Baseline results of the NeuroNEXT spinal muscular atrophy infant biomarker study

<!DOCTYPE html> <html lang="en" > <head > <meta charset="UTF-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge" /> <meta name="HandheldFriendly" content="True" /> <meta name="MobileOptimized" content="320" /> <meta name="viewport" content="width=device-width, initial-scale=1.0" /> <link rel="stylesheet" href="/static/assets/style-70b9163a.css" /> <script type="module" crossorigin="" src="/static/assets/base_style-ec2bc71e.js"></script> <link rel="stylesheet" href="/static/assets/style-ef962842.css" /> <link rel="stylesheet" href="/static/assets/style-3ade8b5c.css" /> <script type="module" crossorigin="" src="/static/assets/article_style-d757a0dd.js"></script> <style> @media screen and (min-width: 64em) { div.pmc-wm { background: repeat-y; background-image: url("data:image/svg+xml,%3Csvg xmlns='http://www.w3.org/2000/svg' width='20' height='350' xmlns:xlink='http://www.w3.org/1999/xlink'%3E%3Cdefs%3E%3Cfilter x='-.02' y='0' width='1.05' height='1' id='c'%3E%3CfeFlood flood-color='%23FFF'/%3E%3CfeComposite in='SourceGraphic'/%3E%3C/filter%3E%3Ctext id='b' font-family='Helvetica' font-size='11pt' style='opacity:1;fill:%23005ea2;stroke:none;text-anchor:middle' x='175' y='14'%3E%3C/text%3E%3Cpath id='a' style='fill:%23005ea2' d='M0 8h350v3H0z'/%3E%3C/defs%3E%3Cuse xlink:href='%23a' transform='rotate(90 10 10)'/%3E%3Cuse xlink:href='%23b' transform='rotate(90 10 10)' filter='url(%23c)'/%3E%3C/svg%3E"); padding-left: 3rem; } } </style> <link rel="apple-touch-icon" sizes="180x180" href="/static/img/favicons/apple-touch-icon.png" /> <link rel="icon" type="image/png" sizes="48x48" href="/static/img/favicons/favicon-48x48.png" /> <link rel="icon" type="image/png" sizes="32x32" href="/static/img/favicons/favicon-32x32.png" /> <link rel="icon" type="image/png" sizes="16x16" href="/static/img/favicons/favicon-16x16.png" /> <link rel="manifest" href="/static/img/favicons/site.webmanifest" /> <link rel="mask-icon" href="/static/img/favicons/safari-pinned-tab.svg" color="#0071bc" /> <meta name="msapplication-config" content="/static/img/favicons/browserconfig.xml" /> <meta name="theme-color" content="#ffffff" /> <title> Baseline results of the NeuroNEXT spinal muscular atrophy infant biomarker study - PMC </title>  <meta name="ncbi_app" content="cloudpmc-viewer" /> <meta name="ncbi_db" content="pmc" /> <meta name="ncbi_phid" content="E5FD8004741FCC83038004000CB8EA86.m_1" />  <meta name="ncbi_pdid" content="article" /> <link rel="preconnect" href="https://www.google-analytics.com" /> <link rel="dns-prefetch" href="https://cdn.ncbi.nlm.nih.gov" /> <link rel="preconnect" href="https://code.jquery.com" /> <meta name="ncbi_domain" content="ancltransneuro"> <meta name="ncbi_type" content="fulltext"> <meta name="ncbi_pcid" content="journal"> <meta name="ncbi_feature" content="associated_data"> <link rel="canonical" href="https://pmc.ncbi.nlm.nih.gov/articles/PMC4748311/"> <meta name="robots" content="INDEX,NOFOLLOW,NOARCHIVE"> <meta name="citation_journal_title" content="Annals of Clinical and Translational Neurology"> <meta name="citation_title" content="Baseline results of the NeuroNEXT spinal muscular atrophy infant biomarker study"> <meta name="citation_author" content="Stephen J Kolb"> <meta name="citation_author_institution" content="Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author_institution" content="Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="Christopher S Coffey"> <meta name="citation_author_institution" content="Department of Biostatistics, NeuroNEXT Data Coordinating Center, University of Iowa, Iowa City, Iowa"> <meta name="citation_author" content="Jon W Yankey"> <meta name="citation_author_institution" content="Department of Biostatistics, NeuroNEXT Data Coordinating Center, University of Iowa, Iowa City, Iowa"> <meta name="citation_author" content="Kristin Krosschell"> <meta name="citation_author_institution" content="Departments of Physical Therapy and Human Movement Sciences and Pediatrics, Northwestern University Feinberg School of Medicine, Chicago, Illinois"> <meta name="citation_author" content="W David Arnold"> <meta name="citation_author_institution" content="Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author_institution" content="Department of Physical Medicine and Rehabilitation, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="Seward B Rutkove"> <meta name="citation_author_institution" content="Department of Neurology, Beth Israel Deaconess Medical Center, Boston, Massachusetts"> <meta name="citation_author" content="Kathryn J Swoboda"> <meta name="citation_author_institution" content="Departments of Neurology and Pediatrics, University of Utah, Salt Lake City, Utah"> <meta name="citation_author_institution" content="Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts"> <meta name="citation_author" content="Sandra P Reyna"> <meta name="citation_author_institution" content="Departments of Neurology and Pediatrics, University of Utah, Salt Lake City, Utah"> <meta name="citation_author_institution" content="Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts"> <meta name="citation_author" content="Ai Sakonju"> <meta name="citation_author_institution" content="Departments of Neurology and Pediatrics, University of Utah, Salt Lake City, Utah"> <meta name="citation_author" content="Basil T Darras"> <meta name="citation_author_institution" content="Department of Neurology, Boston Children's Hospital, Boston, Massachusetts"> <meta name="citation_author" content="Richard Shell"> <meta name="citation_author_institution" content="Nationwide Children's Hospital, Columbus, Ohio"> <meta name="citation_author" content="Nancy Kuntz"> <meta name="citation_author_institution" content="Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Illinois"> <meta name="citation_author" content="Diana Castro"> <meta name="citation_author_institution" content="UT Southwestern Medical Center, Dallas, Texas"> <meta name="citation_author" content="Susan T Iannaccone"> <meta name="citation_author_institution" content="UT Southwestern Medical Center, Dallas, Texas"> <meta name="citation_author" content="Julie Parsons"> <meta name="citation_author_institution" content="Children's Hospital Colorado, University of Colorado School of Medicine, Aurora, Colorado"> <meta name="citation_author" content="Anne M Connolly"> <meta name="citation_author_institution" content="Washington University School of Medicine in St. Louis, St. Louis, Missouri"> <meta name="citation_author" content="Claudia A Chiriboga"> <meta name="citation_author_institution" content="Department of Neurology, Columbia College of Physicians and Surgeons, New York, New York"> <meta name="citation_author" content="Craig McDonald"> <meta name="citation_author_institution" content="University of California – Davis, Davis, California"> <meta name="citation_author" content="W Bryan Burnette"> <meta name="citation_author_institution" content="Vanderbilt University, Nashville, Tennessee"> <meta name="citation_author" content="Klaus Werner"> <meta name="citation_author_institution" content="SUNY Upstate Medical Center, Syracuse, New York"> <meta name="citation_author" content="Mathula Thangarajh"> <meta name="citation_author_institution" content="Children's National Medical Center, Washington, District of Columbia"> <meta name="citation_author" content="Perry B Shieh"> <meta name="citation_author_institution" content="University of California – Los Angeles, Los Angeles, California"> <meta name="citation_author" content="Erika Finanger"> <meta name="citation_author_institution" content="Dorenbecher Children's Hospital, Portland, Oregon"> <meta name="citation_author" content="Merit E Cudkowicz"> <meta name="citation_author_institution" content="Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts"> <meta name="citation_author" content="Michelle M McGovern"> <meta name="citation_author_institution" content="Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts"> <meta name="citation_author" content="D Elizabeth McNeil"> <meta name="citation_author_institution" content="National Institute of Neurological Disorders and Stroke, Bethesda, Maryland"> <meta name="citation_author" content="Richard Finkel"> <meta name="citation_author_institution" content="Nemours Children's Hospital, Orlando, Florida"> <meta name="citation_author" content="Edward Kaye"> <meta name="citation_author_institution" content="Sarepta Therapeutics, Cambridge, Massachusetts"> <meta name="citation_author" content="Allison Kingsley"> <meta name="citation_author_institution" content="Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="Samantha R Renusch"> <meta name="citation_author_institution" content="Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="Vicki L McGovern"> <meta name="citation_author_institution" content="Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="Xueqian Wang"> <meta name="citation_author_institution" content="Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="Phillip G Zaworski"> <meta name="citation_author_institution" content="PharmOptima, Portage, Michigan"> <meta name="citation_author" content="Thomas W Prior"> <meta name="citation_author_institution" content="Department of Molecular Pathology, Ohio State Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="Arthur HM Burghes"> <meta name="citation_author_institution" content="Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="Amy Bartlett"> <meta name="citation_author_institution" content="Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="John T Kissel"> <meta name="citation_author_institution" content="Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio"> <meta name="citation_author" content="the NeuroNEXT Clinical Trial Network and on behalf of the NN101 SMA Biomarker Investigators"> <meta name="citation_publication_date" content="2016 Jan 21"> <meta name="citation_volume" content="3"> <meta name="citation_issue" content="2"> <meta name="citation_firstpage" content="132"> <meta name="citation_doi" content="10.1002/acn3.283"> <meta name="citation_pmid" content="26900585"> <meta name="citation_abstract_html_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC4748311/"> <meta name="citation_fulltext_html_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC4748311/"> <meta name="citation_pdf_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC4748311/pdf/ACN3-3-132.pdf"> <meta name="description" content="This study prospectively assessed putative promising biomarkers for use in assessing infants with spinal muscular atrophy (SMA). This prospective, multi‐center natural history study targeted the enrollment of SMA infants and healthy control infants ..."> <meta name="og:title" content="Baseline results of the NeuroNEXT spinal muscular atrophy infant biomarker study"> <meta name="og:type" content="article"> <meta name="og:site_name" content="PubMed Central (PMC)"> <meta name="og:description" content="This study prospectively assessed putative promising biomarkers for use in assessing infants with spinal muscular atrophy (SMA). This prospective, multi‐center natural history study targeted the enrollment of SMA infants and healthy control infants ..."> <meta name="og:url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC4748311/"> <meta name="og:image" content="https://cdn.ncbi.nlm.nih.gov/pmc/cms/images/pmc-card-share.jpg?_=0"> <meta name="twitter:card" content="summary_large_image"> <meta name="twitter:site" content="@ncbi"> </head> <body > <a class="usa-skipnav " href="#main-content"> Skip to main content </a> <section class="usa-banner " aria-label="Official website of the United States government" > <div class="usa-accordion"> <header class="usa-banner__header"> <div class="usa-banner__inner"> <div class="grid-col-auto"> <img aria-hidden="true" class="usa-banner__header-flag" src="/static/img/us_flag.svg" alt="" /> </div> <div class="grid-col-fill tablet:grid-col-auto" aria-hidden="true"> <p class="usa-banner__header-text"> An official website of the United States government </p> <span class="usa-banner__header-action">Here's how you know</span> </div> <button type="button" class="usa-accordion__button usa-banner__button " aria-expanded="false" aria-controls="gov-banner-default" data-testid="storybook-django-banner" > <span class="usa-banner__button-text">Here's how you know</span> </button> </div> </header> <div class="usa-banner__content usa-accordion__content" id="gov-banner-default" hidden> <div class="grid-row grid-gap-lg"> <div class="usa-banner__guidance tablet:grid-col-6"> <img class="usa-banner__icon usa-media-block__img" src="/static/img/icon-dot-gov.svg" alt="" aria-hidden="true" /> <div class="usa-media-block__body"> <p> <strong>Official websites use .gov</strong> <br /> A <strong>.gov</strong> website belongs to an official government organization in the United States. </p> </div> </div> <div class="usa-banner__guidance tablet:grid-col-6"> <img class="usa-banner__icon usa-media-block__img" src="/static/img/icon-https.svg" alt="" aria-hidden="true" /> <div class="usa-media-block__body"> <p> <strong>Secure .gov websites use HTTPS</strong> <br /> A <strong>lock</strong> ( <span class="icon-lock"> <svg xmlns="http://www.w3.org/2000/svg" width="52" height="64" viewBox="0 0 52 64" class="usa-banner__lock-image" role="graphics-symbol" aria-labelledby="banner-lock-description" focusable="false"> <title id="banner-lock-title">Lock</title> <desc id="banner-lock-description"> Locked padlock icon </desc> <path fill="#000000" fill-rule="evenodd" d="M26 0c10.493 0 19 8.507 19 19v9h3a4 4 0 0 1 4 4v28a4 4 0 0 1-4 4H4a4 4 0 0 1-4-4V32a4 4 0 0 1 4-4h3v-9C7 8.507 15.507 0 26 0zm0 8c-5.979 0-10.843 4.77-10.996 10.712L15 19v9h22v-9c0-6.075-4.925-11-11-11z" /> </svg> </span>) or <strong>https://</strong> means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. </p> </div> </div> </div> </div> </div> </section> <div class="usa-overlay"> </div> <header class="usa-header usa-header--extended usa-header--wide" data-testid="header" data-header > <div class="ncbi-header"> <div class="ncbi-header__container"> <a class="ncbi-header__logo-container" href="/"> <img alt=" PMC home page " class="ncbi-header__logo-image" src="/static/img/ncbi-logos/nih-nlm-ncbi--white.svg" /> </a>  <button type="button" class="usa-menu-btn ncbi-header__hamburger-button " aria-label="Show menu" data-testid="navMenuButton" > <svg aria-hidden="true" class="ncbi-hamburger-icon" fill="none" focusable="false" height="21" viewBox="0 0 31 21" width="31" xmlns="http://www.w3.org/2000/svg"> <path clip-rule="evenodd" d="M0.125 20.75H30.875V17.3333H0.125V20.75ZM0.125 12.2083H30.875V8.79167H0.125V12.2083ZM0.125 0.25V3.66667H30.875V0.25H0.125Z" fill="#F1F1F1" fill-rule="evenodd" /> </svg> </button>  <div class="ncbi-header__desktop-buttons">  <button type="button" class="usa-button usa-button--unstyled ncbi-header__desktop-button " aria-expanded="false" aria-controls="search-field-desktop-navigation" aria-label="Show search overlay" data-testid="toggleSearchPanelButton" data-toggle-search-panel-button > <svg class="usa-icon " role="graphics-symbol" aria-hidden="true" > <use xlink:href="/static/img/sprite.svg#search" /> </svg> Search </button>  <div class="ncbi-header__login-dropdown"> <button type="button" class="usa-button usa-button--unstyled ncbi-header__desktop-button ncbi-header__login-dropdown-button " aria-expanded="false" aria-controls="login-dropdown-menu" aria-label="Show login menu" data-testid="toggleLoginMenuDropdown" data-desktop-login-button > <svg class="usa-icon " role="graphics-symbol" aria-hidden="true" > <use xlink:href="/static/img/sprite.svg#person" /> </svg> <span data-login-dropdown-text>Log in</span>  <svg class="usa-icon ncbi-header__login-dropdown-icon ncbi-header__login-dropdown-icon--expand-less ncbi-header__login-dropdown-icon--hidden" role="graphics-symbol" aria-hidden="true" data-login-dropdown-up-arrow> <use xlink:href="/static/img/sprite.svg#expand_less" /> </svg>  <svg class="usa-icon ncbi-header__login-dropdown-icon ncbi-header__login-dropdown-icon--expand-more ncbi-header__login-dropdown-icon--hidden" role="graphics-symbol" aria-hidden="true" data-login-dropdown-down-arrow> <use xlink:href="/static/img/sprite.svg#expand_more" /> </svg> </button>  <ul class="usa-nav__submenu ncbi-header__login-dropdown-menu" id="login-dropdown-menu" data-desktop-login-menu-dropdown hidden> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/myncbi/" class="usa-link " > Dashboard </a> </li> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/myncbi/collections/bibliography/" class="usa-link " > Publications </a> </li> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/account/settings/" class="usa-link " > Account settings </a> </li> <li class="usa-nav__submenu-item"> <button type="button" class="usa-button usa-button--outline ncbi-header__login-dropdown-logout-button " data-testid="desktopLogoutButton" data-desktop-logout-button > Log out </button> </li> </ul> </div> </div> </div> </div>  <div class="ncbi-search-panel ncbi--show-only-at-desktop" data-testid="searchPanel" data-header-search-panel hidden> <div class="ncbi-search-panel__container"> <form action="https://www.ncbi.nlm.nih.gov/search/all/" aria-describedby="search-field-desktop-navigation-help-text" autocomplete="off" class="usa-search usa-search--big ncbi-search-panel__form" data-testid="form" method="GET" role="search"> <label class="usa-sr-only" data-testid="label" for="search-field-desktop-navigation"> Search… </label> <input class="usa-input" data-testid="textInput" id="search-field-desktop-navigation" name="term" placeholder="Search NCBI" type="search" value="" /> <button type="submit" class="usa-button " data-testid="button" > <span class="usa-search__submit-text"> Search NCBI </span> </button> </form> </div> </div> <nav aria-label="Primary navigation" class="usa-nav"> <p class="usa-sr-only" id="primary-navigation-sr-only-title"> Primary site navigation </p>  <button type="button" class="usa-nav__close ncbi-nav__close-button " aria-label="Close navigation menu" data-testid="navCloseButton" > <img src="/static/img/usa-icons/close.svg" alt="Close" /> </button>  <form class="usa-search usa-search--small ncbi--hide-at-desktop margin-top-6" role="search"> <label class="usa-sr-only" for="search-field"> Search </label> <input class="usa-input" id="search-field-mobile-navigation" type="search" placeholder="Search NCBI" name="search" /> <button type="submit" class="usa-button " >  <img src="data:image/svg+xml;base64,PHN2ZyB4bWxucz0iaHR0cDovL3d3dy53My5vcmcvMjAwMC9zdmciIGhlaWdodD0iMjQiIHZpZXdCb3g9IjAgMCAyNCAyNCIgd2lkdGg9IjI0Ij48cGF0aCBkPSJNMCAwaDI0djI0SDB6IiBmaWxsPSJub25lIi8+PHBhdGggZmlsbD0iI2ZmZiIgZD0iTTE1LjUgMTRoLS43OWwtLjI4LS4yN0E2LjQ3MSA2LjQ3MSAwIDAgMCAxNiA5LjUgNi41IDYuNSAwIDEgMCA5LjUgMTZjMS42MSAwIDMuMDktLjU5IDQuMjMtMS41N2wuMjcuMjh2Ljc5bDUgNC45OUwyMC40OSAxOWwtNC45OS01em0tNiAwQzcuMDEgMTQgNSAxMS45OSA1IDkuNVM3LjAxIDUgOS41IDUgMTQgNy4wMSAxNCA5LjUgMTEuOTkgMTQgOS41IDE0eiIvPjwvc3ZnPg==" class="usa-search__submit-icon" alt="Search" /> </button> </form>   <div class="ncbi-nav__mobile-login-menu ncbi--hide-at-desktop" data-mobile-login-menu hidden> <p class="ncbi-nav__mobile-login-menu-status"> Logged in as: <strong class="ncbi-nav__mobile-login-menu-email" data-mobile-login-email-text></strong> </p> <ul class="usa-nav__primary usa-accordion"> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/myncbi/" class="usa-link " > Dashboard </a> </li> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/myncbi/collections/bibliography/" class="usa-link " > Publications </a> </li> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/account/settings/" class="usa-link " > Account settings </a> </li> </ul> </div> <button type="button" class="usa-button ncbi-nav__mobile-login-button ncbi--hide-at-desktop " data-testid="mobileLoginButton" data-mobile-login-button > Log in </button> </nav> </header> <section class="pmc-header pmc-header--basic" aria-label="PMC Header with search box"> <div class="pmc-nav-container"> <div class="pmc-header__bar"> <div class="pmc-header__logo"> <a href="/" title="Home" aria-label="PMC Home"></a> </div> <button type="button" class="usa-button usa-button--unstyled pmc-header__search__button" aria-label="Open search" data-ga-category="search" data-ga-action="PMC" data-ga-label="pmc_search_panel_mobile" > <svg class="usa-icon width-4 height-4 pmc-icon__open" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#search"></use> </svg> <svg class="usa-icon width-4 height-4 pmc-icon__close" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#close"></use> </svg> </button> </div> <div class="pmc-header__search"> <form class="usa-search usa-search--extra usa-search--article-right-column pmc-header__search__form" autocomplete="off" role="search"> <label class="usa-sr-only" for="pmc-search">Search PMC Full-Text Archive</label> <span class="autoComplete_wrapper flex-1"> <input class="usa-input width-full maxw-none" required="required" placeholder="Search PMC Full-Text Archive" id="pmc-search" type="search" name="term" data-autocomplete-url="/search/autocomplete/"/> </span> <button class="usa-button" type="submit" formaction="https://www.ncbi.nlm.nih.gov/pmc/" data-ga-category="search" data-ga-action="PMC" data-ga-label="PMC_search_button" > <span class="usa-search__submit-text">Search in PMC</span> <img src="/static/img/usa-icons-bg/search--white.svg" class="usa-search__submit-icon" alt="Search" /> </button> </form> <ul class="pmc-header__search__menu"> <li> <a class="usa-link" href="https://www.ncbi.nlm.nih.gov/pmc/advanced/" data-ga-action="featured_link" data-ga-label="advanced_search"> Advanced Search </a> </li> <li> <a class="usa-link" href="/journals/" data-ga-action="featured_link" data-ga-label="journal list"> Journal List </a> </li> <li> <a class="usa-link" href="/about/userguide/" data-ga-action="featured_link" data-ga-label="user guide"> User Guide </a> </li> </ul> </div> </div> </section> <div class="usa-section padding-top-0 desktop:padding-top-6 pmc-article-section" data-article-db="pmc" data-article-id="4748311"> <div class="grid-container pmc-actions-bar" aria-label="Actions bar" role="complementary"> <div class="grid-row"> <div class="grid-col-fill display-flex"> <div class="display-flex"> <ul class="usa-list usa-list--unstyled usa-list--horizontal"> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex mob"> <button type="button" class="usa-button pmc-sidenav__container__open usa-button--unstyled width-auto display-flex" aria-label="Open resources" data-extra-class="is-visible-resources" data-ga-category="resources_accordion" data-ga-action="click" data-ga-label="mobile_icon" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#more_vert"></use> </svg> </button> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex mob"> <a href="https://doi.org/10.1002/acn3.283" class="usa-link display-flex" role="button" target="_blank" rel="noreferrer noopener" aria-label="View on publisher site" data-ga-category="actions" data-ga-action="click" data-ga-label="publisher_link_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#launch"></use> </svg> </a> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <a href="pdf/ACN3-3-132.pdf" class="usa-link display-flex" role="button" aria-label="Download PDF" data-ga-category="actions" data-ga-action="click" data-ga-label="pdf_download_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> </a> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <button class="usa-button usa-button--unstyled collections-dialog-trigger collections-button display-flex collections-button-empty" aria-label="Save article in MyNCBI collections." data-ga-category="actions" data-ga-action="click" data-ga-label="collections_button_mobile" data-collections-open-dialog-enabled="false" data-collections-open-dialog-url="https://account.ncbi.nlm.nih.gov/?back_url=https%3A%2F%2Fpmc.ncbi.nlm.nih.gov%2Farticles%2FPMC4748311%2F%23open-collections-dialog" data-in-collections="false" > <svg class="usa-icon width-4 height-4 usa-icon--bookmark-full" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-full.svg#icon"></use> </svg> <svg class="usa-icon width-4 height-4 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-empty.svg#icon"></use> </svg> </button> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <button role="button" class="usa-button usa-button--unstyled citation-dialog-trigger display-flex" aria-label="Open dialog with citation text in different styles" data-ga-category="actions" data-ga-action="open" data-ga-label="cite_mobile" data-all-citations-url="/resources/citations/4748311/" data-citation-style="nlm" data-download-format-link="/resources/citations/4748311/export/" > <svg class="usa-icon width-4 height-4 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#format_quote"></use> </svg> </button> </li> <li class="pmc-permalink display-flex"> <button type="button" class="usa-button usa-button--unstyled display-flex" aria-label="Show article permalink" aria-expanded="false" aria-haspopup="true" data-ga-category="actions" data-ga-action="open" data-ga-label="permalink_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#share"></use> </svg> </button> <div class="pmc-permalink__dropdown" hidden> <div class="pmc-permalink__dropdown__container"> <h2 class="usa-modal__heading margin-top-0 margin-bottom-2">PERMALINK</h2> <div class="pmc-permalink__dropdown__content"> <input type="text" class="usa-input" value="https://pmc.ncbi.nlm.nih.gov/articles/PMC4748311/" aria-label="Article permalink"> <button class="usa-button display-inline-flex pmc-permalink__dropdown__copy__btn margin-right-0" title="Copy article permalink" data-ga-category="save_share" data-ga-action="link" data-ga-label="copy_link"> <svg class="usa-icon" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span class="margin-left-1">Copy</span> </button> </div> </div> </div> </li> </ul> </div> <button type="button" class="usa-button pmc-sidenav__container__open usa-button--unstyled width-auto display-flex" aria-label="Open article navigation" data-extra-class="is-visible-in-page" data-ga-category="actions" data-ga-action="open" data-ga-label="article_nav_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#list"></use> </svg> </button> </div> </div> </div> <div class="grid-container desktop:padding-left-6"> <div id="article-container" class="grid-row grid-gap"> <div class="grid-col-12 desktop:grid-col-8 order-2 pmc-layout__content"> <div class="grid-container padding-left-0 padding-right-0"> <div class="grid-row desktop:margin-left-neg-6"> <div class="grid-col-12"> <div class="pmc-layout__disclaimer" role="complementary" aria-label="Disclaimer note"> As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health.