 and hNav1.2 channels, enables important comparisons with sodium channels found in human brain tissues. Structure/function/drug-binding studies using some of the other prokaryotic sodium channels have also been used for drug discovery projects (<a href="#bib22" class="usa-link" aria-describedby="bib22">Martin and Corry, 2014</a>; <a href="#bib30" class="usa-link" aria-describedby="bib30">Ouyang et al., 2007</a>), but their structures tend to be of lower resolution than those of NavMs. Furthermore the cryo-EM structures of hNavs available to date generally have overall resolutions of ~4–5 Å, with the transmembrane regions having the best resolutions of ~3 Å (not sufficient for detailed views of the binding sites), whilst their extra- and intra- membranous regions are less well defined. However, these reasons would not be sufficient to indicate the value of using NavMs for understanding the molecular basis of drug interactions if its functional properties (conductance and drug-binding affinities) were not comparable to those of hNavs, but NavMs and hNav1.1 have been shown to exhibit similar ion flux and other conductance properties, as well as very similar binding affinities for a wide range of sodium channel-specific drugs (<a href="#bib3" class="usa-link" aria-describedby="bib3">Bagnéris et al., 2014</a>).</p> <section id="s2-1"><h3 class="pmc_sec_title">The CBD-binding site in sodium channels</h3> <p>The CBD-binding site is located and clearly visible (<a href="#fig1" class="usa-link">Figure 1</a> and <a href="#fig2" class="usa-link">2</a>, <a href="#fig2s1" class="usa-link">Figure 2—figure supplement 1</a>) in a well-defined region of the NavMs-CBD structure, sited in the hydrophobic pockets present between subunits that run perpendicular to the channel direction (<a href="#bib26" class="usa-link" aria-describedby="bib26">Montini et al., 2018</a>) (such features have been designated ‘fenestrations’ and are located (horizontally in <a href="#fig1" class="usa-link">Figure 1</a>) in the transmembrane region, just below the level of the selectivity filter), and are the features originally proposed by <a href="#bib14" class="usa-link" aria-describedby="bib14">Hille, 1977</a> as sites for ingress of hydrophobic drugs into the channel interior. CBD is located at the ends of the fenestrations that lie closest to the central pore, and protrudes into (and blocks) the central transmembrane cavity, just below the sodium ion selectivity filter (<a href="#fig1" class="usa-link">Figure 1C</a>). There is experimental electron density (<a href="#fig2" class="usa-link">Figure 2A</a>, right panel) and enough room (<a href="#fig2" class="usa-link">Figure 2A</a>, third panel from left) for four CBD molecules in this region, although one would be sufficient to block sodium ion passage, as seen from the HOLE (<a href="#bib39" class="usa-link" aria-describedby="bib39">Smart et al., 1993</a>) depictions (<a href="#fig2" class="usa-link">Figure 2B</a>) and pore radius plots (<a href="#fig2" class="usa-link">Figure 2C</a>), which show the size of the transmembrane pathway with and without different numbers of CBD molecules; their blockage clearly provides a mechanism for channel inhibition as well as a basis for understanding the concentration-dependence of the drug effects. Each binding site is comprised of 11 residues from three different subunits in NavMs (shown in detail and in different colours in <a href="#fig1" class="usa-link">Figure 1D &amp; E</a>). The corresponding residues in hNavs arise from three different domains of the same polypeptide chain (<a href="#fig3" class="usa-link">Figure 3</a>). It should be noted here, that this region of the apo structure also exhibits some electron density (but has a different size and shape), which has been attributed to detergent molecules. The (2Fo-Fc) electron density map of the CBD complex (<a href="#fig2s1" class="usa-link">Figure 2—figure supplement 1</a>) clearly indicates that in these crystals the site is occupied by CBD rather than by detergent.</p> <figure class="fig xbox font-sm" id="fig1"><h4 class="obj_head">Figure 1. The NavMs sodium channel-cannabidiol (CBD) crystal structure.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig1.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/670ce8ab1021/elife-58593-fig1.jpg" loading="lazy" height="682" width="721" alt="Figure 1."></a></p> <div class="p text-right font-secondary"><a href="figure/fig1/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) The crystal structure (2.3 Å resolution) of the NavMs sodium channel (in coral coloured ribbon depiction) with one CBD molecule (in green space-filing depiction), showing its location within the hydrophobic cavity of the channel, located adjacent to the fenestration. Three sodium ions are shown as grey spheres in the selectivity filter, for visual reference. The view on the right is rotated 90 degrees from the view on the left. (<strong>B</strong>) As in (<strong>A</strong>) but showing 4 CBD molecules in stick depiction. (<strong>C</strong>) (left) Surface view of space filling structure of NavMs coloured by electrostatics with CBD (in green) present. The orientation is the same as in the left panel of part A. The CBD (in green) is only just visible through the exterior end of one of the fenestration holes. (right) As in panel B, but with a slice through the space filling model (and through the middle of the fenestrations). For clarity only 2 CBD molecules are included, showing where the drug lies along the fenestration and blocks the ion pathway. (<strong>D</strong>) The CBD-binding site: the polypeptide backbone of the NavMs-CBD complex is depicted in ribbon motif. The ribbons are coloured by subunit (regions of the subunits that come in close contact with the one CBD molecule shown, are depicted in red, grey, blue, and yellow). The (2Fo-Fc) map (in blue mesh) was calculated at 0.7 sigma and the structure of the CBD molecule present is in stick depiction. (<strong>E</strong>) Detailed views of the residues that lie within 3.9 Å of the CBD molecule (which is depicted in green/red stick representation) are shown and coloured by domain (as in part D). The H-bond between CBD and NavMs involves the M175 backbone carbonyl group, which is shown as a dashed black line. The distance between the side chain of T207 and the CBD molecule is 3.7 Å, and is indicated by a dotted red line. This is the residue that was mutated in the electrophysiology studies. The pink sphere indicates the sodium ion site in the selectivity filter which is furthest from the extra-membranous surface (the one located farthest into the channel). On the right is the same view, rotated by 90 degrees.</p></figcaption></figure><figure class="fig xbox font-sm" id="fig2"><h4 class="obj_head">Figure 2. NavMs structures and pore diameters in the absence and presence of CBD.</h4> <figcaption><p>The NavMs structure (coral) is depicted in ribbon motif. (<strong>A</strong>) (from the left): For clarity, only a single NavMs monomer with one CDB (green sticks) is shown; the NavMs tetrameric structure with all 4 CBDs bound; top view of NavMs tetramer with all 4 CDBs bound; top view of NavMs tetramer showing the electron density map (blue) demonstrating all 4 CBDs are bound in the tetrameric structure. (<strong>B</strong>) Pore interior dimensions calculated using the HOLE algorithm (<a href="#bib39" class="usa-link" aria-describedby="bib39">Smart et al., 1993</a>). Progressively from left to right: The apo structure and structures with 1, 2, and 4 CBD molecules present. In this figure the HOLE surface is depicted in blue for pore radii greater than 2.3 Å, and green for radii less than 2.3 Å. There is no occlusion in the absence of CBD, so hydrated sodium ions could freely pass through the pore. The NavMs structure with 4 CBD molecules present shows a full occlusion in the middle of the channel transmembrane pathway (near the centre of the hydrophobic cavity, so ion transport would be prevented [<a href="#bib29" class="usa-link" aria-describedby="bib29">Naylor et al., 2016</a>]). (<strong>C</strong>) Accessibility plots of pore radii versus position within the pore, in the absence and presence of different numbers of CBD molecules. The plot for the apo structure is in blue, and the plots for the CBD-containing structures with 1, 2, or 4 CBD molecules are in coral, red and black, respectively. The plots for 2 and 3 CBD molecules were the same, so the latter is not shown. In cases where at least some region of the radius is &lt;2.0 Å, sodium ions will not be able to be translocated across the channel (<a href="#bib29" class="usa-link" aria-describedby="bib29">Naylor et al., 2016</a>). This plot thus shows that regardless of whether one or more CBD molecules are present, ion passage will not occur. These figures were produced using VMD software (<a href="#bib15" class="usa-link" aria-describedby="bib15">Humphrey et al., 1996</a>). </p></figcaption><p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig2.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/8b420618bdfd/elife-58593-fig2.jpg" loading="lazy" height="515" width="708" alt="Figure 2."></a></p> <div class="p"><figure class="fig xbox font-sm" id="fig2s1"><h5 class="obj_head">Figure 2—figure supplement 1. Comparisons of the electron density map of CBD in the NavMs-CBD complex with the electron density maps of Apo-NavMs crystals.</h5> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig2-figsupp1.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/f0526bbac692/elife-58593-fig2-figsupp1.jpg" loading="lazy" height="202" width="708" alt="Figure 2—figure supplement 1."></a></p> <figcaption><div class="p">(<strong>A</strong>) CBD molecule fit into the NavMs-CBD crystal structure (overlaid by the 2Fo-Fc map contoured at 0.75 sigma), indicating the fit of the CBD to the density. (<strong>B</strong>) Aliphatic (C<sub>9</sub>H<sub>20</sub>) part of a lipid (or detergent) molecule (overlaid by the (2Fo-Fc) density (also contoured in blue at 0.75 sigma) in the crystal structure of Apo-NavMs. (<strong>C</strong>) The C<sub>9</sub>H<sub>20</sub> structure refined into the NavMs-CBD (2Fo-Fc) (blue) map also contoured at 0.75 sigma [but without CBD structure present during refinement]. The green and red meshes (Fo-Fc maps contoured at sigma = 3) correspond to unaccounted for positive and negative densities, respectively). This clearly indicates that the density seen in the NavMs-CBD map is not due to bound lipid or detergent. The extra densities seen in the apo-NavMs maps may, however, arise from transient/partial occupancy of the cavity by a lipid, as had been indicated by molecular dynamics simulations (<a href="#bib42" class="usa-link" aria-describedby="bib42">Ulmschneider et al., 2013</a>), but occupancy by a lipid molecule for any significant time period is unlikely as it would inhibit the entry of hydrophobic drugs into the fenestration. In all panels the protein is shown in ribbon depiction (different colours for different polypeptide chains in the tetramer) and the three sodium ions present in the channel selectivity filter are shown as small grey balls, for visual reference.</div></figcaption></figure></div> <div class="p text-right font-secondary"><a href="figure/fig2/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></figure><figure class="fig xbox font-sm" id="fig3"><h4 class="obj_head">Figure 3. Location of CBD-binding sites in NavMs and the equivalent sites in hNav1.2.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig3.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/4e63684c86d8/elife-58593-fig3.jpg" loading="lazy" height="399" width="714" alt="Figure 3."></a></p> <div class="p text-right font-secondary"><a href="figure/fig3/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(Centre) Structural alignment of the NavMs-CBD crystal structure (coral) and the hNav1.2 cryo-EM structure (grey). The RMSD of the aligned structures is 3.2 Å. (Top left): equivalent binding residues between domain I and domain II of hNav1.2 found within 4 Å of the CBD site. (Top right): equivalent binding residues in hNav1.2 between domains II and III located within 4 Å of the CBD-binding site. (Bottom left): Residues in hNav1.2 between domains III and IV within 4 Å of the CBD-binding site. (Bottom right): Residues in hNAv1.2 between domains IV and I within 4 Å of the CBD-binding site. In the surrounding panels the atoms in the protein are coloured by atom type, with carbons represented in grey, oxygen in red, nitrogen in blue, and sulphur in yellow, whilst the carbon atoms of the drug are depicted in green and the oxygens in red.</p></figcaption></figure><p>The location of the CBD-binding site is very close to the locations of the binding sites that have been identified for analgesic and other hydrophobic compounds in NavMs (<a href="#bib3" class="usa-link" aria-describedby="bib3">Bagnéris et al., 2014</a>; <a href="#fig4" class="usa-link">Figure 4</a>) as well as in another bacterial sodium channel, NavAb (<a href="#bib12" class="usa-link" aria-describedby="bib12">Gamal El-Din et al., 2018</a>). This is of interest because those other compounds also inhibit hNav functions, and so suggest the importance of this site for drug interactions in humans. All of the interactions seen except one, that of residue M175 (<a href="#fig1" class="usa-link">Figure 1E</a>), involve hydrophobic interactions rather than hydrogen-bond formation (but that particular interaction between the main chain carbonyl of residue M175 and the OH group present in CBD, may be important for specificity of binding – see below).</p> <figure class="fig xbox font-sm" id="fig4"><h4 class="obj_head">Figure 4. Similarity of CBD and analgesic compound binding sites.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig4.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/f222b50a9509/elife-58593-fig4.jpg" loading="lazy" height="418" width="769" alt="Figure 4."></a></p> <div class="p text-right font-secondary"><a href="figure/fig4/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Structural alignment of the NavMs-CBD complex (protein in coral ribbon depiction, CBD in green stick depiction), with the structure of the NavMs pore-PI1 complex (<a href="#bib3" class="usa-link" aria-describedby="bib3">Bagnéris et al., 2014</a>) [the protein is in grey ribbon depiction and the PI1 molecule is in blue stick depiction]. PI1 is a highly potent designed analgesic compound, which binds to and inhibits flux through the NavMs channel (<a href="#bib3" class="usa-link" aria-describedby="bib3">Bagnéris et al., 2014</a>). Two views of the aligned structural complexes, rotated by 90 degrees, are shown. They show the similarity, but not identity of the binding sites of the two ligands. (<strong>B</strong>) Detailed view showing the locations of these molecules in the pore/fenestration area. (<strong>C</strong>) Chemical structure of the PI1 compound.</p></figcaption></figure></section><section id="s2-2"><h3 class="pmc_sec_title">CBD inhibition of NavMs function</h3> <p>To investigate whether CBD functionally inhibits NavMs, whole-cell voltage-clamp studies of transiently transfected cells were performed (<a href="#fig5" class="usa-link">Figure 5</a>). Previous studies (<a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a>) had shown that CBD imparts little selectivity in inhibiting various voltage-dependent sodium channels, including the bacterial sodium channel NaChBac. CBD inhibitions of Nav channels have steep Hill-slopes (~2) from both resting- and inactivated- states, indicating that relatively small magnitude differences in CBD potency are a product of the difference in slope. In the present study it was shown that CBD inhibits NavMs less potently and with a slightly shallower Hill slope than the other Nav channels previously studied (<a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a> <a href="#fig5" class="usa-link">Figure 5A</a>). The moderate variation in CBD inhibition potency between human Navs and NavMs is consistent with previous reports using other Nav blockers (<a href="#bib3" class="usa-link" aria-describedby="bib3">Bagnéris et al., 2014</a>). Overall, these results show that CBD inhibits NavMs similarly to other Nav channels and, thus supports the proposed interaction inside the pore depicted in the NavMs structure as being functionally relevant.</p> <figure class="fig xbox font-sm" id="fig5"><h4 class="obj_head">Figure 5. Electrophysiology studies of CBD inhibition of NavMs.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig5.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/97dddfe506ec/elife-58593-fig5.jpg" loading="lazy" height="961" width="708" alt="Figure 5."