<br/> Learn more: <a class="usa-link" data-ga-category="Link click" data-ga-action="Disclaimer" data-ga-label="New disclaimer box" href="/about/disclaimer/">PMC Disclaimer</a> | <a class="usa-link" data-ga-category="Link click" data-ga-action="PMC Copyright Notice" data-ga-label="New disclaimer box" href="/about/copyright/"> PMC Copyright Notice </a> </div> </div> </div> <div class="grid-row pmc-wm desktop:margin-left-neg-6">  <main id="main-content" class="usa-layout-docs__main usa-layout-docs grid-col-12 pmc-layout pmc-prose padding-0" > <section class="pmc-journal-banner text-center line-height-none" aria-label="Journal banner"><img src="https://cdn.ncbi.nlm.nih.gov/pmc/banners/logo-ancltransneuro.gif" alt="Annals of Clinical and Translational Neurology logo" usemap="#pmc-banner-imagemap" width="500" height="75"><map name="pmc-banner-imagemap"><area alt="Link to Annals of Clinical and Translational Neurology" title="Link to Annals of Clinical and Translational Neurology" shape="default" href="http://onlinelibrary.wiley.com/journal/10.1002/(ISSN)2328-9503" target="_blank" rel="noopener noreferrer"></map></section><article lang="en"><section aria-label="Article citation and metadata"><section class="pmc-layout__citation font-secondary font-xs"><div> <div class="display-inline-block"><button type="button" class="cursor-pointer text-no-underline bg-transparent border-0 padding-0 text-left margin-0 text-normal text-primary" aria-controls="journal_context_menu">Ann Clin Transl Neurol</button></div>. 2016 Jan 21;3(2):132–145. doi: <a href="https://doi.org/10.1002/acn3.283" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">10.1002/acn3.283</a> </div> <nav id="journal_context_menu" hidden="hidden"><ul class="menu-list font-family-ui" role="menu"> <li role="presentation"><a href="https://www.ncbi.nlm.nih.gov/pmc/?term=%22Ann%20Clin%20Transl%20Neurol%22%5Bjour%5D" class="usa-link" role="menuitem">Search in PMC</a></li> <li role="presentation"><a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Ann%20Clin%20Transl%20Neurol%22%5Bjour%5D" lang="en" class="usa-link" role="menuitem">Search in PubMed</a></li> <li role="presentation"><a href="https://www.ncbi.nlm.nih.gov/nlmcatalog?term=%22Ann%20Clin%20Transl%20Neurol%22%5BTitle%20Abbreviation%5D" class="usa-link" role="menuitem">View in NLM Catalog</a></li> <li role="presentation"><a href="?term=%22Ann%20Clin%20Transl%20Neurol%22%5Bjour%5D" class="usa-link" role="menuitem" data-add-to-search="true">Add to search</a></li> </ul></nav></section><section class="front-matter"><div class="ameta p font-secondary font-xs"> <hgroup><h1>Baseline results of the NeuroNEXT spinal muscular atrophy infant biomarker study</h1></hgroup><div class="cg p"> <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kolb%20SJ%22%5BAuthor%5D" class="usa-link" aria-describedby="id1"><span class="name western">Stephen J Kolb</span></a><div hidden="hidden" id="id1"> <h3><span class="name western">Stephen J Kolb</span></h3> <div class="p"> <sup><sup>1</sup></sup>Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p"> <sup><sup>2</sup></sup>Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kolb%20SJ%22%5BAuthor%5D" class="usa-link"><span class="name western">Stephen J Kolb</span></a> </div> </div> <sup>1,</sup><sup>2,</sup><sup>✉</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Coffey%20CS%22%5BAuthor%5D" class="usa-link" aria-describedby="id2"><span class="name western">Christopher S Coffey</span></a><div hidden="hidden" id="id2"> <h3><span class="name western">Christopher S Coffey</span></h3> <div class="p"> <sup><sup>3</sup></sup>Department of Biostatistics, NeuroNEXT Data Coordinating Center, University of Iowa, Iowa City, Iowa</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Coffey%20CS%22%5BAuthor%5D" class="usa-link"><span class="name western">Christopher S Coffey</span></a> </div> </div> <sup>3</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Yankey%20JW%22%5BAuthor%5D" class="usa-link" aria-describedby="id3"><span class="name western">Jon W Yankey</span></a><div hidden="hidden" id="id3"> <h3><span class="name western">Jon W Yankey</span></h3> <div class="p"> <sup><sup>3</sup></sup>Department of Biostatistics, NeuroNEXT Data Coordinating Center, University of Iowa, Iowa City, Iowa</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Yankey%20JW%22%5BAuthor%5D" class="usa-link"><span class="name western">Jon W Yankey</span></a> </div> </div> <sup>3</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Krosschell%20K%22%5BAuthor%5D" class="usa-link" aria-describedby="id4"><span class="name western">Kristin Krosschell</span></a><div hidden="hidden" id="id4"> <h3><span class="name western">Kristin Krosschell</span></h3> <div class="p"> <sup><sup>4</sup></sup>Departments of Physical Therapy and Human Movement Sciences and Pediatrics, Northwestern University Feinberg School of Medicine, Chicago, Illinois</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Krosschell%20K%22%5BAuthor%5D" class="usa-link"><span class="name western">Kristin Krosschell</span></a> </div> </div> <sup>4</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Arnold%20WD%22%5BAuthor%5D" class="usa-link" aria-describedby="id5"><span class="name western">W David Arnold</span></a><div hidden="hidden" id="id5"> <h3><span class="name western">W David Arnold</span></h3> <div class="p"> <sup><sup>1</sup></sup>Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p"> <sup><sup>5</sup></sup>Department of Physical Medicine and Rehabilitation, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Arnold%20WD%22%5BAuthor%5D" class="usa-link"><span class="name western">W David Arnold</span></a> </div> </div> <sup>1,</sup><sup>5</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Rutkove%20SB%22%5BAuthor%5D" class="usa-link" aria-describedby="id6"><span class="name western">Seward B Rutkove</span></a><div hidden="hidden" id="id6"> <h3><span class="name western">Seward B Rutkove</span></h3> <div class="p"> <sup><sup>6</sup></sup>Department of Neurology, Beth Israel Deaconess Medical Center, Boston, Massachusetts</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Rutkove%20SB%22%5BAuthor%5D" class="usa-link"><span class="name western">Seward B Rutkove</span></a> </div> </div> <sup>6</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Swoboda%20KJ%22%5BAuthor%5D" class="usa-link" aria-describedby="id7"><span class="name western">Kathryn J Swoboda</span></a><div hidden="hidden" id="id7"> <h3><span class="name western">Kathryn J Swoboda</span></h3> <div class="p"> <sup><sup>7</sup></sup>Departments of Neurology and Pediatrics, University of Utah, Salt Lake City, Utah</div> <div class="p"> <sup><sup>8</sup></sup>Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Swoboda%20KJ%22%5BAuthor%5D" class="usa-link"><span class="name western">Kathryn J Swoboda</span></a> </div> </div> <sup>7,</sup><sup>8</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Reyna%20SP%22%5BAuthor%5D" class="usa-link" aria-describedby="id8"><span class="name western">Sandra P Reyna</span></a><div hidden="hidden" id="id8"> <h3><span class="name western">Sandra P Reyna</span></h3> <div class="p"> <sup><sup>7</sup></sup>Departments of Neurology and Pediatrics, University of Utah, Salt Lake City, Utah</div> <div class="p"> <sup><sup>8</sup></sup>Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Reyna%20SP%22%5BAuthor%5D" class="usa-link"><span class="name western">Sandra P Reyna</span></a> </div> </div> <sup>7,</sup><sup>8</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Sakonju%20A%22%5BAuthor%5D" class="usa-link" aria-describedby="id9"><span class="name western">Ai Sakonju</span></a><div hidden="hidden" id="id9"> <h3><span class="name western">Ai Sakonju</span></h3> <div class="p"> <sup><sup>7</sup></sup>Departments of Neurology and Pediatrics, University of Utah, Salt Lake City, Utah</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Sakonju%20A%22%5BAuthor%5D" class="usa-link"><span class="name western">Ai Sakonju</span></a> </div> </div> <sup>7</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Darras%20BT%22%5BAuthor%5D" class="usa-link" aria-describedby="id10"><span class="name western">Basil T Darras</span></a><div hidden="hidden" id="id10"> <h3><span class="name western">Basil T Darras</span></h3> <div class="p"> <sup><sup>9</sup></sup>Department of Neurology, Boston Children's Hospital, Boston, Massachusetts</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Darras%20BT%22%5BAuthor%5D" class="usa-link"><span class="name western">Basil T Darras</span></a> </div> </div> <sup>9</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Shell%20R%22%5BAuthor%5D" class="usa-link" aria-describedby="id11"><span class="name western">Richard Shell</span></a><div hidden="hidden" id="id11"> <h3><span class="name western">Richard Shell</span></h3> <div class="p"> <sup><sup>10</sup></sup>Nationwide Children's Hospital, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Shell%20R%22%5BAuthor%5D" class="usa-link"><span class="name western">Richard Shell</span></a> </div> </div> <sup>10</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kuntz%20N%22%5BAuthor%5D" class="usa-link" aria-describedby="id12"><span class="name western">Nancy Kuntz</span></a><div hidden="hidden" id="id12"> <h3><span class="name western">Nancy Kuntz</span></h3> <div class="p"> <sup><sup>11</sup></sup>Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Illinois</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kuntz%20N%22%5BAuthor%5D" class="usa-link"><span class="name western">Nancy Kuntz</span></a> </div> </div> <sup>11</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Castro%20D%22%5BAuthor%5D" class="usa-link" aria-describedby="id13"><span class="name western">Diana Castro</span></a><div hidden="hidden" id="id13"> <h3><span class="name western">Diana Castro</span></h3> <div class="p"> <sup><sup>12</sup></sup>UT Southwestern Medical Center, Dallas, Texas</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Castro%20D%22%5BAuthor%5D" class="usa-link"><span class="name western">Diana Castro</span></a> </div> </div> <sup>12</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Iannaccone%20ST%22%5BAuthor%5D" class="usa-link" aria-describedby="id14"><span class="name western">Susan T Iannaccone</span></a><div hidden="hidden" id="id14"> <h3><span class="name western">Susan T Iannaccone</span></h3> <div class="p"> <sup><sup>12</sup></sup>UT Southwestern Medical Center, Dallas, Texas</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Iannaccone%20ST%22%5BAuthor%5D" class="usa-link"><span class="name western">Susan T Iannaccone</span></a> </div> </div> <sup>12</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Parsons%20J%22%5BAuthor%5D" class="usa-link" aria-describedby="id15"><span class="name western">Julie Parsons</span></a><div hidden="hidden" id="id15"> <h3><span class="name western">Julie Parsons</span></h3> <div class="p"> <sup><sup>13</sup></sup>Children's Hospital Colorado, University of Colorado School of Medicine, Aurora, Colorado</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Parsons%20J%22%5BAuthor%5D" class="usa-link"><span class="name western">Julie Parsons</span></a> </div> </div> <sup>13</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Connolly%20AM%22%5BAuthor%5D" class="usa-link" aria-describedby="id16"><span class="name western">Anne M Connolly</span></a><div hidden="hidden" id="id16"> <h3><span class="name western">Anne M Connolly</span></h3> <div class="p"> <sup><sup>14</sup></sup>Washington University School of Medicine in St. Louis, St. Louis, Missouri</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Connolly%20AM%22%5BAuthor%5D" class="usa-link"><span class="name western">Anne M Connolly</span></a> </div> </div> <sup>14</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Chiriboga%20CA%22%5BAuthor%5D" class="usa-link" aria-describedby="id17"><span class="name western">Claudia A Chiriboga</span></a><div hidden="hidden" id="id17"> <h3><span class="name western">Claudia A Chiriboga</span></h3> <div class="p"> <sup><sup>15</sup></sup>Department of Neurology, Columbia College of Physicians and Surgeons, New York, New York</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Chiriboga%20CA%22%5BAuthor%5D" class="usa-link"><span class="name western">Claudia A Chiriboga</span></a> </div> </div> <sup>15</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22McDonald%20C%22%5BAuthor%5D" class="usa-link" aria-describedby="id18"><span class="name western">Craig McDonald</span></a><div hidden="hidden" id="id18"> <h3><span class="name western">Craig McDonald</span></h3> <div class="p"> <sup><sup>16</sup></sup>University of California – Davis, Davis, California</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22McDonald%20C%22%5BAuthor%5D" class="usa-link"><span class="name western">Craig McDonald</span></a> </div> </div> <sup>16</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Burnette%20WB%22%5BAuthor%5D" class="usa-link" aria-describedby="id19"><span class="name western">W Bryan Burnette</span></a><div hidden="hidden" id="id19"> <h3><span class="name western">W Bryan Burnette</span></h3> <div class="p"> <sup><sup>17</sup></sup>Vanderbilt University, Nashville, Tennessee</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Burnette%20WB%22%5BAuthor%5D" class="usa-link"><span class="name western">W Bryan Burnette</span></a> </div> </div> <sup>17</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Werner%20K%22%5BAuthor%5D" class="usa-link" aria-describedby="id20"><span class="name western">Klaus Werner</span></a><div hidden="hidden" id="id20"> <h3><span class="name western">Klaus Werner</span></h3> <div class="p"> <sup><sup>18</sup></sup>SUNY Upstate Medical Center, Syracuse, New York</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Werner%20K%22%5BAuthor%5D" class="usa-link"><span