></a></p> <div class="p text-right font-secondary"><a href="figure/fig5/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Block was measured after ~6 min wash and incubation in CBD. The IC<sub>50</sub> measurement was from CBD inhibition data obtained from whole-cell voltage-clamp recordings and fit with the Hill-Langmuir equation. The IC<sub>50</sub> for CBD inhibition of wild-type NavMs is 17.8 ± 0.5 µM with a Hill slope of 1.5 ± 0.1 (the S.E. values quoted are errors of the fit, n = 8 panel-wide). (<strong>B</strong>) Sample traces of (top) wild-type NavMs without CBD added, (middle) wild-type NavMs before (black) and after (red)10 µM CBD perfusion (compound effect was measured after ~6 min of wash/incubation, 1 Hz), and (bottom), as in the middle panel, but using the T207A mutant (in green). (<strong>C</strong>) Bar graphs showing percentage of peak sodium current remaining over time after control (no CBD) (grey) and with CBD (red, green, as above) perfusions at 10 µM (n = 4–6). Statistical comparison against control: WT (p&lt;0.0027) and T207A (p=0.0269).</p></figcaption></figure><p>To gain further functional insight into the molecular interactions between CBD and the NavMs pore, CBD block was measured using the T207A mutant channel. This residue is located in the CBD-binding site (<a href="#fig1" class="usa-link">Figure 1E</a>), with its side chain involved in hydrophobic interactions with the drug. This threonine has the closest sidechain (3.7 Å) to the CBD molecule. The mutation of the threonine side chain to a smaller alanine side chain results in a modest reduction in the CBD block (<a href="#fig5" class="usa-link">Figure 5B,C</a>), hence correlating its location with a functional effect.</p></section><section id="s2-3"><h3 class="pmc_sec_title">Comparison of specificity/potential interactions with other hNavs</h3> <p>The focus of functional effects of CBD on hNavs has primarily been on hNav1.1, due to its association with epilepsy, although there is yet no structure for this isoform. However, due to the strong sequence similarities of hNav1.1, hNav1.2 and NavMs in the region identified as the binding site in NavMs (<a href="#fig6" class="usa-link">Figure 6</a>), it has been possible to explore potential interactions using a hNav1.1 homology model based on the hNav1.2 cryo-EM structure (<a href="#fig6s1" class="usa-link">Figure 6—figure supplement 1</a>). It suggests, not surprisingly, that the interactions would be very similar to those of Nav1.2 and NavMs in this region (<a href="#fig6s1" class="usa-link">Figure 6—figure supplement 1</a>). In NavMs, the involvement of the T207 residue is of importance as it is well established as a primary binding site for local anaesthetics (and has been shown to be involved in the electrophysiology studies on NavMs reported herein). Furthermore, when the equivalent residue (F1774) was mutated in hNav1.1 (boxed in <a href="#fig6" class="usa-link">Figure 6</a>), the binding affinity of CBD was found to decrease by a factor of ~2.5 (<a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a>). The binding site residues (coloured red in <a href="#fig6" class="usa-link">Figure 6</a>) include both residues that are identical/homologous in NavMs and hNavs as well as residues that are only found in NavMs and not in human Navs. In most cases the non-cognate residues are also variable between hNavs and would thus appear not to be essential for the interactions. It is notable, however, that the T207 residue that produced the altered electrophysiology results (<a href="#fig5" class="usa-link">Figure 5</a>) is at a comparable site to the phenylalanine (F1774 in hNav1.1 – <a href="#fig6s1" class="usa-link">Figure 6—figure supplement 1</a>) in the local anaesthetic site, which was also found to moderately alter the functon in the hNav1.1 orthologue (<a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a>).</p> <figure class="fig xbox font-sm" id="fig6"><h4 class="obj_head">Figure 6. Sequence alignments of CBD-binding site regions of NavMs With corresponding regions in hNav1.1 and hNav1.2.</h4> <figcaption><p>In red are the CBD-binding residues (within 3.9 Å of the compound) in NavMs and the equivalent residues in hNav1.1 and hNav1.2. The bold black F indicates the site of the NavMs F208L mutant used in these studies. It was changed from F to L in NavMs<sub>L</sub> because in half of the human Nav domains it is an F and in the other half it is an L (both indicated in bold black in the other sequences). However, as shown in <a href="#fig6s2" class="usa-link"><a href="#fig6s2" class="usa-link">Figure 6—figure supplement 2</a></a>, the residue type present at this site makes essentially no difference in the structure. Residues located in the binding site are found within the P1 pore helix, the selectivity filter loop, and the S6 helix. The residue, which when mutated to alanine in hNav1.1 reduces the binding affinity of CBD (<a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a>), is boxed. This corresponds to T207 in NavMs, which is the residue that was mutated to alanine in the electrophysiology characterisations in the present study. The sequence alignment was carried out using Clustal Omega (<a href="#bib38" class="usa-link" aria-describedby="bib38">Sievers et al., 2011</a>) and annotated manually. </p></figcaption><p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig6.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/ff63f999d792/elife-58593-fig6.jpg" loading="lazy" height="342" width="776" alt="Figure 6."></a></p> <div class="p"><figure class="fig xbox font-sm" id="fig6s1"><h5 class="obj_head">Figure 6—figure supplement 1. Alignment of the NavMs-CBD structure (coral) with a homology model of hNav1.1 (grey).</h5> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig6-figsupp1.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/f00448fa1953/elife-58593-fig6-figsupp1.jpg" loading="lazy" height="408" width="772" alt="Figure 6—figure supplement 1."></a></p> <figcaption><div class="p">The homology model was created in SWISS-MODEL (<a href="#bib43" class="usa-link" aria-describedby="bib43">Waterhouse et al., 2009</a>) using hNav1.2 (PDB code 6J8E) as a template. (<strong>A</strong>) Overall structural alignment. (RMSD = 3.34 Å for the transmembrane regions). (<strong>B</strong>) Detail of this overlay showing the location of CBD (green and red stick depiction) in the region of NavMs residue T207 (light blue stick representation); this residue corresponds with residue F1774 in hNav1.1, which is a residue that has been identified as being in the local anaesthetic binding site, and was the residue that was mutated in electrophysiology experiments (<a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a>), which showed the effects of CBD inhibition on hNav1.2.</div></figcaption></figure></div> <div class="p"><figure class="fig xbox font-sm" id="fig6s2"><h5 class="obj_head">Figure 6—figure supplement 2. Comparisons of wild type NavMs (gold) [PDB ID 5HVX] and the NavMs<sub>L</sub> mutant (coral) [PDB ID 6YZ2] structures.</h5> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig6-figsupp2.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/2a69ef646d1f/elife-58593-fig6-figsupp2.jpg" loading="lazy" height="315" width="687" alt="Figure 6—figure supplement 2."></a></p> <figcaption><div class="p">These figures show (left) the close overall similarities of the structures, and (right) the detailed region surrounding mutated residue F208L (which is circled in both panels, and is indicated in bold in the sequence alignment shown in <a href="#fig6" class="usa-link">Figure 6</a>).</div></figcaption></figure></div> <div class="p text-right font-secondary"><a href="figure/fig6/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></figure></section><section id="s2-4"><h3 class="pmc_sec_title">Modelling the binding of CBD relative to that of THC</h3> <p>There are two main phytocannabinoids that can be extracted from cannabis plants, the psychoactive tetrahydrocannabinol (THC) and the non-psychoactive CBD. Electrophysiological studies on hNavs and the bacterial NaChBac have identified CBD (<a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a>) as having functional effects that are distinct from those of THC on these channels. CBD and THC have previously been shown to inhibit hNav1.2 with similar potencies, however the THC inhibition slope was less steep than that of CBD (<a href="#bib13" class="usa-link" aria-describedby="bib13">Ghovanloo et al., 2018</a>).</p> <p>The chemical structures of CBD and THC are very similar (<a href="#fig7" class="usa-link">Figure 7A</a>), differing only by the presence of an additional free hydroxyl group on one of the rings in CBD (in THC the equivalent oxygen forms part of a closed pyran ring). Therefore, the structure of the CBD/NavMs complex was examined to see if it could provide a clue as to the reasons for the different functional effects of the two compounds. As can be seen in <a href="#fig7" class="usa-link">Figure 7B</a>, by placing the THC structure into the CBD-binding site with the same orientation as found for CBD, it can be physically and sterically accommodated. However, and crucially, it is missing the one electrostatic interaction seen between CBD and NavMs: the hydrogen bond between the oxygen of the main chain residue M175 and the drug (<a href="#fig7" class="usa-link">Figure 7C</a>). This is the consequence of the absence of the additional free hydroxyl group in THC, as noted above. That hydroxyl group is the one which forms the hydrogen bond present in the CBD-protein complex, and provides an additional intermolecular interaction for CBD, which could account for the differences in functional effects (inhibition slopes) of the two compounds on voltage-gated sodium channels.</p> <figure class="fig xbox font-sm" id="fig7"><h4 class="obj_head">Figure 7. Comparisons of CBD and THC.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig7.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/429fbb6efb07/elife-58593-fig7.jpg" loading="lazy" height="722" width="708" alt="Figure 7."></a></p> <div class="p text-right font-secondary"><a href="figure/fig7/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Chemical structures of cannabidiol (CBD) (left) and Δ-9-tetrahydrocannabinol (THC) (right). The difference between the two structures is highlighted in blue background. The formation of a pyran ring in THC removes the hydrogen from the hydroxyl group which is present in CBD. (<strong>B</strong>) The locations of CBD in the CBD-NavMs crystal structure (left), and THC (right) modelled into this site. The NavMs structure is depicted in grey ribbons, and the three sodium ions sites in the selectively filter are indicated by the pink balls, as a reference point. (<strong>C</strong>) (left) A detailed overlay of CBD (coral) and THC (blue) shows the additional hydrogen bond between the protein and drug for CBD, by comparison to THC, which, without the corresponding hydroxyl group does not have the potential to form such a hydrogen bond. The view on the right is rotated from the view on the left to clearly visualise the alignment.</p></figcaption></figure></section><section id="s2-5"><h3 class="pmc_sec_title">Comparison with binding to the TRPV2 channel</h3> <p>CBD has also been suggested to be a potential activator of the Transient Receptor Potential Cation Channel Subfamily V Member 2 (TRPV2) channel (<a href="#bib34" class="usa-link" aria-describedby="bib34">Qin et al., 2008</a>; <a href="#bib27" class="usa-link" aria-describedby="bib27">Morelli et al., 2013</a>), a channel which facilitates the non-specific movement of both sodium and calcium ions through plasma membranes. According to electrophysiology studies, CBD activates rat TRPV2 with an EC<sub>50</sub> of 3.7 µM (<a href="#bib34" class="usa-link" aria-describedby="bib34">Qin et al., 2008</a>), although the link with epilepsy (<a href="#bib27" class="usa-link" aria-describedby="bib27">Morelli et al., 2013</a>) is much less direct than that for sodium channels. Recently cryo-electron microscopy (cryo-EM) was used to elucidate the structure of TRPV2 in a CBD-bound state at a nominal resolution of 3.2 Å (<a href="#bib33" class="usa-link" aria-describedby="bib33">Pumroy et al., 2019</a>); that study indicated the presence of CBD in the pore region of the protein, thus supporting the proposal for TRPV2 being a candidate target for CBD binding. The general location of the CBD was visible in the structure, although the lower resolution of that structure did not allow detailed analysis of its binding site. However, its interactions appear to involve a number of hydrophobic side chains, whilst requiring a partial refolding of the adjacent region of the protein polypeptide. The binding site found for CBD in the TRPV2 structure is in a similar region to that of CBD in NavMs (<a href="#fig8" class="usa-link">Figure 8</a>). However, the sodium channel-CBD site is located further into the fenestration than it is in TRPV2, but closer to the ion binding sites, and thus could more effectively modulate effects in the transmembrane passageway for ion conductance, and could account for sodium channels being blocked by CBD, whilst TRPV2 channels appear to be activated by them (<a href="#bib27" class="usa-link" aria-describedby="bib27">Morelli et al., 2013</a>).</p> <figure class="fig xbox font-sm" id="fig8"><h4 class="obj_head">Figure 8. Structural alignments of the NavMs-CBD (coral ribbons) crystal structure and the TRPV2-CBD cryo-EM structure [PDB ID 6U88] (grey ribbons).</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&amp;p=PMC3&amp;id=7641581_elife-58593-fig8.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9de/7641581/1ed2cb9d82d1/elife-58593-fig8.jpg" loading="lazy" height="361" width="708" alt="Figure 8."></a></p> <div class="p text-right font-secondary"><a href="figure/fig8/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(Left) Overall alignment of the structures. The TRPV2 structure was trimmed to remove the extramembranous regions for clarity. The RMSD of the alignment is 4.2 Å. The CBD in NavMs is shown in green and that in TRPV2 is in blue. The CBD site in NavMs appears to be located further into the fenestration than it is in TRPV2. (Right) Detailed view of the CBD sites, highlighting the similarity and differences in orientation and location in the two channel types.</p></figcaption></figure></section></section><section id="s3"><h2 class="pmc_sec_title">Discussion</h2> <p>This study has demonstrated the nature of the interactions of CBD and a voltage-gated sodium channel, showing that CBD-binding blocks the transmembrane pathway for sodium ion translocation through the membrane (<a href="#bib29" class="usa-link" aria-describedby="bib29">Naylor et al., 2016</a>), and hence provides a potential mechanism for the functioning of CBD in sodium channels. It further suggests a possible molecular basis for the medicinal effects of CBD in the treatment of epilepsies, as sodium channels have been shown to be causally-related to various types of human epilepsy, with disease-related mutations interfering with sodium ion transmembrane flux. The CBD-binding site is a novel site, near to, but not coincident with, known analgesic binding sites in sodium channels. The binding site is located at the pore end of the transmembrane fenestrations which enable the ingress of hydrophobic molecules into the channel lumen, hence this may also provide the pathway for CBD to enter and block the channels.</p> <p>Examination of the residues involved in the binding site interactions and modelling of the THC into the CBD-binding site have indicated a possible reason for why the closely-related psychoactive phytocannabinoid THC has not been observed to have a similar effect on sodium channel function: THC would be able to physically fit in the CBD site when oriented in the same manner, but it does not have the same hydroxyl moiety that in CBD forms an important hydrogen-bonding interaction with the channel protein.</p> <p>A recent cryo-EM structural study (at lower resolution) has suggested that the TRPV2 channel may be a CBD-binding target, although that study did not show the relationship of the binding site to epilepsy-based mutations. Functional studies suggest these two channels act by different mechanisms: CBD is a channel blocker in NavMs, whilst in TRPV2 channels it appears to be a channel activator. In addition, NavMs channel and TRPV2 have quite different overall molecular folds: the NavMs channel is rather narrow, enabling sodium ion selectivity, whilst TRPV2 channel is able to act as a conduit for much larger substrates. Nevertheless, it is interesting that the binding sites for CBD in NavMs and TRPV2 (<a href="#fig8" class="usa-link">Figure 8</a>) appear to be in a roughly comparable structural feature: near the transmembrane channel and substrates (sodium ions in the case of NavMs) pathways, and adjacent to the fenestration pathways that are proposed to enable drugs to enter into the channels.