class="name western">Klaus Werner</span></a> </div> </div> <sup>18</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Thangarajh%20M%22%5BAuthor%5D" class="usa-link" aria-describedby="id21"><span class="name western">Mathula Thangarajh</span></a><div hidden="hidden" id="id21"> <h3><span class="name western">Mathula Thangarajh</span></h3> <div class="p"> <sup><sup>19</sup></sup>Children's National Medical Center, Washington, District of Columbia</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Thangarajh%20M%22%5BAuthor%5D" class="usa-link"><span class="name western">Mathula Thangarajh</span></a> </div> </div> <sup>19</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Shieh%20PB%22%5BAuthor%5D" class="usa-link" aria-describedby="id22"><span class="name western">Perry B Shieh</span></a><div hidden="hidden" id="id22"> <h3><span class="name western">Perry B Shieh</span></h3> <div class="p"> <sup><sup>20</sup></sup>University of California – Los Angeles, Los Angeles, California</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Shieh%20PB%22%5BAuthor%5D" class="usa-link"><span class="name western">Perry B Shieh</span></a> </div> </div> <sup>20</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Finanger%20E%22%5BAuthor%5D" class="usa-link" aria-describedby="id23"><span class="name western">Erika Finanger</span></a><div hidden="hidden" id="id23"> <h3><span class="name western">Erika Finanger</span></h3> <div class="p"> <sup><sup>21</sup></sup>Dorenbecher Children's Hospital, Portland, Oregon</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Finanger%20E%22%5BAuthor%5D" class="usa-link"><span class="name western">Erika Finanger</span></a> </div> </div> <sup>21</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Cudkowicz%20ME%22%5BAuthor%5D" class="usa-link" aria-describedby="id24"><span class="name western">Merit E Cudkowicz</span></a><div hidden="hidden" id="id24"> <h3><span class="name western">Merit E Cudkowicz</span></h3> <div class="p"> <sup><sup>8</sup></sup>Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Cudkowicz%20ME%22%5BAuthor%5D" class="usa-link"><span class="name western">Merit E Cudkowicz</span></a> </div> </div> <sup>8</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22McGovern%20MM%22%5BAuthor%5D" class="usa-link" aria-describedby="id25"><span class="name western">Michelle M McGovern</span></a><div hidden="hidden" id="id25"> <h3><span class="name western">Michelle M McGovern</span></h3> <div class="p"> <sup><sup>8</sup></sup>Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22McGovern%20MM%22%5BAuthor%5D" class="usa-link"><span class="name western">Michelle M McGovern</span></a> </div> </div> <sup>8</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22McNeil%20DE%22%5BAuthor%5D" class="usa-link" aria-describedby="id26"><span class="name western">D Elizabeth McNeil</span></a><div hidden="hidden" id="id26"> <h3><span class="name western">D Elizabeth McNeil</span></h3> <div class="p"> <sup><sup>22</sup></sup>National Institute of Neurological Disorders and Stroke, Bethesda, Maryland</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22McNeil%20DE%22%5BAuthor%5D" class="usa-link"><span class="name western">D Elizabeth McNeil</span></a> </div> </div> <sup>22</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Finkel%20R%22%5BAuthor%5D" class="usa-link" aria-describedby="id27"><span class="name western">Richard Finkel</span></a><div hidden="hidden" id="id27"> <h3><span class="name western">Richard Finkel</span></h3> <div class="p"> <sup><sup>23</sup></sup>Nemours Children's Hospital, Orlando, Florida</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Finkel%20R%22%5BAuthor%5D" class="usa-link"><span class="name western">Richard Finkel</span></a> </div> </div> <sup>23</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kaye%20E%22%5BAuthor%5D" class="usa-link" aria-describedby="id28"><span class="name western">Edward Kaye</span></a><div hidden="hidden" id="id28"> <h3><span class="name western">Edward Kaye</span></h3> <div class="p"> <sup><sup>24</sup></sup>Sarepta Therapeutics, Cambridge, Massachusetts</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kaye%20E%22%5BAuthor%5D" class="usa-link"><span class="name western">Edward Kaye</span></a> </div> </div> <sup>24</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kingsley%20A%22%5BAuthor%5D" class="usa-link" aria-describedby="id29"><span class="name western">Allison Kingsley</span></a><div hidden="hidden" id="id29"> <h3><span class="name western">Allison Kingsley</span></h3> <div class="p"> <sup><sup>1</sup></sup>Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kingsley%20A%22%5BAuthor%5D" class="usa-link"><span class="name western">Allison Kingsley</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Renusch%20SR%22%5BAuthor%5D" class="usa-link" aria-describedby="id30"><span class="name western">Samantha R Renusch</span></a><div hidden="hidden" id="id30"> <h3><span class="name western">Samantha R Renusch</span></h3> <div class="p"> <sup><sup>2</sup></sup>Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Renusch%20SR%22%5BAuthor%5D" class="usa-link"><span class="name western">Samantha R Renusch</span></a> </div> </div> <sup>2</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22McGovern%20VL%22%5BAuthor%5D" class="usa-link" aria-describedby="id31"><span class="name western">Vicki L McGovern</span></a><div hidden="hidden" id="id31"> <h3><span class="name western">Vicki L McGovern</span></h3> <div class="p"> <sup><sup>2</sup></sup>Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22McGovern%20VL%22%5BAuthor%5D" class="usa-link"><span class="name western">Vicki L McGovern</span></a> </div> </div> <sup>2</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Wang%20X%22%5BAuthor%5D" class="usa-link" aria-describedby="id32"><span class="name western">Xueqian Wang</span></a><div hidden="hidden" id="id32"> <h3><span class="name western">Xueqian Wang</span></h3> <div class="p"> <sup><sup>2</sup></sup>Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Wang%20X%22%5BAuthor%5D" class="usa-link"><span class="name western">Xueqian Wang</span></a> </div> </div> <sup>2</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Zaworski%20PG%22%5BAuthor%5D" class="usa-link" aria-describedby="id33"><span class="name western">Phillip G Zaworski</span></a><div hidden="hidden" id="id33"> <h3><span class="name western">Phillip G Zaworski</span></h3> <div class="p"> <sup><sup>25</sup></sup>PharmOptima, Portage, Michigan</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Zaworski%20PG%22%5BAuthor%5D" class="usa-link"><span class="name western">Phillip G Zaworski</span></a> </div> </div> <sup>25</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Prior%20TW%22%5BAuthor%5D" class="usa-link" aria-describedby="id34"><span class="name western">Thomas W Prior</span></a><div hidden="hidden" id="id34"> <h3><span class="name western">Thomas W Prior</span></h3> <div class="p"> <sup><sup>26</sup></sup>Department of Molecular Pathology, Ohio State Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Prior%20TW%22%5BAuthor%5D" class="usa-link"><span class="name western">Thomas W Prior</span></a> </div> </div> <sup>26</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Burghes%20AHM%22%5BAuthor%5D" class="usa-link" aria-describedby="id35"><span class="name western">Arthur HM Burghes</span></a><div hidden="hidden" id="id35"> <h3><span class="name western">Arthur HM Burghes</span></h3> <div class="p"> <sup><sup>2</sup></sup>Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Burghes%20AHM%22%5BAuthor%5D" class="usa-link"><span class="name western">Arthur HM Burghes</span></a> </div> </div> <sup>2</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Bartlett%20A%22%5BAuthor%5D" class="usa-link" aria-describedby="id36"><span class="name western">Amy Bartlett</span></a><div hidden="hidden" id="id36"> <h3><span class="name western">Amy Bartlett</span></h3> <div class="p"> <sup><sup>1</sup></sup>Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Bartlett%20A%22%5BAuthor%5D" class="usa-link"><span class="name western">Amy Bartlett</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kissel%20JT%22%5BAuthor%5D" class="usa-link" aria-describedby="id37"><span class="name western">John T Kissel</span></a><div hidden="hidden" id="id37"> <h3><span class="name western">John T Kissel</span></h3> <div class="p"> <sup><sup>1</sup></sup>Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Kissel%20JT%22%5BAuthor%5D" class="usa-link"><span class="name western">John T Kissel</span></a> </div> </div> <sup>1</sup>; <span class="collab">the NeuroNEXT Clinical Trial Network and on behalf of the NN101 SMA Biomarker Investigators</span> </div> <ul class="d-buttons inline-list"> <li><button class="d-button" aria-controls="aip_a" aria-expanded="false">Author information</button></li> <li><button class="d-button" aria-controls="anp_a" aria-expanded="false">Article notes</button></li> <li><button class="d-button" aria-controls="clp_a" aria-expanded="false">Copyright and License information</button></li> </ul> <div class="d-panels font-secondary-light"> <div id="aip_a" class="d-panel p" style="display: none"> <div class="p" id="acn3283-aff-0001"> <sup><sup>1</sup></sup>Department of Neurology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div id="acn3283-aff-0002"> <sup><sup>2</sup></sup>Department of Biological Chemistry & Pharmacology, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div id="acn3283-aff-0003"> <sup><sup>3</sup></sup>Department of Biostatistics, NeuroNEXT Data Coordinating Center, University of Iowa, Iowa City, Iowa</div> <div id="acn3283-aff-0004"> <sup><sup>4</sup></sup>Departments of Physical Therapy and Human Movement Sciences and Pediatrics, Northwestern University Feinberg School of Medicine, Chicago, Illinois</div> <div id="acn3283-aff-0005"> <sup><sup>5</sup></sup>Department of Physical Medicine and Rehabilitation, The Ohio State University Wexner Medical Center, Columbus, Ohio</div> <div id="acn3283-aff-0006"> <sup><sup>6</sup></sup>Department of Neurology, Beth Israel Deaconess Medical Center, Boston, Massachusetts</div> <div id="acn3283-aff-0007"> <sup><sup>7</sup></sup>Departments of Neurology and Pediatrics, University of Utah, Salt Lake City, Utah</div> <div id="acn3283-aff-0008"> <sup><sup>8</sup></sup>Department of Neurology, NeuroNEXT Clinical Coordinating Center, Massachusetts General Hospital, Boston, Massachusetts</div> <div id="acn3283-aff-0009"> <sup><sup>9</sup></sup>Department of Neurology, Boston Children's Hospital, Boston, Massachusetts</div> <div id="acn3283-aff-0010"> <sup><sup>10</sup></sup>Nationwide Children's Hospital, Columbus, Ohio</div> <div id="acn3283-aff-0011"> <sup><sup>11</sup></sup>Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Illinois</div> <div id="acn3283-aff-0012"> <sup><sup>12</sup></sup>UT Southwestern Medical Center, Dallas, Texas</div> <div id="acn3283-aff-0013"> <sup><sup>13</sup></sup>Children's Hospital Colorado, University of Colorado School of Medicine, Aurora, Colorado</div> <div id="acn3283-aff-0014"> <sup><sup>14</sup></sup>Washington University School of Medicine in St. Louis, St. Louis, Missouri</div> <div id="acn3283-aff-0015"> <sup><sup>15</sup></sup>Department of Neurology, Columbia College of Physicians and Surgeons, New York, New York</div> <div id="acn3283-aff-0016"> <sup><sup>16</sup></sup>University of California – Davis, Davis, California</div> <div id="acn3283-aff-0017"> <sup><sup>17</sup></sup>Vanderbilt University, Nashville, Tennessee</div> <div id="acn3283-aff-0018"> <sup><sup>18</sup></sup>SUNY Upstate Medical Center, Syracuse, New York</div> <div id="acn3283-aff-0019"> <sup><sup>19</sup></sup>Children's National Medical Center, Washington, District of Columbia</div> <div id="acn3283-aff-0020"> <sup><sup>20</sup></sup>University of California – Los Angeles, Los Angeles, California</div> <div id="acn3283-aff-0021"> <sup><sup>21</sup></sup>Dorenbecher Children's Hospital, Portland, Oregon</div> <div id="acn3283-aff-0022"> <sup><sup>22</sup></sup>National Institute of Neurological Disorders and Stroke, Bethesda, Maryland</div> <div id="acn3283-aff-0023"> <sup><sup>23</sup></sup>Nemours Children's Hospital, Orlando, Florida</div> <div id="acn3283-aff-0024"> <sup><sup>24</sup></sup>Sarepta Therapeutics, Cambridge, Massachusetts</div> <div id="acn3283-aff-0025"> <sup><sup>25</sup></sup>PharmOptima, Portage, Michigan</div> <div id="acn3283-aff-0026"> <sup><sup>26</sup></sup>Department of Molecular Pathology, Ohio State Wexner Medical Center, Columbus, Ohio</div> <div class="author-notes p"> <div class="fn" id="correspondenceTo"> <sup>*</sup><p class="display-inline"><strong>Correspondence</strong>, Stephen J. Kolb, Departments of Neurology and Biological Chemistry & Pharmacology, Wexner Medical Center at The Ohio State University, Hamilton Hall, Room 337B, 1645 Neil Avenue, Columbus, OH 43210‐1228. Tel: +1 614 292 3545; Fax: +1 614 292 4118; E‐mail: <span>stephen.kolb@osumc.edu</span></p> </div> <div class="fn" id="_fncrsp93pmc__"> <sup>✉</sup><p class="display-inline">Corresponding author.</p> </div> </div> </div> <div id="anp_a" class="d-panel p" style="display: none"><div class="notes p"><section id="historyarticle-meta1" class="history"><p>Received 2015 Nov 23; Revised 2015 Oct 30; Accepted 2015 Dec 10; Collection date 2016 Feb.</p></section></div></div> <div id="clp_a" class="d-panel p" style="display: none"> <div>© 2016 The Authors. <em>Annals of Clinical and Translational Neurology</em> published by Wiley Periodicals, Inc on behalf of American Neurological Association.</div> <p>This is an open access article under the terms of the <a href="http://creativecommons.org/licenses/by-nc-nd/4.0/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Creative Commons Attribution‐NonCommercial‐NoDerivs</a> License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.</p> <div class="p"><a href="/about/copyright/" class="usa-link">PMC Copyright notice</a></div> </div> </div> <div>PMCID: PMC4748311 PMID: <a href="https://pubmed.ncbi.nlm.nih.gov/26900585/" class="usa-link">26900585</a> </div> </div></section></section><section aria-label="Article content"><section class="body main-article-body"><section class="abstract" id="acn3283-abs-0001"><h2>Abstract</h2> <section id="acn3283-sec-0001"><h3 class="pmc_sec_title">Objective</h3> <p>This study prospectively assessed putative promising biomarkers for use in assessing infants with spinal muscular atrophy (SMA).</p></section><section id="acn3283-sec-0002"><h3 class="pmc_sec_title">Methods</h3> <p>This prospective, multi‐center natural history study targeted the enrollment of SMA infants and healthy control infants less than 6 months of age. Recruitment occurred at 14 centers within the NINDS National Network for Excellence in Neuroscience Clinical Trials (NeuroNEXT) Network. Infant motor function scales and putative electrophysiological, protein and molecular biomarkers were assessed at baseline and subsequent visits.</p></section><section id="acn3283-sec-0003"><h3 class="pmc_sec_title">Results</h3> <p>Enrollment began November, 2012 and ended September, 2014 with 26 SMA infants and 27 healthy infants enrolled. Baseline demographic characteristics of the SMA and control infant cohorts aligned well. Motor function as assessed by the Test for Infant Motor Performance Items (TIMPSI) and the Children's Hospital of Philadelphia Infant Test of Neuromuscular Disorders (CHOP‐INTEND) revealed significant differences between the SMA and control infants at baseline. Ulnar compound muscle action potential amplitude (CMAP) in SMA infants (1.4 ± 2.2 mV) was significantly reduced compared to controls (5.5 ± 2.0 mV). Electrical impedance myography (EIM) high‐frequency reactance slope (Ohms/MHz) was significantly higher in SMA infants than controls SMA infants had lower survival motor neuron (SMN) mRNA levels in blood than controls, and several serum protein analytes were altered between cohorts.</p></section><section id="acn3283-sec-0004"><h3 class="pmc_sec_title">Interpretation</h3> <p>By the time infants were recruited and presented for the baseline visit, SMA infants had reduced motor function compared to controls. Ulnar CMAP, EIM, blood SMN mRNA levels, and serum protein analytes were able to distinguish between cohorts at the enrollment visit.</p></section></section><section id="acn3283-sec-0005"><h2 class="pmc_sec_title">Introduction</h2> <p>Spinal muscular atrophy (SMA) is the leading genetic cause of death in infants, exhibits a wide range of clinical severity and has an incidence of one in 11,000 live births.<a href="#acn3283-bib-0001" class="usa-link" aria-describedby="acn3283-bib-0001">1</a>, <a href="#acn3283-bib-0002" class="usa-link" aria-describedby="acn3283-bib-0002">2</a> SMA is caused by homozygous deletion or mutation in the <em>SMN1</em> (<em>survival motor neuron 1</em>) gene and retention of the nearly identical gene, <em>SMN2</em> (<em>survival motor neuron 2</em>), which results in reduced expression of full‐length SMN protein.<a href="#acn3283-bib-0003" class="usa-link" aria-describedby="acn3283-bib-0003">3</a>, <a href="#acn3283-bib-0004" class="usa-link" aria-describedby="acn3283-bib-0004">4</a> In humans, <em>SMN2</em> is present in the same genomic region and differs from <em>SMN1</em> by a single‐nucleotide substitution that results in the exclusion of exon 7 in approximately 90% of SMN transcripts.<a href="#acn3283-bib-0005" class="usa-link" aria-describedby="acn3283-bib-0005">5</a>, <a href="#acn3283-bib-0006" class="usa-link" aria-describedby="acn3283-bib-0006">6</a> The mRNA that results, SMNΔ7, produces a truncated protein that is nonfunctional and targeted for degradation.<a href="#acn3283-bib-0007" class="usa-link" aria-describedby="acn3283-bib-0007">7</a>, <a href="#acn3283-bib-0008" class="usa-link" aria-describedby="acn3283-bib-0008">8</a> </p> <p>Clinically, SMA is characterized by skeletal muscle weakness and, in a substantial majority of severely affected individuals, respiratory insufficiency and premature death. Disease severity spans a wide range of phenotypes divided into five categories based upon maximal motor function: type 0, (neonates who present with severe hypotonia often with history of decreased fetal movements), type 1 (never sit independently), type 2 (sit but never stand independently), type 3 (ambulatory children), and type 4 (ambulatory adults).<a href="#acn3283-bib-0009" class="usa-link" aria-describedby="acn3283-bib-0009">9</a>, <a href="#acn3283-bib-0010" class="usa-link" aria-describedby="acn3283-bib-0010">10</a> <em>SMN2</em> copy number correlates inversely with clinical severity in humans and motor function and survival in murine models.<a href="#acn3283-bib-0011" class="usa-link" aria-describedby="acn3283-bib-0011">11</a>, <a href="#acn3283-bib-0012" class="usa-link" aria-describedby="acn3283-bib-0012">12</a>, <a href="#acn3283-bib-0013" class="usa-link" aria-describedby="acn3283-bib-0013">13</a>, <a href="#acn3283-bib-0014" class="usa-link" aria-describedby="acn3283-bib-0014">14</a> Thus, <em>SMN2</em> copy number is a prognostic biomarker that predicts future clinical outcome.</p> <p>Clinical studies designed to increase the expression of the SMN protein are underway in infants with SMA (ClinicalTrials.gov: <a href="https://ncbi.nlm.nih.gov/nucleotide/NCT02193074" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">NCT02193074</a>, <a href="https://ncbi.nlm.nih.gov/nucleotide/NCT02292537" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">NCT02292537</a>, <a href="https://ncbi.nlm.nih.gov/nucleotide/NCT02386553" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">NCT02386553</a>, <a href="https://ncbi.nlm.nih.gov/nucleotide/NCT02122952" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">NCT02122952</a>, <a href="https://ncbi.nlm.nih.gov/nucleotide/NCT02462759" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">NCT02462759</a>, and <a href="https://ncbi.nlm.nih.gov/nucleotide/NCT02268552" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">NCT02268552</a>).<a href="#acn3283-bib-0015" class="usa-link" aria-describedby="acn3283-bib-0015">15</a>, <a href="#acn3283-bib-0016" class="usa-link" aria-describedby="acn3283-bib-0016">16</a> Natural history studies in the SMA type 1 population demonstrated shortened lifespan, with 68% mortality within the first 2 years of life.<a href="#acn3283-bib-0009" class="usa-link" aria-describedby="acn3283-bib-0009">9</a>, <a href="#acn3283-bib-0010" class="usa-link" aria-describedby="acn3283-bib-0010">10</a> With the advent of standardized care guidelines,<a href="#acn3283-bib-0017" class="usa-link" aria-describedby="acn3283-bib-0017">17</a> the mortality of SMA type 1 infants has been reduced at 2 years of age to 30%, with nearly half of these infants dependent upon noninvasive ventilation.<a href="#acn3283-bib-0018" class="usa-link" aria-describedby="acn3283-bib-0018">18</a> In a recent observational study, SMA infants who developed symptoms prior to 6 months of age demonstrated very poor motor function and significant motor loss electrophysiologically at the enrollment visit.<a href="#acn3283-bib-0019" class="usa-link" aria-describedby="acn3283-bib-0019">19</a> Thus, there is heightened need to identify and validate physiological and molecular biomarkers in the SMA type 1 population and to obtain longitudinal outcome measures for use in future SMA infant clinical trials.</p> <p>We sought to determine the feasibility and reliability of testing specific putative physiological and molecular SMA biomarkers in infants with SMA and in age‐matched healthy control infants. We performed a systematic, multi‐center, longitudinal natural history study in SMA infants designed to mimic a hypothetical phase 3 interventional clinical trial. Our goals were: 1) to determine the natural history of motor function during the first 2 years of life in infants with SMA and in healthy infants, 2) to determine the natural history of putative electrophysiological and molecular biomarkers in infants with SMA and healthy infants 3) to determine the relationship between putative electrophysiological and molecular biomarkers to motor function in infants with SMA and healthy infants.</p></section><section id="acn3283-sec-0006"><h2 class="pmc_sec_title">Subjects and Methods</h2> <p>This study was performed and supported by the National Network for Excellence in Neuroscience Clinical Trials (NeuroNEXT) Clinical Trial Network and originated from The Ohio State University Wexner Medical Center. The NeuroNEXT infrastructure consists of 25 clinical centers geographically distributed across the United States, a Central Coordinating Center at Massachusetts General Hospital and a central Data Coordinating Center at University of Iowa (Table S1). Fifteen sites (Table <a href="#acn3283-tbl-0001" class="usa-link">1</a>) began enrollment in November 2012. Guardians of all subjects provided written, informed consent approved by the NeuroNEXT central institutional review board<a href="#acn3283-bib-0020" class="usa-link" aria-describedby="acn3283-bib-0020">20</a> at the enrolling sites.</p> <section class="tw xbox font-sm" id="acn3283-tbl-0001" lang="en"><h3 class="obj_head">Table 1.</h3> <div class="caption p"><p>Baseline characteristics of SMA and healthy control infant cohorts</p></div> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <thead valign="top"><tr style="border-bottom:solid 1px #000000"> <th align="left" valign="top" rowspan="1" colspan="1"></th> <th align="center" valign="top" rowspan="1" colspan="1">SMA (<em>N</em> = 26)</th> <th align="center" valign="top" rowspan="1" colspan="1">Control (<em>N</em> = 27)</th> </tr></thead> <tbody> <tr> <td align="left" rowspan="1" colspan="1">Demographics</td> <td align="center" rowspan="1" colspan="1"> <em>N</em> (%)</td> <td align="center" rowspan="1" colspan="1"> <em>N</em> (%)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">Females</td> <td align="center" rowspan="1" colspan="1">15 (58)</td> <td align="center" rowspan="1" colspan="1">14 (52)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">White race</td> <td align="center" rowspan="1" colspan="1">24 (92)</td> <td align="center" rowspan="1" colspan="1">24 (89)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">Hispanic</td> <td align="center" rowspan="1" colspan="1">6 (23)</td> <td align="center" rowspan="1" colspan="1">3 (11)</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"></td> <td align="center" rowspan="1" colspan="1">Mean (SD)</td> <td align="center" rowspan="1" colspan="1">Mean (SD)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">Age at enrollment (months)</td> <td align="center" rowspan="1" colspan="1">3.7 (1.7)</td> <td align="center" rowspan="1" colspan="1">3.3 (2.0)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">Baseline visit weight (lbs)</td> <td align="center" rowspan="1" colspan="1">13.4 (2.2)</td> <td align="center" rowspan="1" colspan="1">13.4 (3.3)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">Gestational age (weeks)</td> <td align="center" rowspan="1" colspan="1">38.8 (1.5)</td> <td align="center" rowspan="1" colspan="1">39.0 (1.4)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">Birth weight (lbs)</td> <td align="center" rowspan="1" colspan="1">7.2 (1.2)</td> <td align="center" rowspan="1" colspan="1">7.0 (1.4)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">Birth length (inches)</td> <td align="center" rowspan="1" colspan="1">20.1 (1.2)</td> <td align="center" rowspan="1" colspan="1">20.0 (1.0)</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <em>SMN2</em> copy number</td> <td align="center" rowspan="1" colspan="1"> <em>N</em> (%)</td> <td align="center" rowspan="1" colspan="1"> <em>N</em> (%)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">1</td> <td align="center" rowspan="1" colspan="1">0</td> <td align="center" rowspan="1" colspan="1">12 (44)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">2</td> <td align="center" rowspan="1" colspan="1">16 (64)</td> <td align="center" rowspan="1" colspan="1">13 (48)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">3</td> <td align="center" rowspan="1" colspan="1">5 (19)</td> <td align="center" rowspan="1" colspan="1">1 (4)</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">4</td> <td align="center" rowspan="1" colspan="1">1 (4)</td> <td align="center" rowspan="1" colspan="1">0</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">Unknown</td> <td align="center" rowspan="1" colspan="1">4 (15)</td> <td align="center" rowspan="1" colspan="1">1 (4)</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <em>SMN2</em> gene modifier c.859G>C</td> <td align="center" rowspan="1" colspan="1">0</td> <td align="center" rowspan="1" colspan="1">0</td> </tr> </tbody> </table></div> <div class="p text-right font-secondary"><a href="table/acn3283-tbl-0001/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></section><section id="acn3283-sec-0007"><h3 class="pmc_sec_title">Study design</h3> <p>This was a prospective, longitudinal natural history study of infants with genetically confirmed SMA and healthy control infants. Enrollment was restricted to infants who were 6 months of age or younger and were born between 36 and 42 weeks of gestation. The study was designed to mimic the inclusion and timing of future SMA clinical trials targeting treatment to SMA infants. Therefore, the diagnosis of SMA was made by study investigators or community neurologists and confirmed with clinical genetic testing prior to enrollment. Asymptomatic subjects who had been genetically tested prior to the enrollment were permitted. Subjects were excluded if they required noninvasive ventilatory support (i.e., BiPAP) for more than 12 hours/day, had a comorbid illness or were enrolled in an SMA therapeutic clinical trial. SMA infants taking any therapies thought to increase SMN expression, such as valproic acid, were excluded from the study. The absence of an <em>SMN1</em> gene deletion/mutation was confirmed for each healthy control infant.