</p> <p>In summary, this study has provided high-resolution structural evidence, along with functional studies, elucidating the molecular basis of the interactions of CBD, a drug recently approved for treatment of epilepsy, with a voltage-gated sodium channel target.</p></section><section id="s4"><h2 class="pmc_sec_title">Materials and methods</h2> <section class="tw xbox font-sm" id="keyresource"><h3 class="obj_head">Key resources table.</h3> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"> <thead><tr> <th rowspan="1" colspan="1">Reagent type <br>(species) or resource</th> <th rowspan="1" colspan="1">Designation</th> <th rowspan="1" colspan="1">Source or reference</th> <th rowspan="1" colspan="1">Identifiers</th> <th rowspan="1" colspan="1">Additional <br>information</th> </tr></thead> <tbody> <tr> <td rowspan="1" colspan="1">Gene (Magnetococcus marinus MC-1)</td> <td rowspan="1" colspan="1">NavMs</td> <td rowspan="1" colspan="1">Uniprot</td> <td rowspan="1" colspan="1">Mmc1_0789</td> <td rowspan="1" colspan="1">A0L5S6_MAGMM</td> </tr> <tr> <td rowspan="1" colspan="1">Strain, strain background (<em>Escherichia coli</em>)</td> <td rowspan="1" colspan="1">Over Express C41 (DE3)</td> <td rowspan="1" colspan="1">Sigma-Aldrich</td> <td rowspan="1" colspan="1">CMC0017</td> <td rowspan="1" colspan="1">Chemically competent <em>E. coli</em> for expression of toxic proteins</td> </tr> <tr> <td rowspan="1" colspan="1">Cell line (<em>Cricetulus griseus</em>)</td> <td rowspan="1" colspan="1">CHO-K1</td> <td rowspan="1" colspan="1">CedarLine Laboratories</td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/CVCL_0214" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">CVCL_0214</a> </td> <td rowspan="1" colspan="1"></td> </tr> <tr> <td rowspan="1" colspan="1">Recombinant DNA reagent</td> <td rowspan="1" colspan="1">pET15b plasmid encoding NavMs</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/28205548" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">28205548</a> </td> <td rowspan="1" colspan="1"></td> <td rowspan="1" colspan="1">Plasmid for NavMs and NavMsL expression for structural study</td> </tr> <tr> <td rowspan="1" colspan="1">Recombinant DNA reagent</td> <td rowspan="1" colspan="1">His-NavMs</td> <td rowspan="1" colspan="1"><a href="http://addgene.org/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">addgene.org</a></td> <td rowspan="1" colspan="1">100004</td> <td rowspan="1" colspan="1">pTracer-CMV2, IRES GFP plasmid encoding NavMs</td> </tr> <tr> <td rowspan="1" colspan="1">Sequence-based reagent</td> <td rowspan="1" colspan="1">F208L_F</td> <td rowspan="1" colspan="1">This Paper</td> <td rowspan="1" colspan="1">PCR Primer for NavMsL (forward)</td> <td rowspan="1" colspan="1">5'-<em>CTCACCACCCTGA</em> <br><em>CCGTGCTCAACCTGT</em> <br><em>TTATTGG</em>-3′</td> </tr> <tr> <td rowspan="1" colspan="1">Squence-based reagent</td> <td rowspan="1" colspan="1">F208L_R</td> <td rowspan="1" colspan="1">This Paper</td> <td rowspan="1" colspan="1">PCR Primer for NavMsL (reverse)</td> <td rowspan="1" colspan="1">5′-<em>GAGCACGGTCAGG</em> <br><em>GTGGTGAGCATGATG</em> <br>+<em>AACGGGATG</em>-3′</td> </tr> <tr> <td rowspan="1" colspan="1">Chemical compound, drug</td> <td rowspan="1" colspan="1">Cannabidiol (CBD)</td> <td rowspan="1" colspan="1">Sigma-Aldrich</td> <td rowspan="1" colspan="1">C7515</td> <td rowspan="1" colspan="1"></td> </tr> <tr> <td rowspan="1" colspan="1">Chemical compound, drug</td> <td rowspan="1" colspan="1">Cannabidiol (CBD)</td> <td rowspan="1" colspan="1">Toronto Research Chemicals</td> <td valign="bottom" rowspan="1" colspan="1">F175300</td> <td rowspan="1" colspan="1"></td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">XDS</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/20124692" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">20124692</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_015652" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_015652</a> </td> <td rowspan="1" colspan="1">Data Processing</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">Aimless</td> <td valign="bottom" rowspan="1" colspan="1">doi:<a href="https://doi.org/10.1107/S0907444913000061" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">10.1107/S0907444913000061</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_015747" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_015747</a> </td> <td rowspan="1" colspan="1">Data Processing</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">CCP4</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/15299374" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">15299374</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_007255" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_007255</a> </td> <td rowspan="1" colspan="1">Structure Determination/Refinement</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">Phaser</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/19461840" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">19461840</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_014219" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_014219</a> </td> <td rowspan="1" colspan="1">Structure Determination/Refinement</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">Coot</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/20383002" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">20383002</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_014222" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_014222</a> </td> <td rowspan="1" colspan="1">Structure Determination/Refinement</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">REFMAC</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/21460454" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">21460454</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_014225" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_014225</a> </td> <td rowspan="1" colspan="1">Structure Determination/Refinement</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">PROCHECK</td> <td rowspan="1" colspan="1">doi:<a href="https://doi.org/10.1107/s0021889892009944" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">10.1107/s0021889892009944</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_019043" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_019043</a> </td> <td rowspan="1" colspan="1">Structure Determination/Refinement</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">Molprobity</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/29067766" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">29067766</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_014226" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_014226</a> </td> <td rowspan="1" colspan="1">Structure Determination/Refinement</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">BUSTER</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/22505257" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">22505257</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_015653" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_015653</a> </td> <td rowspan="1" colspan="1">Structure Determination/Refinement</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">CCP4mg</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/21460457" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">21460457</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_019041" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_019041</a> </td> <td rowspan="1" colspan="1">Structure Presentation</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">PatchMaster</td> <td rowspan="1" colspan="1">HEKA Elektronik</td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_000034" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_000034</a> </td> <td rowspan="1" colspan="1">Data Acquisition</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">FitMaster</td> <td rowspan="1" colspan="1">HEKA Elektronik</td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_016233" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_016233</a> </td> <td rowspan="1" colspan="1">Data Analysis</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">IGOR Pro</td> <td valign="bottom" rowspan="1" colspan="1">Wavemetrics, Lake Oswego, OR</td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_000325" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_000325</a> </td> <td rowspan="1" colspan="1">Data Analysis</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">Clustal Omega</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/24170397" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">24170397</a> </td> <td rowspan="1" colspan="1">RRID:<a href="https://scicrunch.org/resolver/SCR_001591" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">SCR_001591</a> </td> <td rowspan="1" colspan="1">Sequence Alignment</td> </tr> <tr> <td rowspan="1" colspan="1">Software, algorithm</td> <td rowspan="1" colspan="1">HOLE</td> <td rowspan="1" colspan="1">PMID:<a href="https://www.ncbi.nlm.nih.gov/pubmed/9195488" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">9195488</a> </td> <td valign="bottom" rowspan="1" colspan="1"><a href="http://www.holeprogram.org" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">www.holeprogram.org</a></td> <td rowspan="1" colspan="1">Channel Pore Dimension Analysis</td> </tr> </tbody> </table></div> <div class="p text-right font-secondary"><a href="table/keyresource/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></section><section id="s4-1"><h3 class="pmc_sec_title">Materials</h3> <p>Thrombin was purchased from Novagen Inc (Germany), decanoyl-N-hydroxyethylglucamide (Hega10) was purchased from Anatrace (USA); dimethyl sulfoxide (DMSO), sodium chloride, 2-amino-2-(hydroxymethyl)−1,3-propanediol (Tris), and imidazole were purchased from ThermoFisher Scientific (USA). Cannabidiol samples for structural and electrophysiology studies were purchased, respectively, from Sigma and Toronto Research Chemicals. Purification columns were purchased from GE Healthcare (USA). The F208L (NavMs<sub>L</sub>) (<a href="#fig6s2" class="usa-link">Figure 6—figure supplement 2</a>) mutation for crystallography was introduced by the SLIM site-directed mutagenesis protocol (<a href="#bib7" class="usa-link" aria-describedby="bib7">Chiu et al., 2004</a>), using the forward primer 5′-<em>CTCACCACCCTGACCGTGCTCAACCTGTTTATTGG</em>-3′ and reverse primer 5′-<em>GAGCACGGTCAGGGTGGTGAGCATGATGAACGGGATG</em>-3′. The sequence was verified by Source Bioscience, UK.</p></section><section id="s4-2"><h3 class="pmc_sec_title">Protein expression and purification</h3> <p>The NavMs (Uniprot ID A0L5S6) and NavMs<sub>L</sub> proteins were expressed and purified as previously described (<a href="#bib40" class="usa-link" aria-describedby="bib40">Sula et al., 2017</a>), with the following modifications: the bound protein was eluted in a buffer containing 20 mM Tris, pH 7.5, 300 mM NaCl, 0.5 M imidazole and 0.52% Hega10. The Histag was removed by thrombin cleavage overnight at 4° C. The protein sample was loaded onto a Superdex 200 column and eluted with 20 mM Tris, pH 7.5, 300 mM NaCl, and 0.52% Hega10 buffer. Protein samples were pooled and concentrated to 10 mg/ml using a 100 kDa cut-off Amicon concentrator and stored at a concentration of 10 mg/ml at −80°C.</p></section><section id="s4-3"><h3 class="pmc_sec_title">Crystallisation, data collection and structure determination</h3> <p>1 μl of cannabidiol (100 mM) in 100% DMSO was added to 50 μl of the purified protein solution to produce a final protein concentration of ~10 mg/ml containing 2 mM CBD and 2% v/v DMSO. The best crystals were grown at 4°C via the sitting drop vapour diffusion method using a 2:1 ratio of the protein and reservoir solutions containing 0.1 M sodium chloride, 0.1M lithium sulphate, 0.1 M HEPES, pH 7, and 30% v/v PEG300. The apo-NavMs<sub>L</sub> crystals were grown under the same condition as the crystals of the CBD complex, but without the DMSO and drug. Crystals were flash-frozen, with the PEG300 acting as the cryo-protectant. Data were collected on beamline P13 at the Electron Synchrotron (DESY, Germany); on beamline Proxima1 at the Soleil Synchrotron (France), and on beamlines IO3, IO4, and I24 at the Diamond Light Source (UK). Hundreds of crystals were screened and full data sets were collected from more than 40 crystals. Diffraction images were integrated and scaled using XDS (<a href="#bib16" class="usa-link" aria-describedby="bib16">Kabsch, 2010</a>) and then merged with Aimless (<a href="#bib11" class="usa-link" aria-describedby="bib11">Evans and Murshudov, 2013</a>) using the CCP4 suite of programmes (<a href="#bib45" class="usa-link" aria-describedby="bib45">Winn et al., 2011</a>). The structure was determined from the crystals which diffracted to the highest resolution (2.2 Å for the apo protein, and 2.3 Å for the CBD complex). Because of the small but significant variations in the unit cell dimensions and resolution between different crystals of the same type produced under the same conditions, as we have seen previously (<a href="#bib29" class="usa-link" aria-describedby="bib29">Naylor et al., 2016</a>; <a href="#bib40" class="usa-link" aria-describedby="bib40">Sula et al., 2017</a>), datasets from different crystals were not merged.</p> <p>The structure determinations by molecular replacement were as previously described (<a href="#bib40" class="usa-link" aria-describedby="bib40">Sula et al., 2017</a>) using Phaser (<a href="#bib24" class="usa-link" aria-describedby="bib24">McCoy et al., 2007</a>) with the full-length wildtype NavMs structure (PDB 5HVX) as the search model. Model building was carried out using Coot (<a href="#bib10" class="usa-link" aria-describedby="bib10">Emsley et al., 2010</a>). Refinement was initially done using REFMACS (<a href="#bib28" class="usa-link" aria-describedby="bib28">Murshudov et al., 2011</a>), and then the refinement was continued using Buster (<a href="#bib4" class="usa-link" aria-describedby="bib4">Bricogne et al., 2019</a>). Data collection, processing and refinement statistics for both the apo and CBD complex structures are listed in <a href="#supp1" class="usa-link">Supplementary file 1</a>. The structure quality was checked using PROCHECK (<a href="#bib20" class="usa-link" aria-describedby="bib20">Laskowski et al., 1993</a>) and MolProbity (<a href="#bib6" class="usa-link" aria-describedby="bib6">Chen et al., 2010</a>), which indicated that 100% of the residues were in allowed conformations. Figures were created in CCP4mg (<a href="#bib25" class="usa-link" aria-describedby="bib25">McNicholas et al., 2011</a>), unless otherwise noted.</p></section><section id="s4-4"><h3 class="pmc_sec_title">Electrophysiology</h3> <p>CBD dissolved in 100% DMSO was used to prepare extracellular solutions at different concentrations with no more than 0.5% total DMSO content. Chinese Hamster Ovary (CHOK1) cells were transiently co-transfected with cDNA encoding eGFP, the β1-subunit, and the NavMs α-subunit (<a href="https://www.addgene.org/100004/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://www.addgene.org/100004/</a>). Transfection was done according to the PolyFect transfection protocol. After each set of transfections, a minimum of 8 hr incubation was allowed before plating on sterile coverslips. All cells were incubated at 37°C/5% CO<sub>2</sub>.</p> <p>Whole-cell patch-clamp recordings were performed in an extracellular solution containing (in mM): 140 NaCl, 4 KCl, 2 CaCl<sub>2</sub>, 1 MgCl<sub>2</sub>, 10 HEPES (pH 7.4). Solutions were adjusted to pH7.4 with CsOH. Pipettes were filled with intracellular solution, containing (in mM): 120 CsF, 20 CsCl, 10 NaCl, 10 HEPES. All recordings were made using an EPC-9 patch-clamp amplifier (HEKA Elektronik, Lambrecht, Germany) digitized at 20 kHz via an ITC-16 interface (Instrutech, Great Neck, NY, USA). Voltage-clamping and data acquisition were controlled using PatchMaster software (HEKA Elektronik, Lambrecht, Germany) running on an Apple iMac. Current was low-pass-filtered at 10 kHz. Leak subtraction was performed automatically by software using a P/N procedure following the test pulse. Gigaohm seals were allowed to stabilize in the on-cell configuration for 1 min prior to establishing the whole-cell configuration. Series resistance was less than 5 MΩ for all recordings. Series resistance compensation up to 80% was used when necessary. All data were acquired at least 1 min after attaining the whole-cell configuration. Before each protocol, the membrane potential was hyperpolarized to −180 mV to ensure complete removal of inactivation. All experiments were conducted at 22 ± 2 °C. Analysis and graphing were done using FitMaster software (HEKA Elektronik) and Igor Pro (Wavemetrics, Lake Oswego, OR, USA). All data acquisition and analysis programs were run on an Apple iMac (Apple Computer).</p> <p>Continuous variables are presented as means ± standard error and had a normal distribution. A T-test was used to compare the responses. A level of significance α = 0.05 was used in all overall tests, and effects with p-values less than 0.05 were considered to be statistically significant.