</p> <p>The baseline study visit occurred prior to the age of 6 months and as young as possible, following either genetic confirmation of SMA (with or without clinical symptoms at time of enrollment) or identification as a suitable normal control subject. Thereafter, study visits were scheduled to occur according to age at 3 (if applicable), 6, 9, 12, 18, and 24 months. In this report, we present the baseline visit results. Twenty‐seven healthy infants were enrolled within 12 months; 26 infants with SMA were enrolled concurrently over 22 months. Confirmation of the <em>SMN1</em> exon 7 deletion and <em>SMN2</em> copy number were performed as previously described.<a href="#acn3283-bib-0021" class="usa-link" aria-describedby="acn3283-bib-0021">21</a> In addition, DNA from SMA subjects was screened for the <em>SMN2</em> gene positive modifier mutation c.859G>C.<a href="#acn3283-bib-0022" class="usa-link" aria-describedby="acn3283-bib-0022">22</a> </p> <p>The order of study procedures was strictly adhered to at all fifteen enrolling sites to minimize site‐to‐site and visit‐to‐visit variability. Subjects were asked to present to the visit in morning, fully rested. Funds were available for family travel and accommodations near the study site to reduce the confounder of travel time and time of day. After a medical history and a brief general examination, infant motor function testing was performed, followed by electrical impedance myography (EIM) testing, followed by ulnar compound muscle action potential (CMAP) testing, followed by a single peripheral blood draw.</p></section><section id="acn3283-sec-0008"><h3 class="pmc_sec_title">Motor function testing</h3> <p>Infant motor function was assessed by certified physical therapists who were required to pass reliability training and testing prior to enrollment. All subjects were evaluated using the Test of Infant Motor Performance Screening Items (TIMPSI), a 29‐item, 99 point scale evaluation of infant motor function that has been shown to be valid and reliable in infants with SMA type 1.<a href="#acn3283-bib-0023" class="usa-link" aria-describedby="acn3283-bib-0023">23</a> After testing, all subjects were required to have a 20‐minute rest period that could include nursing/feeding. Subjects who scored less than 41 on the TIMSPI were then evaluated using The Children's Hospital of Philadelphia Infant Test for Neuromuscular Disorders (CHOP‐INTEND) which is a validated 16‐item, 64‐point scale shown to be reliable in SMA type 1 subjects.<a href="#acn3283-bib-0019" class="usa-link" aria-describedby="acn3283-bib-0019">19</a>, <a href="#acn3283-bib-0024" class="usa-link" aria-describedby="acn3283-bib-0024">24</a> Subjects scoring 41 or greater on the TIMPSI were evaluated using the Alberta Infant Motor Scale (AIMS), a 58‐item observational scale developed to assess motor development in children from birth until independent walking.<a href="#acn3283-bib-0025" class="usa-link" aria-describedby="acn3283-bib-0025">25</a>, <a href="#acn3283-bib-0026" class="usa-link" aria-describedby="acn3283-bib-0026">26</a> </p></section><section id="acn3283-sec-0009"><h3 class="pmc_sec_title">Compound muscle action potential (CMAP)</h3> <p>Ulnar CMAP measurements were obtained from the abductor digiti minimi (ADM) muscle by trained electromyographers using standardized electrode placement on the basis of anatomical landmarks. The low‐frequency and high‐frequency filter settings were set to 10 Hz and 10 kHz, respectively. Skin temperature was maintained at >33°C. Two adhesive strip electrodes (Carefusion Disposable Ring Electrode with Leads, order number 019‐439300), trimmed to the width of each subject's ADM muscle, were used for recording. The G1 recording electrode was placed on the ADM muscle at 1/3 of the distance measured from the pisiform bone to the fifth metacarpophalangeal joint with the length of the electrode‐oriented orthogonal to the direction of the muscle fibers. The G2 reference electrode was placed on the ulnar aspect of the fifth metacarpophalangeal joint. An adhesive ground electrode (Carefusion Tab Electrodes 1.0 meter leads, order number 019‐406600) was placed on the dorsum of the hand. The ulnar nerve was supramaximally stimulated either at the wrist or just proximal to the ulnar groove at the elbow using pediatric sized bipolar probe. Square‐wave stimulations of 0.2 msec duration and gradually increasing intensity were delivered to reach 120% of the intensity required to elicit a maximal CMAP response. Maximum values for negative peak (NP) amplitude and NP area were recorded.</p></section><section id="acn3283-sec-0010"><h3 class="pmc_sec_title">Electrical impedance myography (EIM)</h3> <p>Measurements were obtained following the motor function tests using a multi‐frequency (1000 Hz–10 MHz) impedance system (Skulpt Inc. EIM1103, San Francisco, CA). As this study was the first time EIM had been performed in infants, a novel probe was designed specifically for use in this population. Muscle groups were tested in a specific order as follows: right biceps, right wrist extensors, right quadriceps, right tibialis anterior, left biceps, left wrist extensors, left quadriceps, and left tibialis anterior muscles. Measurements were performed three times on each muscle before moving on to the next and the two closest sets of data averaged. All data were transferred in a blinded fashion to a central database. Predetermined EIM metrics based on data obtained in older healthy and SMA‐affected children<a href="#acn3283-bib-0027" class="usa-link" aria-describedby="acn3283-bib-0027">27</a> were derived from the full set of impedance data and transferred to the DCC for analysis.</p></section><section id="acn3283-sec-0011"><h3 class="pmc_sec_title">Blood processing</h3> <p>A single peripheral blood draw was then obtained as the last study procedure by an experienced pediatric phlebotomist. Given the challenge and small blood volume of infants, a strict order of blood samples was adhered to: 2 cc blood into a PAXgene tube for SMN mRNA determination, 8 cc blood into a CPT tube for plasma, and PBMC isolation followed by a 2 cc into a purple top for DNA extraction. The CPT tube was processed at each site as previously described<a href="#acn3283-bib-0028" class="usa-link" aria-describedby="acn3283-bib-0028">28</a> and PBMCs resuspended in freezing medium consisting of 10% DMSO in FBS prior to shipment to the central processing laboratory (Kolb Lab).</p></section><section id="acn3283-sec-0012"><h3 class="pmc_sec_title">SMN mRNA quantification</h3> <p>Total mRNA was isolated from the PAXgene tube as previously described.<a href="#acn3283-bib-0028" class="usa-link" aria-describedby="acn3283-bib-0028">28</a> mRNA was converted to cDNA using random hexamer primers and AMV‐RT (7041Z, Affymetrix) according to the manufacture's direction. SMN mRNA analysis was performed using Droplet Digital PCR (ddPCR) (Bio‐Rad Laboratories, Hercules, CA). The following primers were used for detection of full‐length SMN expression: hSMN_FL_Ex7_FP: 5′ CAAAAAGAAGGAAGGTGCTCA, hSMN_FL_Ex8_RP: 5′ TCCAGATCTGTCTGATCGTTTC, hSMN_FL_Ex7/8 probe: 5′ FAM‐TTAAGGAGAAATGCTGGCATAGAGCAGCAC‐MGB. SMN expression was normalized to HPRT expression using the PrimePCR<sup>™</sup> ddPCR<sup>™</sup> Expression Probe Assay for intron‐spanning human HPRT1 with HEX assay (dHsaCPE5192872, Bio‐Rad). Mulitplex reactions were performed with 2–5 <em>μ</em>L of cDNA as required to obtain a sufficient number of positive droplets. Template, primers (900 nM final), probes (250 nM final), and 2 × ddPCR Supermix in 20 <em>μ</em>L final volume were converted into droplets with the QX200 droplet generator (Bio‐Rad Laboratories) and PCR was run on a classic MJ thermal cycler under standard conditions: 95°C for 10 minutes followed by 40 cycles of 94°C for 30 seconds, 60°C for 1 minute, and a final step of 98°C for 10 minutes. After PCR, droplet counts were measured on the QX200 droplet digital reader (Bio‐Rad Laboratories). Concentration of sample was determined by fitting droplet counts to the Poisson distribution using QuantaSoft software (Bio‐Rad Laboratories). SMN mRNA expression per sample was normalized by dividing the SMN concentration by the HPRT concentration and plotted as Relative Fluorescent Units (RFU).</p></section><section id="acn3283-sec-0013"><h3 class="pmc_sec_title">SMN protein levels</h3> <p>For the SMN protein measurements, peripheral blood was drawn into a cell preparation tube and peripheral blood mononuclear cells (PBMCs) were isolated as previously described.<a href="#acn3283-bib-0029" class="usa-link" aria-describedby="acn3283-bib-0029">29</a> PBMCs were cryopreserved at each study site and then shipped to the central laboratory (Kolb Lab) where they were stored at −80°C. Once all baseline samples were collected, SMN protein was measured at PharmOptima (Portage, MI) using the company's proprietary electrochemiluminescence immunoassay based on the Meso Scale Discovery technology. The assay is a quantitative sandwich immunoassay, where a mouse monoclonal antibody (2B1<a href="#acn3283-bib-0030" class="usa-link" aria-describedby="acn3283-bib-0030">30</a>) functions as the capture antibody and a rabbit polyclonal anti‐SMN antibody (Protein Tech, Cat. No. 11708‐1‐AP) labeled with a SULFO‐TAG<sup>™</sup> is used for detection. SMN levels are determined from a standard curve using recombinant SMN protein (Enzo Life Sciences, Cat. No. ADI‐NBP‐201‐050). The dynamic range of the assay is 10 pg/mL to 10,000 pg/mL. PBMC samples were received by PharmOptima, frozen and were maintained at −80°C until thawed for enumeration. Samples were thawed quickly in a 37°C water bath in batches of eight samples per thawing and enumeration event in order to avoid prolonged incubation prior to cell lysis. Samples were diluted 10‐fold into PBS prior to enumeration via direct hemocytometric counting. Finally, cells were lysed at a density of 1 X 10<sup>7</sup> cells/mL. Lysates were maintained at −80°C until the time of assay.</p></section><section id="acn3283-sec-0014"><h3 class="pmc_sec_title">SMA‐MAP quantification</h3> <p>Plasma samples were isolated for the CPT tubes, frozen immediately and stored at −80°C in cryovials. Frozen samples were sent to a central processing laboratory at Myriad and processed to quantify 25 plasma protein analytes that have been identified as putative serum SMA biomarkers.<a href="#acn3283-bib-0031" class="usa-link" aria-describedby="acn3283-bib-0031">31</a>, <a href="#acn3283-bib-0032" class="usa-link" aria-describedby="acn3283-bib-0032">32</a> All samples were stored at −80°C until tested. The samples were thawed at room temperature, vortexed, spun at 4000 RPM for 5 minutes for clarification and volume was removed for MAP analysis into a master microtiter plate. Using automated pipetting, an aliquot of each sample was introduced into one of the capture microsphere multiplexes of the Multi Analyte Profile. The mixture of sample and capture microspheres were thoroughly mixed and incubated at room temperature for 1 hour. Multiplexed cocktails of biotinylated, reporter antibodies for each multiplex were then added robotically and after thorough mixing, were incubated for an additional hour at room temperature. Multiplexes were developed using an excess of streptavidin‐phycoerythrin solution that was thoroughly mixed into each multiplex and incubated for 1 hour at room temperature. The volume of each multiplexed reaction was reduced by vacuum filtration and the volume increased by dilution into matrix buffer for analysis. Analysis was performed in a Luminex 100 instrument and the resulting data stream was interpreted using proprietary data analysis software developed at Rules‐Based Medicine. For each multiplex, both calibrators and controls were included on each microtiter plate. Eight‐point calibrators were run in the first and last column of each plate and 3‐level controls were included in duplicate. Testing results were determined first for the high‐, medium‐, and low controls for each multiplex to ensure proper assay performance. Unknown values for each of the analytes localized in a specific multiplex were determined using 4 and 5 parameter, weighted‐ and nonweighted‐curve fitting algorithms included in the data analysis package.</p></section><section id="acn3283-sec-0015"><h3 class="pmc_sec_title">Statistical analysis</h3> <p>Continuous variables were summarized by means, standard deviation, minimum, and maximum values. Categorical variables were summarized by percentages. Comparisons of continuous variables between the SMA and healthy control cohorts were performed using two sample t‐tests. Comparisons of categorical variables between the two cohorts were performed using chi‐square tests. All statistical tests were two‐sided and used a significance level of 0.05. No adjustments for multiple comparisons were made.</p> <p>Pearson's correlation coefficients between subject's age at enrollment and all continuous outcomes were estimated separately for each cohort. Similarly, the correlations between motor function tests (TIMPSI and CHOP‐INTEND) and biomarkers (CMAP, EIM, SMN mRNA, and SMA‐MAP) were estimated separately for each cohort. Additional analyses restricted to the subgroup of SMA subjects with two copies of the <em>SMN2</em> gene were also performed. All analyses were performed using SAS<sup>®</sup> version 9.3 or later.</p></section></section><section id="acn3283-sec-0016"><h2 class="pmc_sec_title">Results</h2> <section id="acn3283-sec-0017"><h3 class="pmc_sec_title">Baseline demographics</h3> <p>The first site was activated and enrollment began in November 2012. All fifteen sites had passed certification for MFTs and CMAP and were activated by February 2013. Enrollment of 27 healthy infants was completed in October 2013 and enrollment of 26 SMA infants was completed in September 2014. The baseline visit was defined as the enrollment visit. Every infant was less than 6 months of age at the initial visit. The SMA and healthy infant cohorts aligned well on baseline demographic characteristics (Table <a href="#acn3283-tbl-0001" class="usa-link">1</a>). The average age of enrollment for the SMA and healthy cohorts was 3.7 months (SD = 1.7) and 3.3 months (SD = 2.0), respectively; 57.7% of the SMA infants and 51.9% of the healthy infants were female. Birth weight and height were nearly identical in the two cohorts. In the SMA cohort, 15 infants were found to have two copies of <em>SMN2</em> gene, five had three copies and a single infant had four copies. <em>SMN2</em> copy number was not determined in five SMA infants because of a failure to obtain sufficient blood sample for DNA testing on the baseline or subsequent visits. No infants in the SMA cohort for whom DNA was tested had the <em>SMN2</em> c.859G>C mutation. In the healthy cohort, we confirmed that no infant had a homozygous deletion or mutation in the <em>SMN1</em> gene. There were four healthy control infants who were carriers with one copy of <em>SMN1</em> gene and all of these infants had siblings with the diagnosis of SMA. Three control infants had three copies of the <em>SMN1</em> gene.</p> <p>The month of onset of symptoms was obtained from the parent or guardian during the baseline visit (Table <a href="#acn3283-tbl-0002" class="usa-link">2</a>). The majority of SMA infants (9) had symptom onset in the second month of life. There were six infants with symptom onset prior to 1 month of age and all of these infants had two copies of <em>SMN2</em>. All but one SMA infant for whom this data were collected had symptom onset prior to the 3 months of age. This data was not recorded in six SMA infants. When asked if the infants had feeding or swallowing problems at the time of the baseline visit, ten (38.5%) of parents or guardians responded, yes.</p> <section class="tw xbox font-sm" id="acn3283-tbl-0002" lang="en"><h4 class="obj_head">Table 2.</h4> <div class="caption p"><p>Age of symptom onset for SMA subjects</p></div> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <thead valign="top"><tr style="border-bottom:solid 1px #000000"> <th align="left" valign="top" rowspan="1" colspan="1"></th> <th align="center" valign="top" rowspan="1" colspan="1">< 1 month</th> <th align="center" valign="top" rowspan="1" colspan="1">1–2 months</th> <th align="center" valign="top" rowspan="1" colspan="1">2–3 months</th> <th align="center" valign="top" rowspan="1" colspan="1">4–5 months</th> <th align="center" valign="top" rowspan="1" colspan="1">Not recorded</th> <th align="center" valign="top" rowspan="1" colspan="1">Total</th> </tr></thead> <tbody> <tr> <td align="left" rowspan="1" colspan="1">SMA</td> <td align="center" rowspan="1" colspan="1">6</td> <td align="center" rowspan="1" colspan="1">9</td> <td align="center" rowspan="1" colspan="1">4</td> <td align="center" rowspan="1" colspan="1">1</td> <td align="center" rowspan="1" colspan="1">6</td> <td align="center" rowspan="1" colspan="1">26</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">SMA, <em>SMN2</em> = 2</td> <td align="center" rowspan="1" colspan="1">6</td> <td align="center" rowspan="1" colspan="1">5</td> <td align="center" rowspan="1" colspan="1">3</td> <td align="center" rowspan="1" colspan="1">1</td> <td align="center" rowspan="1" colspan="1">1</td> <td align="center" rowspan="1" colspan="1">16</td> </tr> </tbody> </table></div> <div class="p text-right font-secondary"><a href="table/acn3283-tbl-0002/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></section></section><section id="acn3283-sec-0018"><h3 class="pmc_sec_title">Motor function</h3> <p>All motor function values are plotted against age at time of assessment in Figure <a href="#acn3283-fig-0001" class="usa-link">1</a>. Motor function was measured using the TIMPSI for all infants. The average TIMPSI score for the SMA cohort, 34.9 (SD = 20.9, <em>n</em> = 26, range = 14–94), was significantly lower than in the healthy cohort, 66.1 (SD = 22.6, <em>n</em> = 27, range = 15–96, <em>P</em> < 0.01). SMA infants with two <em>SMN2</em> copies had an average TIMPSI score of 27.2 (SD = 8.0, <em>n</em> = 16, range = 15–49), and there was no correlation with age (Table S2). Moreover, at enrollment no SMA infant with two copies of <em>SMN2</em> had a TIMPSI greater than 51. In the healthy control cohort, TIMPSI score had a positive correlation with age (<em>r</em> = 0.80, <em>P</em> < 0.0001). There was no difference noted in control infants with one, two, or three copies of the <em>SMN1</em> gene. All healthy control infants older than 10 weeks of age had TIMPSI scores above 51.</p> <figure class="fig xbox font-sm" id="acn3283-fig-0001" lang="en"><h4 class="obj_head">Figure 1.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><img class="graphic" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/0dcb/4748311/c0af2972bc7c/ACN3-3-132-g001.jpg" loading="lazy" id="nlm-graphic-1" height="932" width="709" alt="Figure 1"></p> <div class="p text-right font-secondary"><a href="figure/acn3283-fig-0001/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>Motor function assessments in SMA and healthy infants in the first 6 months of life. (A) Motor function testing paradigm. All infants were tested using the TIMPSI. After the TIMPSI, a mandatory rest period of 20 minutes was followed by either the CHOP‐INTEND or AIMS assessment. Infants who scored less than 41 on the TIMPSI were tested using the CHOP‐INTEND, otherwise the infant was tested using the AIMS test. (B) Results of infant motor function tests for all infants as a function of the age at the time of enrollment visit. For the SMA cohort, the <em>SMN2</em> copy number for each infant is indicated by the color as indicated in the key by each graph. For the healthy cohort the <em>SMN1</em> copy number for each infant is indicated by the color as indicated in the key by each graph.</p></figcaption></figure><p>The CHOP‐INTEND was utilized to measure motor function in infants scoring less than 41 on the TIMPSI after the TIMSPI and a mandatory 20‐minute rest period. As a result, a total of 23 SMA infants and 14 control infants were assessed using the CHOP‐INTEND. All 16 SMA infants with two copies of <em>SMN2</em> were assessed using the CHOP‐INTEND. The average CHOP‐INTEND score for the SMA cohort, 21.4 (SD = 9.6, <em>n</em> = 23, range = 10–52) was significantly lower than the control cohort, 50.1 (SD = 10.2, <em>n</em> = 14, ranged 32–62, <em>P</em> < 0.01). The average CHOP‐INTEND score for SMA infants with two copies of <em>SMN2</em> was 20.2 (SD = 7.4, <em>n</em> = 16, range = 10–33) and the maximum score in this subgroup was 33. There was no correlation between CHOP‐INTEND scores and age in the SMA or control cohorts. There was excellent correlation between the CHOP‐INTEND and TIMPSI scores for SMA (<em>r</em> = 0.866, <em>n</em> = 22, <em>P</em> < 0.0001) and control cohorts (<em>r</em> = 0.839, <em>n</em> = 9, <em>P</em> = 0.005).</p> <p>The AIMS was assessed in infants scoring 41 or higher on the TIMPSI following the mandatory 20‐minute rest period. Consequently, only three SMA infants and 13 control infants were assessed using the AIMS. No SMA infants with two copies of <em>SMN2</em> received the AIMS. The average AIMS score for the SMA cohort (8.7, SD = 3.5) was lower than the control cohort (13.8, SD = 4.5). There was a positive correlation between AIMS scores and age in the control cohort (<em>r</em> = 0.650, <em>n</em> = 13, <em>P</em> = 0.02).</p></section><section id="acn3283-sec-0019"><h3 class="pmc_sec_title">Baseline putative physiologic biomarkers</h3> <p>Ulnar CMAP recordings were well tolerated. However, the CMAP for one SMA infant was not obtained. The peak amplitude (mV) for each subject is plotted against age at assessment in Figure <a href="#acn3283-fig-0002" class="usa-link">2</a>. The average CMAP peak amplitude for the SMA cohort, 1.4 mV (SD = 2.2, <em>n</em> = 25) was significantly lower than the control cohort, 5.5 mV (SD = 2.0, <em>n</em> = 27, <em>P</em> < 0.01). The average CMAP peak amplitude for SMA infants with two copies of <em>SMN2</em> was 0.5 mV (SD = 1.0, <em>n</em> = 15). The CMAP values obtained in the control infants did not correlate with the motor function ability as measured by the TIMPSI (<em>r</em> = 0.006, <em>n</em> = 27, <em>P</em> = 0.9773) and the CHOP‐INTEND (<em>r</em> = 0.4105, <em>n</em> = 14, <em>P</em> = 0.2725). The CMAP values obtained in the SMA infants had a positive correlation with motor function ability as measured by the TIMPSI (<em>r</em> = 0.785, <em>n</em> = 25, <em>P</em> < 0.0001) and the CHOP‐INTEND (<em>r</em> = 0.556, <em>n</em> = 21, <em>P</em> = 0.0088). Interestingly, in the subgroup of SMA infants with two copies of <em>SMN2</em> there is no correlation with TIMPSI (<em>r</em> = 0.276, <em>n</em> = 15, <em>P</em> = 0.320) or CHOP‐INTEND (<em>r</em> = 0.283, <em>n</em> = 15, <em>P</em> = 306). The results for the ulnar CMAP area were also analyzed and comparisons between groups and correlations were consistent with the results for ulnar CMAP amplitude.</p> <figure class="fig xbox font-sm" id="acn3283-fig-0002" lang="en"><h4 class="obj_head">Figure 2.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><img class="graphic" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/0dcb/4748311/3a032e5590d9/ACN3-3-132-g002.jpg" loading="lazy" id="nlm-graphic-3" height="299" width="709" alt="Figure 2"></p> <div class="p text-right font-secondary"><a href="figure/acn3283-fig-0002/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>Ulnar compound muscle action potential is significantly reduced in SMA infants compared to healthy infants. Ulnar CMAP peak amplitude (mV) in SMA and healthy control infants as a function of the age at the time of enrollment visit. For the SMA cohort, the <em>SMN2</em> copy number for each infant is indicated by the color as indicated in the key by each graph. For the healthy cohort, the <em>SMN1</em> copy number for each infant is indicated by the color as indicated in the key by each graph.</p></figcaption></figure><p>Electrical impedance measurements were well tolerated. The test was not performed in two control infants at baseline. Predetermined EIM outcomes were analyzed based upon prior studies using EIM in older children with SMA.<a href="#acn3283-bib-0027" class="usa-link" aria-describedby="acn3283-bib-0027">27</a> Baseline EIM outcomes are presented in Table <a href="#acn3283-tbl-0003" class="usa-link">3</a>. EIM outcomes were analyzed using 1) the average value of all muscles tested, 2) the average value of the proximal muscles tested (right and left biceps and quadriceps), or 3) the average value of the distal muscles tested (right and left wrist extensors and tibialis anterior muscles). Of the outcomes measured, high‐frequency reactance slope (units) distinguished between SMA and control cohorts regardless of how the muscles were grouped for analysis (Table <a href="#acn3283-tbl-0003" class="usa-link">3</a>).</p> <section class="tw xbox font-sm" id="acn3283-tbl-0003" lang="en"><h4 class="obj_head">Table 3.