</p></section></section><section id="funding-statement1" lang="en"><h2 class="pmc_sec_title">Funding Statement</h2> <p>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</p></section><section id="_ci93_" lang="en" class="contrib-info"><h2 class="pmc_sec_title">Contributor Information</h2> <p>BA Wallace, Email: b.wallace@mail.cryst.bbk.ac.uk.</p> <p>Leon D Islas, Universidad Nacional Autónoma de México, Mexico.</p> <p>Olga Boudker, Weill Cornell Medicine, United States.</p></section><section id="sec14"><h2 class="pmc_sec_title">Funding Information</h2> <p>This paper was supported by the following grants:</p> <ul class="list" style="list-style-type:disc"> <li><p>Biotechnology and Biological Sciences Research Council BB/L006790 to BA Wallace.</p></li> <li><p>Biotechnology and Biological Sciences Research Council BB/R001294 to BA Wallace.</p></li> <li><p>Rosetrees Trust M848 to BA Wallace.</p></li> <li><p>Medical Research Council Studentship to Lily Goodyer Sait.</p></li> <li><p>Natural Science and Engineering Research Council of Canada RGPIN03920 to Peter C Ruben.</p></li> <li><p>Natural Science and Engineering Research Council of Canada CGS-D:535333-2019 to Mohammad-Reza Ghovanloo.</p></li> </ul></section><section id="s5"><h2 class="pmc_sec_title">Additional information</h2> <section id="fn-group1" class="fn-group"><h3 class="pmc_sec_title"><strong>Competing interests</strong></h3> <div class="fn-group p font-secondary-light font-sm"><div class="fn p" id="conf1"><p>No competing interests declared.</p></div></div></section><section id="fn-group2" class="fn-group"><h3 class="pmc_sec_title"><strong>Author contributions</strong></h3> <div class="fn-group p font-secondary-light font-sm"> <div class="fn p" id="con1"><p>Formal analysis, Funding acquisition, Investigation, Visualization, Writing - review and editing.</p></div> <div class="fn p" id="con2"><p>Conceptualization, Resources, Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing.</p></div> <div class="fn p" id="con3"><p>Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Writing - review and editing.</p></div> <div class="fn p" id="con4"><p>Conceptualization, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing - original draft, Writing - review and editing.</p></div> <div class="fn p" id="con5"><p>Conceptualization, Funding acquisition, Methodology, Project administration.</p></div> <div class="fn p" id="con6"><p>Conceptualization, Funding Aquisition, Resources, Data curation, Formal analysis, Supervision, Validation, Investigation, Methodology, Writing - original draft, Writing - review and editing, Project Administration.</p></div> </div></section></section><section id="s6"><h2 class="pmc_sec_title">Additional files</h2> <section class="sm xbox font-sm" id="supp1"><div class="caption p"><span>Supplementary file 1. Crystal structure parameters.</span></div> <div class="media p" id="d38e1419"><div class="caption"> <a href="/articles/instance/7641581/bin/elife-58593-supp1.docx" data-ga-action="click_feat_suppl" class="usa-link">elife-58593-supp1.docx</a><sup> (16.8KB, docx) </sup> </div></div></section><section class="sm xbox font-sm" id="transrepform"><div class="caption p"><span>Transparent reporting form</span></div> <div class="media p" id="d38e1423"><div class="caption"> <a href="/articles/instance/7641581/bin/elife-58593-transrepform.docx" data-ga-action="click_feat_suppl" class="usa-link">elife-58593-transrepform.docx</a><sup> (248.5KB, docx) </sup> </div></div></section></section><section id="s7"><h2 class="pmc_sec_title">Data availability</h2> <p>Coordinates and Diffraction data have been deposited in the PDB under PDB6YZ2, and PDB6YZ0. All data generated or analysed during this study are included in the manuscript and supporting files.</p> <p>The following datasets were generated:</p> <p>Sula A, Sait LG, Hollingworth D, Wallace BA. 2020. Full Length Open-form Sodium Channel NavMs F208L. RCSB Protein Data Bank. 6YZ2</p> <p>Sula A, Sait LG, Hollingworth D, Wallace BA. 2020. Full Length Open-form Sodium Channel NavMs F208L in Complex with Cannabidiol (CBD) RCSB Protein Data Bank. 6YZ0</p></section><section id="ref-list1" class="ref-list"><h2 class="pmc_sec_title">References</h2> <section id="ref-list1_sec2"><ol class="ref-list font-sm"> <li id="bib1"> <cite>Ahern CA, Payandeh J, Bosmans F, Chanda B. The hitchhiker's guide to the voltage-gated sodium channel galaxy. Journal of General Physiology. 2016;147:1–24. doi: 10.1085/jgp.201511492.</cite> [<a href="https://doi.org/10.1085/jgp.201511492" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4692491/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/26712848/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20General%20Physiology&amp;title=The%20hitchhiker's%20guide%20to%20the%20voltage-gated%20sodium%20channel%20galaxy&amp;author=CA%20Ahern&amp;author=J%20Payandeh&amp;author=F%20Bosmans&amp;author=B%20Chanda&amp;volume=147&amp;publication_year=2016&amp;pages=1-24&amp;pmid=26712848&amp;doi=10.1085/jgp.201511492&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib2"> <cite>Bagal SK, Marron BE, Owen RM, Storer RI, Swain NA. Voltage gated sodium channels as drug discovery targets. Channels. 2015;9:360–366. doi: 10.1080/19336950.2015.1079674.</cite> [<a href="https://doi.org/10.1080/19336950.2015.1079674" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4850042/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/26646477/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Channels&amp;title=Voltage%20gated%20sodium%20channels%20as%20drug%20discovery%20targets&amp;author=SK%20Bagal&amp;author=BE%20Marron&amp;author=RM%20Owen&amp;author=RI%20Storer&amp;author=NA%20Swain&amp;volume=9&amp;publication_year=2015&amp;pages=360-366&amp;pmid=26646477&amp;doi=10.1080/19336950.2015.1079674&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib3"> <cite>Bagnéris C, DeCaen PG, Naylor CE, Pryde DC, Nobeli I, Clapham DE, Wallace BA. Prokaryotic NavMs channel as a structural and functional model for eukaryotic sodium channel antagonism. PNAS. 2014;111:8428–8433. doi: 10.1073/pnas.1406855111.</cite> [<a href="https://doi.org/10.1073/pnas.1406855111" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4060673/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/24850863/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=PNAS&amp;title=Prokaryotic%20NavMs%20channel%20as%20a%20structural%20and%20functional%20model%20for%20eukaryotic%20sodium%20channel%20antagonism&amp;author=C%20Bagn%C3%A9ris&amp;author=PG%20DeCaen&amp;author=CE%20Naylor&amp;author=DC%20Pryde&amp;author=I%20Nobeli&amp;volume=111&amp;publication_year=2014&amp;pages=8428-8433&amp;pmid=24850863&amp;doi=10.1073/pnas.1406855111&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib4"> <cite>Bricogne G, Blanc E, Brandl M, Flensburg C, Keller P, Paciorek W, Roversi P, Sharff A, Smart O, Vonrhein C, Womack TO. Cambridge, United Kingdom: Global Phasing Ltd; 2019. </cite> [<a href="https://scholar.google.com/scholar_lookup?Bricogne%20G,%20Blanc%20E,%20Brandl%20M,%20Flensburg%20C,%20Keller%20P,%20Paciorek%20W,%20Roversi%20P,%20Sharff%20A,%20Smart%20O,%20Vonrhein%20C,%20Womack%20TO.%20Cambridge,%20United%20Kingdom:%20Global%20Phasing%20Ltd;%202019." class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib5"> <cite>Catterall WA, Goldin AL, Waxman SG. International Union of Pharmacology. XLVII. Nomenclature and structure-function relationships of voltage-gated sodium channels. Pharmacological Reviews. 2005;57:397–409. doi: 10.1124/pr.57.4.4.</cite> [<a href="https://doi.org/10.1124/pr.57.4.4" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/16382098/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Pharmacological%20Reviews&amp;title=International%20Union%20of%20Pharmacology.%20XLVII.%20Nomenclature%20and%20structure-function%20relationships%20of%20voltage-gated%20sodium%20channels&amp;author=WA%20Catterall&amp;author=AL%20Goldin&amp;author=SG%20Waxman&amp;volume=57&amp;publication_year=2005&amp;pages=397-409&amp;pmid=16382098&amp;doi=10.1124/pr.57.4.4&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib6"> <cite>Chen VB, Arendall WB, Headd JJ, Keedy DA, Immormino RM, Kapral GJ, Murray LW, Richardson JS, Richardson DC. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallographica . 2010;D66:12–21. doi: 10.1107/S0907444909042073.</cite> [<a href="https://doi.org/10.1107/S0907444909042073" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2803126/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/20057044/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Acta%20Crystallographica%C2%A0&amp;title=MolProbity:%20all-atom%20structure%20validation%20for%20macromolecular%20crystallography&amp;author=VB%20Chen&amp;author=WB%20Arendall&amp;author=JJ%20Headd&amp;author=DA%20Keedy&amp;author=RM%20Immormino&amp;volume=D66&amp;publication_year=2010&amp;pages=12-21&amp;pmid=20057044&amp;doi=10.1107/S0907444909042073&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib7"> <cite>Chiu J, March PE, Lee R, Tillett D. Site-directed, Ligase-Independent Mutagenesis (SLIM): a single-tube methodology approaching 100% efficiency in 4 h. Nucleic Acids Research. 2004;32:e174. doi: 10.1093/nar/gnh172.</cite> [<a href="https://doi.org/10.1093/nar/gnh172" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC535700/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/15585660/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nucleic%20Acids%20Research&amp;title=Site-directed,%20Ligase-Independent%20Mutagenesis%20(SLIM):%20a%20single-tube%20methodology%20approaching%20100%%20efficiency%20in%204%20h&amp;author=J%20Chiu&amp;author=PE%20March&amp;author=R%20Lee&amp;author=D%20Tillett&amp;volume=32&amp;publication_year=2004&amp;pages=e174&amp;pmid=15585660&amp;doi=10.1093/nar/gnh172&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib8"> <cite>Cross JH, Devinsky O, Marsh E, Miller I, Nabbout R, Scheffer IE, Thiele EA, Laux L, Wright S. Cannabidiol (CBD) reduces convulsive seizure frequency in Dravet syndrome: results of a multi-center, randomized, controlled trial. Epilepsia. 2017;58:S12. doi: 10.1111/epi.13944.</cite> [<a href="https://doi.org/10.1111/epi.13944" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Epilepsia&amp;title=Cannabidiol%20(CBD)%20reduces%20convulsive%20seizure%20frequency%20in%20Dravet%20syndrome:%20results%20of%20a%20multi-center,%20randomized,%20controlled%20trial&amp;author=JH%20Cross&amp;author=O%20Devinsky&amp;author=E%20Marsh&amp;author=I%20Miller&amp;author=R%20Nabbout&amp;volume=58&amp;publication_year=2017&amp;pages=S12&amp;doi=10.1111/epi.13944&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib9"> <cite>Devinsky O, Patel AD, Cross JH, Villanueva V, Wirrell EC, Privitera M, Greenwood SM, Roberts C, Checketts D, VanLandingham KE, Zuberi SM, GWPCARE3 Study Group Effect of cannabidiol on drop seizures in the Lennox-Gastaut syndrome. New England Journal of Medicine. 2018;378:1888–1897. doi: 10.1056/NEJMoa1714631.</cite> [<a href="https://doi.org/10.1056/NEJMoa1714631" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/29768152/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=New%20England%20Journal%20of%20Medicine&amp;title=Effect%20of%20cannabidiol%20on%20drop%20seizures%20in%20the%20Lennox-Gastaut%20syndrome&amp;author=O%20Devinsky&amp;author=AD%20Patel&amp;author=JH%20Cross&amp;author=V%20Villanueva&amp;author=EC%20Wirrell&amp;volume=378&amp;publication_year=2018&amp;pages=1888-1897&amp;pmid=29768152&amp;doi=10.1056/NEJMoa1714631&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib10"> <cite>Emsley P, Lohkamp B, Scott WG, Cowtan K. Features and development of coot. Acta Crystallographica D. 2010;66:486–501. doi: 10.1107/S0907444910007493.</cite> [<a href="https://doi.org/10.1107/S0907444910007493" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2852313/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/20383002/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Acta%20Crystallographica%20D&amp;title=Features%20and%20development%20of%20coot&amp;author=P%20Emsley&amp;author=B%20Lohkamp&amp;author=WG%20Scott&amp;author=K%20Cowtan&amp;volume=66&amp;publication_year=2010&amp;pages=486-501&amp;pmid=20383002&amp;doi=10.1107/S0907444910007493&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib11"> <cite>Evans PR, Murshudov GN. How good are my data and what is the resolution? Acta Crystallographica . 2013;D69:1204–1214. doi: 10.1107/S0907444913000061.</cite> [<a href="https://doi.org/10.1107/S0907444913000061" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3689523/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23793146/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Acta%20Crystallographica%C2%A0&amp;title=How%20good%20are%20my%20data%20and%20what%20is%20the%20resolution?&amp;author=PR%20Evans&amp;author=GN%20Murshudov&amp;volume=D69&amp;publication_year=2013&amp;pages=1204-1214&amp;pmid=23793146&amp;doi=10.1107/S0907444913000061&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib12"> <cite>Gamal El-Din TM, Lenaeus MJ, Zheng N, Catterall WA. Fenestrations control resting-state block of a voltage-gated sodium channel. PNAS. 2018;115:13111–13116. doi: 10.1073/pnas.1814928115.</cite> [<a href="https://doi.org/10.1073/pnas.1814928115" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6304959/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30518562/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=PNAS&amp;title=Fenestrations%20control%20resting-state%20block%20of%20a%20voltage-gated%20sodium%20channel&amp;author=TM%20Gamal%20El-Din&amp;author=MJ%20Lenaeus&amp;author=N%20Zheng&amp;author=WA%20Catterall&amp;volume=115&amp;publication_year=2018&amp;pages=13111-13116&amp;pmid=30518562&amp;doi=10.1073/pnas.1814928115&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib13"> <cite>Ghovanloo MR, Shuart NG, Mezeyova J, Dean RA, Ruben PC, Goodchild SJ. Inhibitory effects of cannabidiol on voltage-dependent sodium currents. Journal of Biological Chemistry. 2018;293:16546–16558. doi: 10.1074/jbc.RA118.004929.</cite> [<a href="https://doi.org/10.1074/jbc.RA118.004929" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6204917/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30219789/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20Biological%20Chemistry&amp;title=Inhibitory%20effects%20of%20cannabidiol%20on%20voltage-dependent%20sodium%20currents&amp;author=MR%20Ghovanloo&amp;author=NG%20Shuart&amp;author=J%20Mezeyova&amp;author=RA%20Dean&amp;author=PC%20Ruben&amp;volume=293&amp;publication_year=2018&amp;pages=16546-16558&amp;pmid=30219789&amp;doi=10.1074/jbc.RA118.004929&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib14"> <cite>Hille B. Local anesthetics: hydrophilic and hydrophobic pathways for the drug-receptor reaction. Journal of General Physiology. 1977;69:497–515. doi: 10.1085/jgp.69.4.497.</cite> [<a href="https://doi.org/10.1085/jgp.69.4.497" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2215053/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/300786/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20General%20Physiology&amp;title=Local%20anesthetics:%20hydrophilic%20and%20hydrophobic%20pathways%20for%20the%20drug-receptor%20reaction&amp;author=B%20Hille&amp;volume=69&amp;publication_year=1977&amp;pages=497-515&amp;pmid=300786&amp;doi=10.1085/jgp.69.4.497&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib15"> <cite>Humphrey W, Dalke A, Schulten K. VMD: visual molecular dynamics. Journal of Molecular Graphics. 1996;14:33–38. doi: 10.1016/0263-7855(96)00018-5.</cite> [<a href="https://doi.org/10.1016/0263-7855(96)00018-5" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/8744570/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20Molecular%20Graphics&amp;title=VMD:%20visual%20molecular%20dynamics&amp;author=W%20Humphrey&amp;author=A%20Dalke&amp;author=K%20Schulten&amp;volume=14&amp;publication_year=1996&amp;pages=33-38&amp;pmid=8744570&amp;doi=10.1016/0263-7855(96)00018-5&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib16"> <cite>Kabsch W. XDS. Acta Crystallographica D. 2010;66:125–132. doi: 10.1107/S0907444909047337.</cite> [<a href="https://doi.org/10.1107/S0907444909047337" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2815665/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/20124692/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Acta%20Crystallographica%20D&amp;title=XDS&amp;author=W%20Kabsch&amp;volume=66&amp;publication_year=2010&amp;pages=125-132&amp;pmid=20124692&amp;doi=10.1107/S0907444909047337&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib17"> <cite>Kaplan DI, Isom LL, Petrou S. Role of sodium channels in epilepsy. Cold Spring Harbor Perspectives in Medicine. 2016;6:a022814. doi: 10.1101/cshperspect.a022814.</cite> [<a href="https://doi.org/10.1101/cshperspect.a022814" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4888813/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/27143702/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cold%20Spring%20Harbor%20Perspectives%20in%20Medicine&amp;title=Role%20of%20sodium%20channels%20in%20epilepsy&amp;author=DI%20Kaplan&amp;author=LL%20Isom&amp;author=S%20Petrou&amp;volume=6&amp;publication_year=2016&amp;pages=a022814&amp;pmid=27143702&amp;doi=10.1101/cshperspect.a022814&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib18"> <cite>Ke S, Ulmschneider MB, Wallace BA, Ulmschneider JP. Role of the interaction motif in maintaining the open gate of an open sodium channel. Biophysical Journal. 2018;115:1920–1930. doi: 10.1016/j.bpj.2018.10.001.</cite> [<a href="https://doi.org/10.1016/j.bpj.2018.10.001" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6303419/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30366630/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Biophysical%20Journal&amp;title=Role%20of%20the%20interaction%20motif%20in%20maintaining%20the%20open%20gate%20of%20an%20open%20sodium%20channel&amp;author=S%20Ke&amp;author=MB%20Ulmschneider&amp;author=BA%20Wallace&amp;author=JP%20Ulmschneider&amp;volume=115&amp;publication_year=2018&amp;pages=1920-1930&amp;pmid=30366630&amp;doi=10.1016/j.bpj.2018.10.001&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib19"> <cite>Kuo CC, Bean BP. Slow binding of phenytoin to inactivated sodium channels in rat hippocampal neurons. Molecular Pharmacology. 1994;46:716–725.</cite> [<a href="https://pubmed.ncbi.nlm.nih.gov/7969051/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Molecular%20Pharmacology&amp;title=Slow%20binding%20of%20phenytoin%20to%20inactivated%20sodium%20channels%20in%20rat%20hippocampal%20neurons&amp;author=CC%20Kuo&amp;author=BP%20Bean&amp;volume=46&amp;publication_year=1994&amp;pages=716-725&amp;pmid=7969051&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib20"> <cite>Laskowski RA, MacArthur MW, Moss DS, Thornton JM. PROCHECK: a program to check the stereochemical quality of protein structures. Journal of Applied Crystallography. 1993;26:283–291. doi: 10.1107/S0021889892009944.</cite> [<a href="https://doi.org/10.1107/S0021889892009944" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20Applied%20Crystallography&amp;title=PROCHECK:%20a%20program%20to%20check%20the%20stereochemical%20quality%20of%20protein%20structures&amp;author=RA%20Laskowski&amp;author=MW%20MacArthur&amp;author=DS%20Moss&amp;author=JM%20Thornton&amp;volume=26&amp;publication_year=1993&amp;pages=283-291&amp;doi=10.1107/S0021889892009944&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib21"> <cite>Marini C, Scheffer IE, Nabbout R, Suls A, De Jonghe P, Zara F, Guerrini R. The genetics of Dravet syndrome. Epilepsia. 2011;52:24–29. doi: 10.1111/j.1528-1167.2011.02997.x.</cite> [<a href="https://doi.org/10.1111/j.1528-1167.2011.02997.x" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21463275/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Epilepsia&amp;title=The%20genetics%20of%20Dravet%20syndrome&amp;author=C%20Marini&amp;author=IE%20Scheffer&amp;author=R%20Nabbout&amp;author=A%20Suls&amp;author=P%20De%20Jonghe&amp;volume=52&amp;publication_year=2011&amp;pages=24-29&amp;pmid=21463275&amp;doi=10.1111/j.1528-1167.2011.02997.x&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib22"> <cite>Martin LJ, Corry B. Locating the route of entry and binding sites of benzocaine and phenytoin in a bacterial voltage gated sodium channel. PLOS Computational Biology. 2014;10:e1003688. doi: 10.1371/journal.pcbi.1003688.</cite> [<a href="https://doi.org/10.1371/journal.pcbi.1003688" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4084639/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/24992293/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=PLOS%20Computational%20Biology&amp;title=Locating%20the%20route%20of%20entry%20and%20binding%20sites%20of%20benzocaine%20and%20phenytoin%20in%20a%20bacterial%20voltage%20gated%20sodium%20channel&amp;author=LJ%20Martin&amp;author=B%20Corry&amp;volume=10&amp;publication_year=2014&amp;pages=e1003688&amp;pmid=24992293&amp;doi=10.1371/journal.pcbi.1003688&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib23"> <cite>Mason ER, Cummins TR. Differential inhibition of human Nav1.2 resurgent and persistent sodium currents by cannabidiol and GS967. International Journal of Molecular Sciences. 2020;21:2454. doi: 10.3390/ijms21072454.</cite> [<a href="https://doi.org/10.3390/ijms21072454" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7177867/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32244818/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=International%20Journal%20of%20Molecular%20Sciences&amp;title=Differential%20inhibition%20of%20human%20Nav1.2%20resurgent%20and%20persistent%20sodium%20currents%20by%20cannabidiol%20and%20GS967&amp;author=ER%20Mason&amp;author=TR%20Cummins&amp;volume=21&amp;publication_year=2020&amp;pages=2454&amp;pmid=32244818&amp;doi=10.3390/ijms21072454&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib24"> <cite>McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read RJ. Phaser crystallographic software. Journal of Applied Crystallography. 2007;404:658–674. doi: 10.1107/S0021889807021206.</cite> [<a href="https://doi.org/10.1107/S0021889807021206" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2483472/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19461840/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20Applied%20Crystallography&amp;title=Phaser%20crystallographic%20software&amp;author=AJ%20McCoy&amp;author=RW%20Grosse-Kunstleve&amp;author=PD%20Adams&amp;author=MD%20Winn&amp;author=LC%20Storoni&amp;volume=404&amp;publication_year=2007&amp;pages=658-674&amp;pmid=19461840&amp;doi=10.1107/S0021889807021206&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib25"> <cite>McNicholas S, Potterton E, Wilson KS, Noble MEM. Presenting your structures: the CCP4mg molecular-graphics software. Acta Crystallographica. 2011;D67:384–394. doi: 10.1107/S0907444911007281.</cite> [<a href="https://doi.org/10.1107/S0907444911007281" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3069754/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21460457/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Acta%20Crystallographica&amp;title=Presenting%20your%20structures:%20the%20CCP4mg%20molecular-graphics%20software&amp;author=S%20McNicholas&amp;author=E%20Potterton&amp;author=KS%20Wilson&amp;author=MEM%20Noble&amp;volume=D67&amp;publication_year=2011&amp;pages=384-394&amp;pmid=21460457&amp;doi=10.1107/S0907444911007281&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib26"> <cite>Montini G, Booker J, Sula A, Wallace BA. Comparisons of voltage-gated sodium channel structures with open and closed gates and implications for state-dependent drug design. Biochemical Society Transactions. 2018;46:1567–1575. doi: 10.1042/BST20180295.</cite> [<a href="https://doi.org/10.1042/BST20180295" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30381338/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Biochemical%20Society%20Transactions&amp;title=Comparisons%20of%20voltage-gated%20sodium%20channel%20structures%20with%20open%20and%20closed%20gates%20and%20implications%20for%20state-dependent%20drug%20design&amp;author=G%20Montini&amp;author=J%20Booker&amp;author=A%20Sula&amp;author=BA%20Wallace&amp;volume=46&amp;publication_year=2018&amp;pages=1567-1575&amp;pmid=30381338&amp;doi=10.1042/BST20180295&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib27"> <cite>Morelli MB, Amantini C, Liberati S, Santoni M, Nabissi M. TRP channels: new potential therapeutic approaches in CNS neuropathies. CNS &amp; Neurological Disorders - Drug Targets. 2013;12:274–293. doi: 10.2174/18715273113129990056.</cite> [<a href="https://doi.org/10.2174/18715273113129990056" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23469844/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=CNS%20&amp;%20Neurological%20Disorders%20-%20Drug%20Targets&amp;title=TRP%20channels:%20new%20potential%20therapeutic%20approaches%20in%20CNS%20neuropathies&amp;author=MB%20Morelli&amp;author=C%20Amantini&amp;author=S%20Liberati&amp;author=M%20Santoni&amp;author=M%20Nabissi&amp;volume=12&amp;publication_year=2013&amp;pages=274-293&amp;pmid=23469844&amp;doi=10.2174/18715273113129990056&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib28"> <cite>Murshudov GN, Skubák P, Lebedev AA, Pannu NS, Steiner RA, Nicholls RA, Winn MD, Long F, Vagin AA. REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallographica . 2011;D67:355–367. doi: 10.1107/S0907444911001314.</cite> [<a href="https://doi.org/10.1107/S0907444911001314" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3069751/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21460454/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Acta%20Crystallographica%C2%A0&amp;title=REFMAC5%20for%20the%20refinement%20of%20macromolecular%20crystal%20structures&amp;author=GN%20Murshudov&amp;author=P%20Skub%C3%A1k&amp;author=AA%20Lebedev&amp;author=NS%20Pannu&amp;author=RA%20Steiner&amp;volume=D67&amp;publication_year=2011&amp;pages=355-367&amp;pmid=21460454&amp;doi=10.1107/S0907444911001314&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib29"> <cite>Naylor CE, Bagnéris C, DeCaen PG, Sula A, Scaglione A, Clapham DE, Wallace BA. Molecular basis of ion permeability in a voltage‐gated sodium channel. The EMBO Journal. 2016;35:820–830. doi: 10.15252/embj.201593285.</cite> [<a href="https://doi.org/10.15252/embj.201593285" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4972137/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/26873592/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=The%20EMBO%20Journal&amp;title=Molecular%20basis%20of%20ion%20permeability%20in%20a%20voltage%E2%80%90gated%20sodium%20channel&amp;author=CE%20Naylor&amp;author=C%20Bagn%C3%A9ris&amp;author=PG%20DeCaen&amp;author=A%20Sula&amp;author=A%20Scaglione&amp;volume=35&amp;publication_year=2016&amp;pages=820-830&amp;pmid=26873592&amp;doi=10.15252/embj.201593285&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib30"> <cite>Ouyang W, Jih TY, Zhang TT, Correa AM, Hemmings HC. Isoflurane inhibits NaChBac, a prokaryotic voltage-gated sodium channel. Journal of Pharmacology and Experimental Therapeutics. 2007;322:1076–1083. doi: 10.1124/jpet.107.122929.</cite> [<a href="https://doi.org/10.1124/jpet.107.122929" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/17569823/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20Pharmacology%20and%20Experimental%20Therapeutics&amp;title=Isoflurane%20inhibits%20NaChBac,%20a%20prokaryotic%20voltage-gated%20sodium%20channel&amp;author=W%20Ouyang&amp;author=TY%20Jih&amp;author=TT%20Zhang&amp;author=AM%20Correa&amp;author=HC%20Hemmings&amp;volume=322&amp;publication_year=2007&amp;pages=1076-1083&amp;pmid=17569823&amp;doi=10.1124/jpet.107.122929&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib31"> <cite>Patel RR, Barbosa C, Brustovetsky T, Brustovetsky N, Cummins TR. Aberrant epilepsy-associated mutant Nav1.6 sodium channel activity can be targeted with cannabidiol. Brain: A Journal of Neurology. 2016;139:2164–2181. doi: 10.1093/brain/aww129.</cite> [<a href="https://doi.org/10.1093/brain/aww129" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4958898/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/27267376/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Brain:%20A%20Journal%20of%20Neurology&amp;title=Aberrant%20epilepsy-associated%20mutant%20Nav1.6%20sodium%20channel%20activity%20can%20be%20targeted%20with%20cannabidiol&amp;author=RR%20Patel&amp;author=C%20Barbosa&amp;author=T%20Brustovetsky&amp;author=N%20Brustovetsky&amp;author=TR%20Cummins&amp;volume=139&amp;publication_year=2016&amp;pages=2164-2181&amp;pmid=27267376&amp;doi=10.1093/brain/aww129&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib32"> <cite>Pisanti S, Malfitano AM, Ciaglia E, Lamberti A, Ranieri R, Cuomo G, Abate M, Faggiana G, Proto MC, Fiore D, Laezza C, Bifulco M. Cannabidiol: State of the art and new challenges for therapeutic applications. Pharmacology &amp; Therapeutics. 2017;175:133–150. doi: 10.1016/j.pharmthera.2017.02.041.</cite> [<a href="https://doi.org/10.1016/j.pharmthera.2017.02.041" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/28232276/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Pharmacology%20&amp;%20Therapeutics&amp;title=Cannabidiol:%20State%20of%20the%20art%20and%20new%20challenges%20for%20therapeutic%20applications&amp;author=S%20Pisanti&amp;author=AM%20Malfitano&amp;author=E%20Ciaglia&amp;author=A%20Lamberti&amp;author=R%20Ranieri&amp;volume=175&amp;publication_year=2017&amp;pages=133-150&amp;pmid=28232276&amp;doi=10.1016/j.pharmthera.2017.02.041&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib33"> <cite>Pumroy RA, Samanta A, Liu Y, Hughes TET, Zhao S, Yudin Y, Rohacs T, Han S, Moiseenkova-Bell VY. Molecular mechanism of TRPV2 channel modulation by cannabidiol. eLife. 2019;8:48792. doi: 10.7554/eLife.48792.</cite> [<a href="https://doi.org/10.7554/eLife.48792" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6794088/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/31566564/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=eLife&amp;title=Molecular%20mechanism%20of%20TRPV2%20channel%20modulation%20by%20cannabidiol&amp;author=RA%20Pumroy&amp;author=A%20Samanta&amp;author=Y%20Liu&amp;author=TET%20Hughes&amp;author=S%20Zhao&amp;volume=8&amp;publication_year=2019&amp;pages=48792&amp;pmid=31566564&amp;doi=10.7554/eLife.48792&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib34"> <cite>Qin N, Neeper MP, Liu Y, Hutchinson TL, Lubin ML, Flores CM. TRPV2 is activated by cannabidiol and mediates CGRP release in cultured rat dorsal root ganglion neurons. Journal of Neuroscience. 2008;28:6231–6238. doi: 10.1523/JNEUROSCI.0504-08.2008.</cite> [<a href="https://doi.org/10.1523/JNEUROSCI.0504-08.2008" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6670541/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/18550765/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20Neuroscience&amp;title=TRPV2%20is%20activated%20by%20cannabidiol%20and%20mediates%20CGRP%20release%20in%20cultured%20rat%20dorsal%20root%20ganglion%20neurons&amp;author=N%20Qin&amp;author=MP%20Neeper&amp;author=Y%20Liu&amp;author=TL%20Hutchinson&amp;author=ML%20Lubin&amp;volume=28&amp;publication_year=2008&amp;pages=6231-6238&amp;pmid=18550765&amp;doi=10.1523/JNEUROSCI.0504-08.2008&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib35"> <cite>Rosenberg EC, Tsien RW, Whalley BJ, Devinsky O. Cannabinoids and epilepsy. Neurotherapeutics. 2015;12:747–768. doi: 10.1007/s13311-015-0375-5.</cite> [<a href="https://doi.org/10.1007/s13311-015-0375-5" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4604191/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/26282273/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Neurotherapeutics&amp;title=Cannabinoids%20and%20epilepsy&amp;author=EC%20Rosenberg&amp;author=RW%20Tsien&amp;author=BJ%20Whalley&amp;author=O%20Devinsky&amp;volume=12&amp;publication_year=2015&amp;pages=747-768&amp;pmid=26282273&amp;doi=10.1007/s13311-015-0375-5&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib36"> <cite>Rosenberg EC, Patra PH, Whalley BJ. Therapeutic effects of cannabinoids in animal models of seizures, epilepsy, epileptogenesis, and epilepsy-related neuroprotection. Epilepsy &amp; Behavior. 2017;70:319–327. doi: 10.1016/j.yebeh.2016.11.006.</cite> [<a href="https://doi.org/10.1016/j.yebeh.2016.11.006" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5651410/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/28190698/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Epilepsy%20&amp;%20Behavior&amp;title=Therapeutic%20effects%20of%20cannabinoids%20in%20animal%20models%20of%20seizures,%20epilepsy,%20epileptogenesis,%20and%20epilepsy-related%20neuroprotection&amp;author=EC%20Rosenberg&amp;author=PH%20Patra&amp;author=BJ%20Whalley&amp;volume=70&amp;publication_year=2017&amp;pages=319-327&amp;pmid=28190698&amp;doi=10.1016/j.yebeh.2016.11.006&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib37"> <cite>Sarker SD, Nahar L. Cannabidiol (CBD) – An update. Trends Phytochemical Res. 2020;4:1–2.</cite> [<a href="https://scholar.google.com/scholar_lookup?journal=Trends%20Phytochemical%20Res&amp;title=Cannabidiol%20(CBD)%20%E2%80%93%20An%20update&amp;author=SD%20Sarker&amp;author=L%20Nahar&amp;volume=4&amp;publication_year=2020&amp;pages=1-2&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib38"> <cite>Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins DG. Fast, scalable generation of high-quality protein multiple sequence alignments using clustal omega. Molecular Systems Biology. 2011;7:539. doi: 10.1038/msb.2011.75.</cite> [<a href="https://doi.org/10.1038/msb.2011.75" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3261699/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21988835/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Molecular%20Systems%20Biology&amp;title=Fast,%20scalable%20generation%20of%20high-quality%20protein%20multiple%20sequence%20alignments%20using%20clustal%20omega&amp;author=F%20Sievers&amp;author=A%20Wilm&amp;author=D%20Dineen&amp;author=TJ%20Gibson&amp;author=K%20Karplus&amp;volume=7&amp;publication_year=2011&amp;pages=539&amp;pmid=21988835&amp;doi=10.1038/msb.2011.75&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib39"> <cite>Smart OS, Goodfellow JM, Wallace BA. The pore dimensions of gramicidin A. Biophysical Journal. 1993;65:2455–2460. doi: 10.1016/S0006-3495(93)81293-1.</cite> [<a href="https://doi.org/10.1016/S0006-3495(93)81293-1" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC1225986/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/7508762/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Biophysical%20Journal&amp;title=The%20pore%20dimensions%20of%20gramicidin%20A&amp;author=OS%20Smart&amp;author=JM%20Goodfellow&amp;author=BA%20Wallace&amp;volume=65&amp;publication_year=1993&amp;pages=2455-2460&amp;pmid=7508762&amp;doi=10.1016/S0006-3495(93)81293-1&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib40"> <cite>Sula A, Booker J, Ng LC, Naylor CE, DeCaen PG, Wallace BA. The complete structure of an activated open sodium channel. Nature Communications. 2017;8:14205. doi: 10.1038/ncomms14205.</cite> [<a href="https://doi.org/10.1038/ncomms14205" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5316852/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/28205548/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nature%20Communications&amp;title=The%20complete%20structure%20of%20an%20activated%20open%20sodium%20channel&amp;author=A%20Sula&amp;author=J%20Booker&amp;author=LC%20Ng&amp;author=CE%20Naylor&amp;author=PG%20DeCaen&amp;volume=8&amp;publication_year=2017&amp;pages=14205&amp;pmid=28205548&amp;doi=10.1038/ncomms14205&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib41"> <cite>Sula A, Wallace BA. Interpreting the functional role of a novel interaction motif in prokaryotic sodium channels. Journal of General Physiology. 2017;149:613–622. doi: 10.1085/jgp.201611740.</cite> [<a href="https://doi.org/10.1085/jgp.201611740" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5460950/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/28522439/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Journal%20of%20General%20Physiology&amp;title=Interpreting%20the%20functional%20role%20of%20a%20novel%20interaction%20motif%20in%20prokaryotic%20sodium%20channels&amp;author=A%20Sula&amp;author=BA%20Wallace&amp;volume=149&amp;publication_year=2017&amp;pages=613-622&amp;pmid=28522439&amp;doi=10.1085/jgp.201611740&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib42"> <cite>Ulmschneider MB, Bagnéris C, McCusker EC, DeCaen PG, Delling M, Clapham DE, Ulmschneider JP, Wallace BA. Molecular dynamics of ion transport through the open conformation of a bacterial voltage-gated sodium channel. PNAS. 2013;110:6364–6369. doi: 10.1073/pnas.1214667110.</cite> [<a href="https://doi.org/10.1073/pnas.1214667110" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3631666/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23542377/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=PNAS&amp;title=Molecular%20dynamics%20of%20ion%20transport%20through%20the%20open%20conformation%20of%20a%20bacterial%20voltage-gated%20sodium%20channel&amp;author=MB%20Ulmschneider&amp;author=C%20Bagn%C3%A9ris&amp;author=EC%20McCusker&amp;author=PG%20DeCaen&amp;author=M%20Delling&amp;volume=110&amp;publication_year=2013&amp;pages=6364-6369&amp;pmid=23542377&amp;doi=10.1073/pnas.1214667110&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib43"> <cite>Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. Jalview version 2a multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009;25:1189–1191. doi: 10.1093/bioinformatics/btp033.</cite> [<a href="https://doi.org/10.1093/bioinformatics/btp033" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2672624/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19151095/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Bioinformatics&amp;title=Jalview%20version%202a%20multiple%20sequence%20alignment%20editor%20and%20analysis%20workbench&amp;author=AM%20Waterhouse&amp;author=JB%20Procter&amp;author=DM%20Martin&amp;author=M%20Clamp&amp;author=GJ%20Barton&amp;volume=25&amp;publication_year=2009&amp;pages=1189-1191&amp;pmid=19151095&amp;doi=10.1093/bioinformatics/btp033&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib44"> <cite>Watkins AR. Cannabinoid interactions with ion channels and receptors. Channels. 2019;13:162–167. doi: 10.1080/19336950.2019.1615824.</cite> [<a href="https://doi.org/10.1080/19336950.2019.1615824" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6527074/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/31088312/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Channels&amp;title=Cannabinoid%20interactions%20with%20ion%20channels%20and%20receptors&amp;author=AR%20Watkins&amp;volume=13&amp;publication_year=2019&amp;pages=162-167&amp;pmid=31088312&amp;doi=10.1080/19336950.2019.1615824&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="bib45"> <cite>Winn MD, Ballard CC, Cowtan KD, Dodson EJ, Emsley P, Evans PR, Keegan RM, Krissinel EB, Leslie AG, McCoy A, McNicholas SJ, Murshudov GN, Pannu NS, Potterton EA, Powell HR, Read RJ, Vagin A, Wilson KS. Overview of the CCP4 suite and current developments. Acta Crystallographica . 2011;D67:235–242. doi: 10.1107/S0907444910045749.</cite> [<a href="https://doi.org/10.1107/S0907444910045749" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3069738/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21460441/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Acta%20Crystallographica%C2%A0&amp;title=Overview%20of%20the%20CCP4%20suite%20and%20current%20developments&amp;author=MD%20Winn&amp;author=CC%20Ballard&amp;author=KD%20Cowtan&amp;author=EJ%20Dodson&amp;author=P%20Emsley&amp;volume=D67&amp;publication_year=2011&amp;pages=235-242&amp;pmid=21460441&amp;doi=10.1107/S0907444910045749&amp;" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> </ol></section></section></section><article class="sub-article" id="sa1"><section class="pmc-layout__citation font-secondary font-xs"><div>eLife. doi: <a href="https://doi.org/10.7554/eLife.58593.sa1" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">10.7554/eLife.58593.sa1</a> </div></section><section class="front-matter"><div class="ameta p font-secondary font-xs"> <hgroup><h1>Decision letter</h1></hgroup><div class="cg p">Editor: <span class="name western">Leon D Islas</span><sup>1</sup> </div> <div class="cg p">Reviewed by: <span class="name western">Leon D Islas</span><sup>2</sup> </div> <ul class="d-buttons inline-list"> <li><button class="d-button" aria-controls="aip_a.c" aria-expanded="false">Author information</button></li> <li><button class="d-button" aria-controls="clp_a.c" aria-expanded="false">Copyright and License information</button></li> </ul> <div class="d-panels font-secondary-light"> <div id="aip_a.c" class="d-panel p" style="display: none"> <div class="p" id="aff5"> <sup>1</sup>Universidad Nacional Autónoma de México, Mexico</div> <div id="aff6"> <sup>2</sup>Universidad Nacional Autónoma de México, Mexico</div> <h4 class="font-secondary">Roles</h4> <div class="p"> <strong class="contrib"><span class="name western">Leon D Islas</span></strong>: <span class="role">Reviewing Editor</span> </div> <div class="p"> <strong class="contrib"><span class="name western">Leon D Islas</span></strong>: <span class="role">Reviewer</span> </div> </div> <div id="clp_a.c" class="d-panel p" style="display: none"><div class="p"><a href="/about/copyright/" class="usa-link">PMC Copyright notice</a></div></div> </div> <div></div> </div></section><section class="body sub-article-body"><hr class="headless"> <section class="bt xbox font-sm" id="boxed-text1"><p>In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.</p></section><p><strong>Acceptance summary:</strong></p> <p>This manuscript presents high-quality X-ray diffraction and functional studies delineating the interaction of cannabidiol (CBD) with the prokaryotic voltage-gated sodium channel. These are important results that will help further our understanding of the effects of CBD on certain neurological diseases and also provide insight into the biophysics of sodium channels.</p> <p><strong>Decision letter after peer review:</strong></p> <p>Thank you for submitting your article "Cannabidiol Interactions with Voltage-Gated Sodium Channels" for consideration by <em>eLife</em>. Your article has been reviewed by three peer reviewers, including Leon D Islas as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Olga Boudker as the Senior Editor.</p> <p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p> <p>As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at <em>eLife</em>". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)</p> <p>Summary:</p> <p>Cannabidiol (CBD) has been recently approved for treatment of epilepsy. Some of CBD anti-epileptic properties might be due to CBD inhibition of voltage-gated sodium channels but the molecular mechanism of such inhibition is unknown. Sait et al. studied the molecular bases of CBD inhibition using X-ray crystallography in application to the bacterial sodium channel NavMs. The authors solved NavMs structures in the apo state and in complex with CBD and based on structural comparison, identified CBD-binding sites and proposed the molecular mechanism of sodium channel inhibition by CBD. The crystal structures are of high quality and among the best published structures of sodium channels, and the study is without doubt of high importance. This is a solid manuscript from an experienced group that reports structural insights into cannabidiol interactions with the voltage-gated sodium channel NavM. The manuscript is easy to read, well-executed, and reveals interesting data.</p> <p>Essential revisions:</p> <p>The weakness of this study is the lack of functional data that would greatly complement the excellent structural results. Electrophysiological data showing the interaction of CBD with NavMs should be obtained and presented. This should be a very easy experiment to perform. CBD has been shown to block the NaChBac sodium channel, but there is no record in the literature that shows that CBD also blocks NavMs. This is a fundamental experiment that should be included in a revised version of the paper. It will also be of great interest to test the results of their structure by mutating appropriate sodium channel residues (e.g. in Nav1.1) and measure changes in cannabidiol interaction.</p> <p>Similarly, discussion of the different ways CBD and THC bind to NavMs would greatly benefit from a comparison of the physiological effects of these two compounds. Does THC block NavMs and if it does, what is Kd/IC50 for THC compared to CBD? Electron density observed at the CBD site in the apo state structure needs to be shown side by side with the density for CBD in the structure obtained in the presence of CBD (a supplementary figure would suffice). Along these lines, it might be a good idea to add a brief discussion on how physiologically relevant is the apo state density. For example, if this site is always occupied by a lipid in physiological conditions, the channel would never open.</p> <p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p> <p>Thank you for submitting your article "Cannabidiol Interactions with Voltage-Gated Sodium Channels" for consideration by <em>eLife</em>. Your article has been reviewed by the Reviewing Editor and Olga Boudker as the Senior Editor.</p> <p>The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.</p> <p>We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, we are asking editors to accept without delay manuscripts, like yours, that they judge can stand as <em>eLife</em> papers without additional data, even if they feel that they would make the manuscript stronger. Thus the revisions requested below only address clarity and presentation.</p> <p>Summary:</p> <p>This manuscript presents high quality X-ray diffraction studies delineating the interaction of cannabidiol (CBD) with the prokaryotic voltage-gated sodium channel. These are important results that will help further our understanding of the effects of CBD on certain neurological diseases and also provide insight into the biophysics of sodium channels.</p> <p>Revisions:</p> <p>The authors have done a superb job at addressing reviewers concerns and the manuscript is much stronger for that. In its present form, the number of principal figures is unnecessarily very large and reading the manuscript is a little "jumpy". Our request is that several figures should be combined into single figures with panels that present a more cohesive and consistent story.</p></section></article><article class="sub-article" id="sa2"><section class="pmc-layout__citation font-secondary font-xs"><div>eLife. 2020 Oct 22;9:e58593. doi: <a href="https://doi.org/10.7554/eLife.58593.sa2" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">10.7554/eLife.58593.sa2</a> </div></section><section class="front-matter"><div class="ameta p font-secondary font-xs"> <hgroup><h1>Author response</h1></hgroup><ul class="d-buttons inline-list"> <li><button class="d-button" aria-controls="anp_a.d" aria-expanded="false">Article notes</button></li> <li><button class="d-button" aria-controls="clp_a.d" aria-expanded="false">Copyright and License information</button></li> </ul> <div class="d-panels font-secondary-light"> <div id="anp_a.d" class="d-panel p" style="display: none"><div class="notes p"><section id="historyfront-stub2" class="history"><p>Collection date 2020.</p></section></div></div> <div id="clp_a.d" class="d-panel p" style="display: none"><div class="p"><a href="/about/copyright/" class="usa-link">PMC Copyright notice</a></div></div> </div> <div></div> </div></section><section class="body sub-article-body"><hr class="headless"> <blockquote class="text-italic"> <p>Essential revisions:</p> <p>The weakness of this study is the lack of functional data that would greatly complement the excellent structural results. Electrophysiological data showing the interaction of CBD with NavMs should be obtained and presented. This should be a very easy experiment to perform. CBD has been shown to block the NaChBac sodium channel, but there is no record in the literature that shows that CBD also blocks NavMs.</p> </blockquote> <p>We entirely agreed with the editor/reviewers that this was important information that should be included in the paper. Consequently we partnered with Prof. Peter Ruben’s expert electrophysiology group from Simon Fraser University, who have now undertaken and analysed the functional consequences of binding CBD to NavMs. The experiments are described in the Materials and methods, the results shown in the new Figure 12, and the interpretation of these discussed in the Results section. This is an important addition to the paper, and directly shows the functional effects that complement the structural studies.</p> <blockquote class="text-italic"><p>This is a fundamental experiment that should be included in a revised version of the paper. It will also be of great interest to test the results of their structure by mutating appropriate sodium channel residues (e.g. in Nav1.1) and measure changes in cannabidiol interaction.</p></blockquote> <p>As requested, we mutated residue T207 (which corresponds with Nav1.1 residue F1774 [now indicated in the Figure 8 sequence and Figure 7 binding site figures] that showed reduced binding affinity for CBD), and also show the EP results for this mutant in new Figure 12. The NavMs T207A mutant protein does indeed show a diminished effect for CBD, indicating a reduced binding affinity. We thank the reviewer for this suggestion, as we believe this is an important addition to the manuscript.</p> <blockquote class="text-italic"><p>Similarly, discussion of the different ways CBD and THC bind to NavMs would greatly benefit from a comparison of the physiological effects of these two compounds. Does THC block NavMs and if it does, what is Kd/IC50 for THC compared to CBD?</p></blockquote> <p>Because of drug licensing regulations, we have currently been unable to source highly purified THC for the experiments proposed by the reviewer. For that reason, we did molecular modelling/bioinformatics comparisons of the two compounds. Previously published studies in the literature (cited in this manuscript) comparing CBD and THC effects on hNav1.2 indicated very similar potencies, although the Hill slope for the THC was less steep, consistent with the possible missing electrostatic interaction in the NavMs binding site, as modelled. This is noted in the section on THC modelling.</p> <blockquote class="text-italic"><p>Electron density observed at the CBD site in the apo state structure needs to be shown side by side with the density for CBD in the structure obtained in the presence of CBD (a supplementary figure would suffice).</p></blockquote> <p>As suggested, we have included a new figure (Figure 11), which clearly shows the requested comparisons of the electron density in the CBD-NavMs complex (Figure 11A) with that in apo-NavMs (Figure 11B), and includes a difference map (Figure 11C) for the CBD-NavMs complex with lipid placed in the CBD site. The CBD density is not in the same location nor is it the same shape as the density in the apo structure. The apo state density appears to be that of a single hydrocarbon chain of a lipid or detergent molecule (at partial occupancy), which adventitiously binds in an existing hydrophobic pocket. This hydrophobic region leads from the fenestration into the edge of the transmembrane channel region. The identity of this density as lipid is consistent with molecular dynamic studies of apo-NavMs (Ulmschneider et al., 2013) that have shown that lipid chains can enter and leave the fenestrations near this site during the course of a simulation; this is now noted in the “CBD-binding Site” section of the main text.</p> <blockquote class="text-italic"><p>Along these lines, it might be a good idea to add a brief discussion on how physiologically relevant is the apo state density. For example, if this site is always occupied by a lipid in physiological conditions, the channel would never open.</p></blockquote> <p>Were it occupied by a lipid molecule all of the time (as suggested by the reviewer), for steric reasons it would block the entry of <em>any</em> hydrophobic drugs into the channel. Partial occupancy is consistent (see above) with the molecular dynamics studies (Ulmschneider et al., 2013) that have shown that lipid chains can enter and leave the fenestrations near this site during the course of a simulation. This is now mentioned in the Discussion section of the text.</p> <p>[Editors' note: further revisions were suggested prior to acceptance, as described below.]</p> <blockquote class="text-italic"> <p>Revisions:</p> <p>The authors have done a superb job at addressing reviewers concerns and the manuscript is much stronger for that. In its present form, the number of principal figures is unnecessarily very large and reading the manuscript is a little "jumpy". Our request is that several figures should be combined into single figures with panels that present a more cohesive and consistent story.</p> </blockquote> <p>We have followed your suggestions and changed the figures (decreasing the number of main figures from 14 to 8). This entailed merging several of them, deleting two that were unnecessary (previous Figures 2 and 3), and moving two of them to figure supplements, along with the associated changes to the figure legends and figure citations within the text. It did entail making some small changes to the organisation of the text, as also indicated in your email might be beneficial, without any loss/change of content. We believe this now reads much more coherently and are pleased to have done these changes.</p></section></article><article class="sub-article" id="_ad93_"><section class="pmc-layout__citation font-secondary font-xs"><div></div></section><section class="front-matter"><div class="ameta p font-secondary font-xs"> <hgroup><h1>Associated Data</h1></hgroup><ul class="d-buttons inline-list"></ul> <div class="d-panels font-secondary-light"></div> <div></div> <p class="font-secondary"><em>This section collects any data citations, data availability statements, or supplementary materials included in this article.</em></p> </div></section><section class="body sub-article-body"><section id="_adc93_" lang="en" class="data-citations"><h2 class="pmc_sec_title">Data Citations</h2> <ol class="ref-list font-sm"> <li id="_dbx_ref_dataset3"><cite>Sula A, Sait LG, Hollingworth D, Wallace BA. 2020. Full Length Open-form Sodium Channel NavMs F208L. RCSB Protein Data Bank. 6YZ2</cite></li> <li id="_dbx_ref_dataset4"><cite>Sula A, Sait LG, Hollingworth D, Wallace BA. 2020. Full Length Open-form Sodium Channel NavMs F208L in Complex with Cannabidiol (CBD) RCSB Protein Data Bank. 6YZ0</cite></li> </ol></section><section id="_adsm93_" lang="en" class="supplementary-materials"><h2 class="pmc_sec_title">Supplementary Materials</h2> <section class="sm xbox font-sm" id="db_ds_supplementary-material1_reqid_"><div class="caption p"><span>Supplementary file 1. Crystal structure parameters.</span></div> <div class="media p"><div class="caption"> <a href="/articles/instance/7641581/bin/elife-58593-supp1.docx" data-ga-action="click_feat_suppl" class="usa-link">elife-58593-supp1.docx</a><sup> (16.8KB, docx) </sup> </div></div></section><section class="sm xbox font-sm" id="db_ds_supplementary-material2_reqid_"><div class="caption p"><span>Transparent reporting form</span></div> <div class="media p"><div class="caption"> <a href="/articles/instance/7641581/bin/elife-58593-transrepform.docx" data-ga-action="click_feat_suppl" class="usa-link">elife-58593-transrepform.docx</a><sup> (248.5KB, docx) </sup> </div></div></section></section><section id="_adda93_" lang="en" class="data-availability-statement"><h2 class="pmc_sec_title">Data Availability Statement</h2> <p>Coordinates and Diffraction data have been deposited in the PDB under PDB6YZ2, and PDB6YZ0. All data generated or analysed during this study are included in the manuscript and supporting files.</p> <p>The following datasets were generated:</p> <p>Sula A, Sait LG, Hollingworth D, Wallace BA. 2020. Full Length Open-form Sodium Channel NavMs F208L. RCSB Protein Data Bank. 6YZ2</p> <p>Sula A, Sait LG, Hollingworth D, Wallace BA. 2020. Full Length Open-form Sodium Channel NavMs F208L in Complex with Cannabidiol (CBD) RCSB Protein Data Bank. 6YZ0</p></section></section></article><footer class="p courtesy-note font-secondary font-sm text-center"><hr class="headless"> <p>Articles from eLife are provided here courtesy of <strong>eLife Sciences Publications, Ltd</strong></p></footer></section></article> </main> </div> </div> </div> <!-- Secondary navigation placeholder --> <div class="pmc-sidenav desktop:grid-col-4 display-flex"> <section class="pmc-sidenav__container" aria-label="Article resources and navigation"> <button type="button" class="usa-button pmc-sidenav__container__close usa-button--unstyled"> <img src="/static/img/usa-icons/close.svg" role="img" alt="Close" /> </button> <div class="display-none desktop:display-block"> <section class="margin-top-4 desktop:margin-top-0"> <h2 class="margin-top-0">ACTIONS</h2> <ul class="usa-list usa-list--unstyled usa-list--actions"> <li> <a href="https://doi.org/10.7554/eLife.58593" class="usa-button usa-button--outline width-24 font-xs display-inline-flex flex-align-center flex-justify-start padding-left-1" target="_blank" rel="noreferrer noopener" data-ga-category="actions" data-ga-action="click" data-ga-label="publisher_link_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#launch"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 padding-right-2">View on publisher site</span> </a> </li> <li> <a href="pdf/elife-58593.pdf" class="usa-button usa-button--outline width-24 display-inline-flex flex-align-center flex-justify-start padding-left-1" data-ga-category="actions" data-ga-action="click" data-ga-label="pdf_download_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1">PDF (5.6 MB)</span> </a> </li> <li> <button role="button" class="usa-button width-24 citation-dialog-trigger display-inline-flex flex-align-center flex-justify-start padding-left-1" aria-label="Open dialog with citation text in different styles" data-ga-category="actions" data-ga-action="open" data-ga-label="cite_desktop" data-all-citations-url="/resources/citations/7641581/" data-citation-style="nlm" data-download-format-link="/resources/citations/7641581/export/" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#format_quote"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 button-label">Cite</span> </button> </li> <li> <button class="usa-button width-24 collections-dialog-trigger collections-button display-inline-flex flex-align-center flex-justify-start padding-left-1 collections-button-empty" aria-label="Save article in MyNCBI collections." data-ga-category="actions" data-ga-action="click" data-ga-label="collections_button_desktop" data-collections-open-dialog-enabled="false" data-collections-open-dialog-url="https://account.ncbi.nlm.nih.gov/?back_url=https%3A%2F%2Fpmc.ncbi.nlm.nih.gov%2Farticles%2FPMC7641581%2F%23open-collections-dialog" data-in-collections="false"> <svg class="usa-icon width-3 height-3 usa-icon--bookmark-full" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-full.svg#icon"></use> </svg> <svg class="usa-icon width-3 height-3 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-empty.svg#icon"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1">Collections</span> </button> </li> <li class="pmc-permalink"> <button type="button" class="usa-button width-24 display-inline-flex flex-align-center flex-justify padding-left-1 shadow-none" aria-label="Show article permalink" aria-expanded="false" aria-haspopup="true" data-ga-category="actions" data-ga-action="open" data-ga-label="permalink_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#share"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 button-label">Permalink</span> </button> <div class="pmc-permalink__dropdown" hidden> <div class="pmc-permalink__dropdown__container"> <h2 class="usa-modal__heading margin-top-0 margin-bottom-2">PERMALINK</h2> <div class="pmc-permalink__dropdown__content"> <input type="text" class="usa-input" value="https://pmc.ncbi.nlm.nih.gov/articles/PMC7641581/" aria-label="Article permalink"> <button class="usa-button display-inline-flex pmc-permalink__dropdown__copy__btn margin-right-0" title="Copy article permalink" data-ga-category="save_share" data-ga-action="link" data-ga-label="copy_link"> <svg class="usa-icon" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span class="margin-left-1">Copy</span> </button> </div> </div> </div> </li> </ul> </section> </div> <section class="pmc-resources margin-top-6 desktop:margin-top-4" data-page-path="/articles/PMC7641581/"> <h2 class="margin-top-0">RESOURCES</h2> <div class="usa-accordion usa-accordion--multiselectable" data-allow-multiple> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-similar-articles" data-ga-category="resources_accordion" data-ga-action="open_similar_articles" data-ga-label="/articles/PMC7641581/" data-action-open="open_similar_articles" data-action-close="close_similar_articles" > Similar articles </button> </h3> <div id="resources-similar-articles" class="usa-accordion__content usa-prose" data-source-url="/resources/similar-article-links/33089780/" > </div> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-cited-by-other-articles" data-ga-category="resources_accordion" data-ga-action="open_cited_by" data-ga-label="/articles/PMC7641581/" data-action-open="open_cited_by" data-action-close="close_cited_by" > Cited by other articles </button> </h3> <div id="resources-cited-by-other-articles" class="usa-accordion__content usa-prose" data-source-url="/resources/cited-by-links/33089780/" > </div> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-links-to-ncbi-databases" data-ga-category="resources_accordion" data-ga-action="open_NCBI_links" data-ga-label="/articles/PMC7641581/" data-action-open="open_NCBI_links" data-action-close="close_NCBI_link" > Links to NCBI Databases </button> </h3> <div id="resources-links-to-ncbi-databases" class="usa-accordion__content usa-prose" data-source-url="/resources/db-links/7641581/" > </div> </div> </section> <section class="usa-in-page-nav usa-in-page-nav--wide margin-top-6 desktop:margin-top-4" data-title-text="On this page" data-title-heading-level="h2" data-scroll-offset="0" data-root-margin="-10% 0px -80% 0px" data-main-content-selector="main" data-threshold="1" hidden ></section> </section> </div> <div class="overlay" role="dialog" aria-label="Citation Dialog" hidden> <div class="dialog citation-dialog" aria-hidden="true"> <div class="display-inline-flex flex-align-center flex-justify width-full margin-bottom-2"> <h2 class="usa-modal__heading margin-0">Cite</h2> <button type="button" class="usa-button usa-button--unstyled close-overlay text-black width-auto" tabindex="1"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#close"></use> </svg> </button> </div> <div class="citation-text-block"> <div class="citation-text margin-bottom-2"></div> <ul class="usa-list usa-list--unstyled display-inline-flex flex-justify width-full flex-align-center"> <li> <button class="usa-button usa-button--unstyled text-no-underline display-flex flex-align-center copy-button dialog-focus" data-ga-category="save_share" data-ga-action="cite" data-ga-label="copy" tabindex="2"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span>Copy</span> </button> </li> <li> <a href="#" role="button" class="usa-button usa-button--unstyled text-no-underline display-flex flex-align-center export-button" data-ga-category="save_share" data-ga-action="cite" data-ga-label="download" title="Download a file for external citation management software" tabindex="3"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> <span class="display-none mobile-lg:display-inline">Download .nbib</span> <span class="display-inline mobile-lg:display-none">.nbib</span> </a> </li> <li> <div class="display-inline-flex flex-align-center"> <label class="usa-label margin-top-0">Format:</label> <select aria-label="Format" class="usa-select citation-style-selector padding-1 margin-top-0 border-0 padding-right-4" tabindex="4" > <option data-style-url-name="ama" value="AMA" > AMA </option> <option data-style-url-name="apa" value="APA" > APA </option> <option data-style-url-name="mla" value="MLA" > MLA </option> <option data-style-url-name="nlm" value="NLM" selected="selected"> NLM </option> </select> </div> </li> </ul> </div> </div> </div> <div class="overlay" role="dialog" hidden> <div id="collections-action-dialog" class="dialog collections-dialog" aria-hidden="true"> <div class="display-inline-flex flex-align-center flex-justify width-full margin-bottom-2"> <h2 class="usa-modal__heading margin-0">Add to Collections</h2> </div> <div class="collections-action-panel action-panel"> <form id="collections-action-dialog-form" class="usa-form maxw-full collections-action-panel-form action-panel-content action-form action-panel-smaller-selectors" data-existing-collections-url="/list-existing-collections/" data-add-to-existing-collection-url="/add-to-existing-collection/" data-create-and-add-to-new-collection-url="/create-and-add-to-new-collection/" data-myncbi-max-collection-name-length="100" data-collections-root-url="https://www.ncbi.nlm.nih.gov/myncbi/collections/"> <input type="hidden" name="csrfmiddlewaretoken" value="1PWnMNkNeMYHL5BFzGRT9PKen1JaLVfqpAzPN9DVtc5vTEzQgss4kuDisyalofdj"> <fieldset class="usa-fieldset margin-bottom-2"> <div class="usa-radio"> <input type="radio" id="collections-action-dialog-new" class="usa-radio__input usa-radio__input--tile collections-new margin-top-0" name="collections" value="new" data-ga-category="collections_button" data-ga-action="click" data-ga-label="collections_radio_new" /> <label class="usa-radio__label" for="collections-action-dialog-new">Create a new collection</label> </div> <div class="usa-radio"> <input type="radio" id="collections-action-dialog-existing" class="usa-radio__input usa-radio__input--tile collections-existing" name="collections" value="existing" checked="true" data-ga-category="collections_button" data-ga-action="click" data-ga-label="collections_radio_existing" /> <label class="usa-radio__label" for="collections-action-dialog-existing">Add to an existing collection</label> </div> </fieldset> <fieldset class="usa-fieldset margin-bottom-2"> <div class="action-panel-control-wrap new-collections-controls"> <label for="collections-action-dialog-add-to-new" class="usa-label margin-top-0"> Name your collection <abbr title="required" class="usa-hint usa-hint--required text-no-underline">*</abbr> </label> <input type="text" name="add-to-new-collection" id="collections-action-dialog-add-to-new" class="usa-input collections-action-add-to-new" pattern="[^&quot;&amp;=&lt;&gt;/]*" title="The following characters are not allowed in the Name field: &quot;&amp;=&lt;&gt;/" maxlength="" data-ga-category="collections_button" data-ga-action="create_collection" data-ga-label="non_favorties_collection" required /> </div> <div class="action-panel-control-wrap existing-collections-controls"> <label for="collections-action-dialog-add-to-existing" class="usa-label margin-top-0"> Choose a collection </label> <select id="collections-action-dialog-add-to-existing" class="usa-select collections-action-add-to-existing" data-ga-category="collections_button" data-ga-action="select_collection" data-ga-label="($('.collections-action-add-to-existing').val() === 'Favorites') ? 'Favorites' : 'non_favorites_collection'"> </select> <div class="collections-retry-load-on-error usa-input-error-message selection-validation-message"> Unable to load your collection due to an error<br> <a href="#">Please try again</a> </div> </div> </fieldset> <div class="display-inline-flex"> <button class="usa-button margin-top-0 action-panel-submit" type="submit" data-loading-label="Adding..." data-pinger-ignore data-ga-category="collections_button" data-ga-action="click" data-ga-label="add"> Add </button> <button class="usa-button usa-button--outline margin-top-0 action-panel-cancel" aria-label="Close 'Add to Collections' panel" ref="linksrc=close_collections_panel" data-ga-category="collections_button" data-ga-action="click" data-ga-label="cancel"> Cancel </button> </div> </form> </div> </div> </div> </div> </div> </div> <footer class="ncbi-footer ncbi-dark-background " > <div class="ncbi-footer__icon-section"> <div class="ncbi-footer__social-header"> Follow NCBI </div> <div class="grid-container ncbi-footer__ncbi-social-icons-container"> <a href="https://twitter.com/ncbi" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="40" height="40" viewBox="0 0 40 40" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="m6.067 8 10.81 13.9L6 33.2h4.2l8.4-9.1 7.068 9.1H34L22.8 18.5 31.9 8h-3.5l-7.7 8.4L14.401 8H6.067Zm3.6 1.734h3.266l16.8 21.732H26.57L9.668 9.734Z"> </path> </svg> <span class="usa-sr-only">NCBI on X (formerly known as Twitter)</span> </a> <a href="https://www.facebook.com/ncbi.nlm" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="16" height="29" focusable="false" aria-hidden="true" viewBox="0 0 16 29" fill="none" xmlns="http://www.w3.org/2000/svg"> <path d="M3.8809 21.4002C3.8809 19.0932 3.8809 16.7876 3.8809 14.478C3.8809 14.2117 3.80103 14.1452 3.54278 14.1492C2.53372 14.1638 1.52334 14.1492 0.514288 14.1598C0.302626 14.1598 0.248047 14.0972 0.248047 13.8936C0.256034 12.4585 0.256034 11.0239 0.248047 9.58978C0.248047 9.37013 0.302626 9.30224 0.528931 9.3049C1.53798 9.31688 2.54837 9.3049 3.55742 9.31555C3.80103 9.31555 3.8809 9.26097 3.87957 9.00272C3.87158 8.00565 3.85428 7.00592 3.90753 6.00884C3.97142 4.83339 4.31487 3.73115 5.04437 2.78467C5.93095 1.63318 7.15699 1.09005 8.56141 0.967577C10.5582 0.79319 12.555 0.982221 14.5518 0.927641C14.7102 0.927641 14.7462 0.99287 14.7449 1.13664C14.7449 2.581 14.7449 4.02668 14.7449 5.47104C14.7449 5.67604 14.6517 5.68669 14.4946 5.68669C13.4523 5.68669 12.4113 5.68669 11.3703 5.68669C10.3506 5.68669 9.92057 6.10868 9.90593 7.13904C9.89661 7.7647 9.91525 8.39303 9.89794 9.01869C9.88995 9.26364 9.96583 9.31822 10.2015 9.31688C11.7204 9.30623 13.2393 9.31688 14.7595 9.3049C15.0257 9.3049 15.0723 9.3728 15.0444 9.62439C14.89 10.9849 14.7515 12.3467 14.6144 13.7085C14.5691 14.1571 14.5785 14.1585 14.1458 14.1585C12.8386 14.1585 11.5313 14.1665 10.2254 14.1518C9.95119 14.1518 9.89794 14.2317 9.89794 14.4899C9.90593 19.0799 9.89794 23.6752 9.91125 28.2612C9.91125 28.5674 9.8407 28.646 9.53186 28.6433C7.77866 28.6273 6.02414 28.6366 4.27094 28.634C3.82499 28.634 3.87158 28.6992 3.87158 28.22C3.87602 25.9472 3.87913 23.6739 3.8809 21.4002Z"> </path> </svg> <span class="usa-sr-only">NCBI on Facebook</span> </a> <a href="https://www.linkedin.com/company/ncbinlm" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="25" height="23" viewBox="0 0 26 24" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M14.6983 9.98423C15.6302 9.24808 16.5926 8.74754 17.6762 8.51991C19.673 8.09126 21.554 8.30824 23.1262 9.7526C24.2351 10.7723 24.7529 12.1115 25.0165 13.5612C25.1486 14.3363 25.2105 15.1218 25.2015 15.9081C25.2015 18.3043 25.2015 20.6898 25.2082 23.0806C25.2082 23.3468 25.1549 23.444 24.8621 23.4414C23.1297 23.4272 21.3992 23.4272 19.6704 23.4414C19.4041 23.4414 19.3429 23.3588 19.3442 23.1019C19.3535 20.5194 19.3442 17.9368 19.3442 15.3543C19.3442 14.0005 18.3258 12.9448 17.0266 12.9488C15.7273 12.9528 14.6983 14.0071 14.6983 15.361C14.6983 17.9328 14.6917 20.5047 14.6983 23.0753C14.6983 23.3708 14.6198 23.444 14.3296 23.4427C12.6185 23.4294 10.9079 23.4294 9.19779 23.4427C8.93155 23.4427 8.86099 23.3735 8.86232 23.1086C8.8783 19.7619 8.88628 16.4144 8.88628 13.066C8.88628 11.5688 8.87874 10.0708 8.86365 8.57182C8.86365 8.3575 8.90758 8.27896 9.14054 8.28029C10.9048 8.29094 12.6687 8.29094 14.4321 8.28029C14.6464 8.28029 14.6983 8.34818 14.6983 8.54653C14.6903 9.00047 14.6983 9.45441 14.6983 9.98423Z"> </path> <path d="M6.55316 15.8443C6.55316 18.2564 6.55316 20.6699 6.55316 23.082C6.55316 23.3629 6.48127 23.4388 6.19906 23.4374C4.47737 23.4241 2.75568 23.4241 1.03399 23.4374C0.767751 23.4374 0.69986 23.3629 0.701191 23.1006C0.709178 18.2648 0.709178 13.4281 0.701191 8.59053C0.701191 8.34026 0.765089 8.27237 1.01669 8.2737C2.74991 8.28435 4.48048 8.28435 6.20838 8.2737C6.47462 8.2737 6.5465 8.33627 6.54517 8.6065C6.54783 11.0186 6.55316 13.4308 6.55316 15.8443Z"> </path> <path d="M3.65878 0.243898C5.36804 0.243898 6.58743 1.45529 6.58743 3.1406C6.58743 4.75801 5.32145 5.95742 3.60819 5.96807C3.22177 5.97614 2.83768 5.90639 2.47877 5.76299C2.11985 5.61959 1.79344 5.40546 1.51897 5.13334C1.24449 4.86123 1.02755 4.53668 0.881058 4.17902C0.734563 3.82136 0.661505 3.43788 0.666231 3.05141C0.67555 1.42601 1.9362 0.242566 3.65878 0.243898Z"> </path> </svg> <span class="usa-sr-only">NCBI on LinkedIn</span> </a> <a href="https://github.com/ncbi" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="28" height="27" viewBox="0 0 28 28" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M16.7228 20.6334C17.5057 20.5527 18.2786 20.3944 19.0301 20.1608C21.3108 19.4193 22.5822 17.8259 22.963 15.4909C23.1228 14.5112 23.1814 13.5287 22.9883 12.5437C22.8106 11.6423 22.4013 10.8028 21.8007 10.1076C21.7526 10.0605 21.7197 10 21.7064 9.934C21.6931 9.86799 21.7 9.79952 21.7262 9.73748C22.0856 8.6206 21.9711 7.51969 21.601 6.42677C21.582 6.3497 21.5345 6.2827 21.468 6.23923C21.4016 6.19577 21.3211 6.17906 21.2429 6.19248C20.7329 6.21649 20.2313 6.33051 19.7611 6.52928C19.1103 6.7908 18.4899 7.12198 17.9104 7.51703C17.84 7.56996 17.7581 7.60551 17.6713 7.62078C17.5846 7.63605 17.4954 7.6306 17.4112 7.60489C15.2596 7.05882 13.0054 7.06203 10.8554 7.61421C10.7806 7.63586 10.7018 7.63967 10.6253 7.62534C10.5487 7.611 10.4766 7.57892 10.4148 7.53167C9.64788 7.03247 8.85171 6.58918 7.96368 6.33359C7.65781 6.24338 7.34123 6.19458 7.02239 6.18849C6.94879 6.17986 6.87462 6.19893 6.81432 6.242C6.75402 6.28507 6.71191 6.34904 6.69621 6.42145C6.32342 7.51437 6.2209 8.61527 6.56307 9.73348C6.59635 9.84264 6.64694 9.93316 6.54177 10.0516C5.47666 11.2604 5.09988 12.6834 5.19574 14.2676C5.2663 15.4244 5.46201 16.5466 6.01454 17.5769C6.84399 19.1171 8.21664 19.9119 9.85158 20.3352C10.3938 20.4706 10.9444 20.5698 11.4998 20.632C11.5384 20.7492 11.4506 20.7798 11.408 20.8291C11.1734 21.1179 10.9894 21.4441 10.8634 21.7942C10.7622 22.0458 10.8315 22.4039 10.6065 22.5516C10.263 22.7766 9.83827 22.8485 9.42421 22.8871C8.17936 23.0056 7.26471 22.4877 6.6283 21.4348C6.25552 20.8184 5.76956 20.3325 5.08523 20.0663C4.76981 19.9325 4.42139 19.8967 4.08537 19.9638C3.7898 20.029 3.73788 20.1901 3.93891 20.4111C4.03639 20.5234 4.14989 20.6207 4.27575 20.6999C4.9796 21.1318 5.51717 21.7884 5.80152 22.5636C6.37002 23.9973 7.48039 24.5697 8.93825 24.6323C9.43741 24.6575 9.93768 24.615 10.4254 24.5058C10.5892 24.4672 10.6531 24.4872 10.6517 24.6762C10.6451 25.4936 10.6637 26.3123 10.6517 27.131C10.6517 27.6635 10.1684 27.9297 9.58663 27.7393C8.17396 27.2671 6.84977 26.5631 5.66838 25.656C2.59555 23.2891 0.720966 20.1861 0.217704 16.3376C-0.357453 11.9127 0.911353 8.00824 3.98551 4.73881C6.11909 2.42656 8.99932 0.939975 12.1203 0.540191C16.5351 -0.0601815 20.4347 1.14323 23.7232 4.16373C26.2449 6.47869 27.724 9.37672 28.1048 12.7726C28.5828 17.0325 27.3686 20.7945 24.4768 23.9827C22.9762 25.6323 21.0956 26.8908 18.9982 27.6488C18.8783 27.6927 18.7585 27.738 18.636 27.7726C18.0356 27.9404 17.6189 27.6395 17.6189 27.0098C17.6189 25.7452 17.6308 24.4806 17.6295 23.2159C17.6329 22.9506 17.6128 22.6856 17.5696 22.4238C17.4325 21.6664 17.3419 21.484 16.7228 20.6334Z"> </path> </svg> <span class="usa-sr-only">NCBI on GitHub</span> </a> <a href="https://ncbiinsights.ncbi.nlm.nih.gov/" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="26" height="26" viewBox="0 0 27 27" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M23.7778 26.4574C23.1354 26.3913 22.0856 26.8024 21.636 26.3087C21.212 25.8444 21.4359 24.8111 21.324 24.0347C19.9933 14.8323 14.8727 8.80132 6.09057 5.85008C4.37689 5.28406 2.58381 4.99533 0.779072 4.99481C0.202773 4.99481 -0.0229751 4.83146 0.00455514 4.21479C0.0660406 3.08627 0.0660406 1.95525 0.00455514 0.826734C-0.0413285 0.0815827 0.259669 -0.0193618 0.896534 0.00266238C6.96236 0.222904 12.3693 2.24179 16.9889 6.16209C22.9794 11.2478 26.1271 17.7688 26.4372 25.648C26.4629 26.294 26.3179 26.5271 25.6609 26.4684C25.0827 26.417 24.4991 26.4574 23.7778 26.4574Z"> </path> <path d="M14.8265 26.441C14.0924 26.441 13.2371 26.6795 12.6626 26.3786C12.0092 26.0372 12.3781 25.0644 12.246 24.378C11.1154 18.5324 6.6849 14.5497 0.74755 14.1001C0.217135 14.0615 -0.0104482 13.9422 0.0134113 13.3659C0.0519536 12.1454 0.0482829 10.9213 0.0134113 9.69524C-0.00127145 9.14464 0.196946 9.03268 0.703502 9.04736C9.21217 9.27128 16.5994 16.2511 17.2804 24.7231C17.418 26.4446 17.418 26.4446 15.6579 26.4446H14.832L14.8265 26.441Z"> </path> <path d="M3.58928 26.4555C2.64447 26.4618 1.73584 26.0925 1.06329 25.4289C0.39073 24.7653 0.00933763 23.8617 0.0030097 22.9169C-0.00331824 21.9721 0.365937 21.0635 1.02954 20.3909C1.69315 19.7184 2.59675 19.337 3.54156 19.3306C4.48637 19.3243 5.39499 19.6936 6.06755 20.3572C6.7401 21.0208 7.1215 21.9244 7.12782 22.8692C7.13415 23.814 6.7649 24.7226 6.10129 25.3952C5.43768 26.0677 4.53409 26.4491 3.58928 26.4555Z"> </path> </svg> <span class="usa-sr-only">NCBI RSS feed</span> </a> </div> </div> <div data-testid="gridContainer" class="grid-container ncbi-footer__container"> <div class="grid-row ncbi-footer__main-content-container" data-testid="grid"> <div class="ncbi-footer__column"> <p class="ncbi-footer__circled-icons-heading"> Connect with NLM </p> <div class="ncbi-footer__circled-icons-list"> <a href=https://twitter.com/nlm_nih class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="32" height="32" viewBox="0 0 40 40" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="m6.067 8 10.81 13.9L6 33.2h4.2l8.4-9.1 7.068 9.1H34L22.8 18.5 31.9 8h-3.5l-7.7 8.4L14.401 8H6.067Zm3.6 1.734h3.266l16.8 21.732H26.57L9.668 9.734Z"> </path> </svg> <span class="usa-sr-only">NLM on X (formerly known as Twitter)</span> </a> <a href=https://www.facebook.com/nationallibraryofmedicine class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="13" height="24" viewBox="0 0 13 24" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M4.11371 23.1369C4.11371 23.082 4.11371 23.0294 4.11371 22.9745V12.9411H0.817305C0.6709 12.9411 0.670898 12.9411 0.670898 12.8016C0.670898 11.564 0.670898 10.3287 0.670898 9.09341C0.670898 8.97903 0.705213 8.95158 0.815017 8.95158C1.8673 8.95158 2.91959 8.95158 3.97417 8.95158H4.12057V8.83263C4.12057 7.8055 4.12057 6.7738 4.12057 5.74897C4.1264 4.92595 4.31387 4.11437 4.66959 3.37217C5.12916 2.38246 5.94651 1.60353 6.95717 1.1921C7.64827 0.905008 8.3913 0.764035 9.13953 0.778051C10.0019 0.791777 10.8644 0.830666 11.7268 0.860404C11.8869 0.860404 12.047 0.894717 12.2072 0.90158C12.2964 0.90158 12.3261 0.940469 12.3261 1.02968C12.3261 1.5421 12.3261 2.05452 12.3261 2.56465C12.3261 3.16857 12.3261 3.7725 12.3261 4.37642C12.3261 4.48165 12.2964 4.51367 12.1912 4.51138C11.5369 4.51138 10.8804 4.51138 10.2261 4.51138C9.92772 4.51814 9.63058 4.5526 9.33855 4.61433C9.08125 4.6617 8.84537 4.78881 8.66431 4.97766C8.48326 5.16652 8.3662 5.40755 8.32972 5.66661C8.28476 5.89271 8.26027 6.1224 8.25652 6.35289C8.25652 7.19014 8.25652 8.02969 8.25652 8.86923C8.25652 8.89439 8.25652 8.91955 8.25652 8.95615H12.0219C12.1797 8.95615 12.182 8.95616 12.1614 9.10714C12.0768 9.76596 11.9876 10.4248 11.9029 11.0813C11.8312 11.6319 11.7626 12.1824 11.697 12.733C11.6719 12.9434 11.6787 12.9434 11.4683 12.9434H8.26338V22.899C8.26338 22.979 8.26338 23.0591 8.26338 23.1392L4.11371 23.1369Z"> </path> </svg> <span class="usa-sr-only">NLM on Facebook</span> </a> <a href=https://www.youtube.com/user/NLMNIH class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="21" height="15" viewBox="0 0 21 15" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M19.2561 1.47914C18.9016 1.15888 18.5699 0.957569 17.2271 0.834039C15.5503 0.678484 13.2787 0.655608 11.563 0.65332H9.43556C7.71987 0.65332 5.4483 0.678484 3.77151 0.834039C2.43098 0.957569 2.097 1.15888 1.74242 1.47914C0.813665 2.32097 0.619221 4.62685 0.598633 6.89384C0.598633 7.31781 0.598633 7.74101 0.598633 8.16345C0.626084 10.4121 0.827391 12.686 1.74242 13.521C2.097 13.8412 2.4287 14.0425 3.77151 14.1661C5.4483 14.3216 7.71987 14.3445 9.43556 14.3468H11.563C13.2787 14.3468 15.5503 14.3216 17.2271 14.1661C18.5676 14.0425 18.9016 13.8412 19.2561 13.521C20.1712 12.6929 20.3725 10.451 20.3999 8.22064C20.3999 7.74025 20.3999 7.25986 20.3999 6.77946C20.3725 4.54907 20.1689 2.30724 19.2561 1.47914ZM8.55942 10.5311V4.65201L13.5601 7.50005L8.55942 10.5311Z" fill="white" /> </svg> <span class="usa-sr-only">NLM on YouTube</span> </a> </div> </div> <address class="ncbi-footer__address ncbi-footer__column"> <p> <a class="usa-link usa-link--external" href="https://www.google.com/maps/place/8600+Rockville+Pike,+Bethesda,+MD+20894/%4038.9959508, -77.101021,17z/data%3D!3m1!4b1!4m5!3m4!1s0x89b7c95e25765ddb%3A0x19156f88b27635b8!8m2!3d38.9959508! 4d-77.0988323" rel="noopener noreferrer" target="_blank">National Library of Medicine <br/> 8600 Rockville Pike<br/> Bethesda, MD 20894</a> </p> </address> <ul class="usa-list usa-list--unstyled ncbi-footer__vertical-list ncbi-footer__column"> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/web_policies.html" class="usa-link usa-link--alt ncbi-footer__link" > Web Policies </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nih.gov/institutes-nih/nih-office-director/office-communications-public-liaison/freedom-information-act-office" class="usa-link usa-link--alt ncbi-footer__link" > FOIA </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.hhs.gov/vulnerability-disclosure-policy/index.html" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > HHS Vulnerability Disclosure </a> </li> </ul> <ul class="usa-list usa-list--unstyled ncbi-footer__vertical-list ncbi-footer__column"> <li class="ncbi-footer__vertical-list-item"> <a href="https://support.nlm.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > Help </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/accessibility.html" class="usa-link usa-link--alt ncbi-footer__link" > Accessibility </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/careers/careers.html" class="usa-link usa-link--alt ncbi-footer__link" > Careers </a> </li> </ul> </div> <div class="grid-row grid-col-12" data-testid="grid"> <ul class="ncbi-footer__bottom-links-list"> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.nlm.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > NLM </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > NIH </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.hhs.gov/" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > HHS </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.usa.gov/" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > USA.gov </a> </li> </ul> </div> </div> </footer> <script type="text/javascript" src="https://cdn.ncbi.nlm.nih.gov/core/pinger/pinger.js"> </script> <button class="back-to-top" data-ga-category="pagination" data-ga-action="back_to_top"> <label>Back to Top</label> <svg class="usa-icon order-0" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#arrow_upward"></use> </svg> </button> <script type="application/javascript"> window.ncbi = window.ncbi || {}; window.ncbi.pmc = window.ncbi.pmc || {}; window.ncbi.pmc.options = { logLevel: 'INFO', staticEndpoint: '/static/', citeCookieName: 'pmc-cf', }; </script> <script type="module" crossorigin="" src="/static/assets/base-6f05ef93.js"></script> <script type="text/javascript" src="https://cdn.ncbi.nlm.nih.gov/core/jquery/jquery-3.6.0.min.js">&#xA0;</script> <script type="text/javascript"> jQuery.getScript("https://cdn.ncbi.nlm.nih.gov/core/alerts/alerts.js", function () { galert(['div.nav_and_browser', 'div.header', '#universal_header', '.usa-banner', 'body > *:nth-child(1)']) }); </script> <script type="text/javascript">var exports = {};</script> <script src="/static/CACHE/js/output.13b077bc3ffd.js"></script> <script type="module" crossorigin="" src="/static/assets/article-69f9d1ae.js"></script> </body> </html>

Pages: 1 2 3 4 5 6 7 8 9 10