</h4> <div class="caption p"><p>Baseline electrical impedance myography results in SMA and healthy control infants</p></div> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <thead valign="top"><tr style="border-bottom:solid 1px #000000"> <th align="left" valign="top" rowspan="1" colspan="1"></th> <th align="center" valign="top" rowspan="1" colspan="1">SMA <em>N</em> = 26</th> <th align="center" valign="top" rowspan="1" colspan="1">SMA: 2 <em>SMN2</em> copy subgroup (<em>N</em> = 16)</th> <th align="center" valign="top" rowspan="1" colspan="1">Control <em>N</em> = 25</th> <th align="center" valign="top" rowspan="1" colspan="1"> <em>P</em> value<br> SMA vs Control </th> <th align="center" valign="top" rowspan="1" colspan="1"> <em>P</em> value<br> <em>SMN2</em> = 2 vs Control </th> </tr></thead> <tbody> <tr><td align="left" colspan="6" rowspan="1">All muscles grouped</td></tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Phase (SD)</td> <td align="center" rowspan="1" colspan="1">5.62 (2.54)</td> <td align="center" rowspan="1" colspan="1">5.39 (1.67)</td> <td align="center" rowspan="1" colspan="1">6.21 (1.64)</td> <td align="center" rowspan="1" colspan="1">0.3317</td> <td align="center" rowspan="1" colspan="1">0.1314</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Resistance (SD)</td> <td align="center" rowspan="1" colspan="1">104.8 (21.09)</td> <td align="center" rowspan="1" colspan="1">108.0 (23.83)</td> <td align="center" rowspan="1" colspan="1">99.11 (21.13)</td> <td align="center" rowspan="1" colspan="1">0.3367</td> <td align="center" rowspan="1" colspan="1">0.2190</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Reactance (SD)</td> <td align="center" rowspan="1" colspan="1">16.48 (27.83)</td> <td align="center" rowspan="1" colspan="1">10.81 (4.91)</td> <td align="center" rowspan="1" colspan="1">10.90 (3.72)</td> <td align="center" rowspan="1" colspan="1">0.3204</td> <td align="center" rowspan="1" colspan="1">0.9493</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">HF phase slope (SD)</td> <td align="center" rowspan="1" colspan="1">13.76 (7.87)</td> <td align="center" rowspan="1" colspan="1">15.53 (2.96)</td> <td align="center" rowspan="1" colspan="1">13.33 (3.90)</td> <td align="center" rowspan="1" colspan="1">0.8073</td> <td align="center" rowspan="1" colspan="1">0.0616</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1"> <strong>HF reactance slope (SD)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>12.65 (4.39)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>12.53 (4.50)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>7.99 (3.82)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0002</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0013</strong> </td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1"> <strong>LF reactance slope (SD)</strong> </td> <td align="center" rowspan="1" colspan="1">−96.1 (2501)</td> <td align="center" rowspan="1" colspan="1"> <strong>426.1 (170.4)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>336.2 (113.2)</strong> </td> <td align="center" rowspan="1" colspan="1">0.3870</td> <td align="center" rowspan="1" colspan="1"> <strong>0.0487</strong> </td> </tr> <tr><td align="left" colspan="6" rowspan="1">Distal muscles grouped</td></tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Phase (SD)</td> <td align="center" rowspan="1" colspan="1">5.04 (2.35)</td> <td align="center" rowspan="1" colspan="1">4.84 (1.69)</td> <td align="center" rowspan="1" colspan="1">5.7 (1.89)</td> <td align="center" rowspan="1" colspan="1">0.2724</td> <td align="center" rowspan="1" colspan="1">0.1452</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Resistance (SD)</td> <td align="center" rowspan="1" colspan="1">100.9 (19.93)</td> <td align="center" rowspan="1" colspan="1">103.9 (21.95)</td> <td align="center" rowspan="1" colspan="1">98.84 (33.77)</td> <td align="center" rowspan="1" colspan="1">0.7926</td> <td align="center" rowspan="1" colspan="1">0.5961</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Reactance (SD)</td> <td align="center" rowspan="1" colspan="1">17.23 (40.54)</td> <td align="center" rowspan="1" colspan="1">9.35 (4.17)</td> <td align="center" rowspan="1" colspan="1">9.58 (3.59)</td> <td align="center" rowspan="1" colspan="1">0.3457</td> <td align="center" rowspan="1" colspan="1">0.8636</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1"> <strong>HF phase slope (SD)</strong> </td> <td align="center" rowspan="1" colspan="1">15.16 (5.95)</td> <td align="center" rowspan="1" colspan="1"> <strong>16.32 (2.80)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>13.12 (6.11)</strong> </td> <td align="center" rowspan="1" colspan="1">0.2315</td> <td align="center" rowspan="1" colspan="1"> <strong>0.0292</strong> </td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1"> <strong>HF reactance slope (SD)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>14.10 (4.75)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>14.03 (5.16)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>9.04 (4.22)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0002</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0017</strong> </td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">LF reactance slope (SD)</td> <td align="center" rowspan="1" colspan="1">181 (2963)</td> <td align="center" rowspan="1" colspan="1">426.6 (253.4)</td> <td align="center" rowspan="1" colspan="1">317.2 (171.9)</td> <td align="center" rowspan="1" colspan="1">0.4006</td> <td align="center" rowspan="1" colspan="1">0.1069</td> </tr> <tr><td align="left" colspan="6" rowspan="1">Proximal muscles grouped</td></tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Phase (SD)</td> <td align="center" rowspan="1" colspan="1">6.19 (2.96)</td> <td align="center" rowspan="1" colspan="1">5.94 (1.78)</td> <td align="center" rowspan="1" colspan="1">6.72 (1.62)</td> <td align="center" rowspan="1" colspan="1">0.4309</td> <td align="center" rowspan="1" colspan="1">0.1580</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Resistance (SD)</td> <td align="center" rowspan="1" colspan="1">109.0 (23.18)</td> <td align="center" rowspan="1" colspan="1">112.0 (26.90)</td> <td align="center" rowspan="1" colspan="1">99.33 (19.80)</td> <td align="center" rowspan="1" colspan="1">0.1151</td> <td align="center" rowspan="1" colspan="1">0.0895</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">50k Reactance (SD)</td> <td align="center" rowspan="1" colspan="1">13.20 (7.86)</td> <td align="center" rowspan="1" colspan="1">12.25 (5.81)</td> <td align="center" rowspan="1" colspan="1">12.21 (4.01)</td> <td align="center" rowspan="1" colspan="1">0.5725</td> <td align="center" rowspan="1" colspan="1">0.9805</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">HF phase slope (SD)</td> <td align="center" rowspan="1" colspan="1">12.35 (10.18)</td> <td align="center" rowspan="1" colspan="1">14.75 (3.50)</td> <td align="center" rowspan="1" colspan="1">13.54 (3.55)</td> <td align="center" rowspan="1" colspan="1">0.5767</td> <td align="center" rowspan="1" colspan="1">0.2941</td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1"> <strong>HF reactance slope (SD)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>11.14 (4.86)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>11.00 (4.79)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>6.70 (4.37)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0016</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0065</strong> </td> </tr> <tr> <td align="left" style="padding-left:10%" rowspan="1" colspan="1">LF reactance slope (SD)</td> <td align="center" rowspan="1" colspan="1">78.95 (1591)</td> <td align="center" rowspan="1" colspan="1">425.7 (162.4)</td> <td align="center" rowspan="1" colspan="1">354.7 (131.5)</td> <td align="center" rowspan="1" colspan="1">0.3869</td> <td align="center" rowspan="1" colspan="1">0.1317</td> </tr> </tbody> </table></div> <div class="p text-right font-secondary"><a href="table/acn3283-tbl-0003/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <div class="tw-foot p"><div class="fn" id="acn3283-note-0002"><p>Bold rows highlight outcomes where <em>P</em> value is equal to or less than 0.05.</p></div></div></section><p>Correlations of EIM outcomes from all muscles grouped with age, TIMPSI and CHOP‐INTEND are tabulated in Table S2. In the control cohort, EIM outcomes 50k Phase, Resistance and Reactance and high‐frequency reactance slope had a positive correlation with age (Table S2). Similarly, in the control cohort there were many correlations between the TIMPSI motor function score and EIM outcomes. TIMPSI scores in the control infants had positive correlations with 50 kHz Phase (<em>r</em> = 0.4968, <em>n</em> = 25, <em>P</em> = 0.0115), Resistance (<em>r</em> = 0.4769, <em>n</em> = 25, <em>P</em> = 0.0159) and Reactance (<em>r</em> = 0.6506, <em>n</em> = 25, <em>P</em> = 0.0004). TIMPSI scores in the control infants had negative correlations with high‐frequency reactance slope (<em>r</em> = −0.4892, <em>n</em> = 25, <em>P</em> = 0.0131). Interestingly, there was no correlation between EIM outcomes and CHOP‐INTEND scores in control infants.</p> <p>In the SMA cohort, there was a strong positive correlation between 50k Resistance and age (<em>r</em> = 0.7649, <em>n</em> = 26, <em>P</em> < 0.0001). This correlation also was seen in the subgroup of SMA infants with two copies of <em>SMN2</em> (<em>r</em> = 0.7484, <em>n</em> = 16, <em>P</em> = 0.0009). There were no correlations between TIMPSI or CHOP‐INTEND and any of the EIM outcomes studied for the SMA cohorts (Table S2).</p></section><section id="acn3283-sec-0020"><h3 class="pmc_sec_title">Baseline putative molecular biomarkers</h3> <p>Peripheral blood draws were tolerated although in some cases an insufficient amount of blood was drawn for all analyses. The SMN mRNA level, expressed as the ratio of SMN to HPRT transcripts, for each subject is plotted against age at assessment in Figure <a href="#acn3283-fig-0003" class="usa-link">3</a>A. The average, baseline SMN/HPRT ratio in the SMA cohort, was 0.50 (SD = 0.14, <em>n</em> = 19) and was significantly lower than the SMN/HPRT ratio of control cohort, 1.27 (SD = 0.44, <em>n</em> = 19, <em>P</em> < 0.0001). The average SMN/HPRT ratio for SMA infants with two copies of <em>SMN2</em> was 0.47 (SD = 0.13, <em>n</em> = 12) and was also significantly lower than the control cohort (<em>P</em> < 0.0001). There was no correlation in either cohort between age and SMN mRNA level (Table S2). In the control cohort, there was no correlation between the TIMPSI score and SMN mRNA levels (<em>r</em> = 0.244, <em>n</em> = 19, <em>P</em> = 0.315). In the subgroup of control infants who were assessed using the CHOP‐INTEND (these infants scored < 41 on the TIMPSI), there was a positive correlation between CHOP‐INTEND score and SMN mRNA level (<em>r</em> = 0.856, <em>n</em> = 7, <em>P</em> = 0.014). In the SMA cohort, there were no correlations between the TIMPSI or CHOP‐INTEND with SMN mRNA levels (Table S2)</p> <figure class="fig xbox font-sm" id="acn3283-fig-0003" lang="en"><h4 class="obj_head">Figure 3.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><img class="graphic" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/0dcb/4748311/572859fc1e41/ACN3-3-132-g003.jpg" loading="lazy" id="nlm-graphic-5" height="700" width="709" alt="Figure 3"></p> <div class="p text-right font-secondary"><a href="figure/acn3283-fig-0003/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>Peripheral blood SMN mRNA and protein levels in SMA and healthy control infants. (A) Full‐length SMN mRNA levels from whole blood measured using ddPCR expressed as a ratio of SMN to HPRT. (B) SMN protein levels detected in PBMCs measured by SMN‐ECL ELISA expressed as pg/10<sup>7</sup> cells. For the SMA cohort, the <em>SMN2</em> copy number for each infant is indicated by the color as indicated in the key by each graph. For the healthy cohort, the <em>SMN1</em> copy number for each infant is indicated by the color as indicated in the key by each graph.</p></figcaption></figure><p>The SMN protein levels were measured from PBMC samples. During the PBMC enumeration process involving direct microscopic examination, many samples were found to have significant numbers of platelets in the samples, in two samples platelets were found to be in a numerical excess of 10‐fold to the PBMCs. Therefore, an additional low‐speed (200 x g) centrifugation step was added resulting in a more purified PBMC sample. In three baseline PBMC samples, there were too few cells to count. The yield of the remaining samples ranged from 1 x 10<sup>5</sup> to 3 x 10<sup>7</sup> PBMCs. The SMN protein level for each subject is plotted against age of assessment in Figure <a href="#acn3283-fig-0003" class="usa-link">3</a>B. The average, baseline SMN protein level in the SMA cohort (6601.7 pg/10<sup>7</sup> PBMCs, SD = 3592.8, <em>n</em> = 18) and was not significantly lower than the baseline SMN protein level of control cohort (8967.8 pg/10<sup>7</sup> PBMCs, SD = 5441.3, <em>n</em> = 21, <em>P</em> = 0.1212). In contrast, the average baseline SMN protein level for SMA infants with two copies of <em>SMN2</em> (5367.4 pg/10<sup>7</sup> PBMCs, SD = 3603.5, <em>n</em> = 12) was lower than the control cohort (<em>P</em> = 0.0484). There was no correlation in the control cohort between age and SMN protein level (Table S2). However, there was a negative correlation between age and SMN protein levels in the SMA cohort (<em>r</em> = −0.632, <em>n</em> = 18, <em>P</em> = 0.0049). In the control cohort, there was no correlation between the TIMPSI score and SMN protein level (<em>r</em> = −0.101, <em>n</em> = 21, <em>P</em> = 0.664) or between the CHOP‐INTEND and SMN protein level (<em>r</em> = −0.245, <em>n</em> = 8, <em>P</em> = 0.559). In the SMA cohort, there were also no correlations between the TIMPSI or CHOP‐INTEND with SMN protein levels (Table S2).</p> <p>The concentration of 25 plasma protein analytes were determined from 18 SMA infants and 20 control infants at the baseline visit. The average baseline plasma analyte concentrations are tabulated in Table <a href="#acn3283-tbl-0004" class="usa-link">4</a>. When compared to the control cohort, the SMA cohort had lower concentrations of cadherin‐13 (<em>P</em> = 0.0277), cartilage oligomeric matrix protein (<em>P</em> = 0.0011), Insulin‐like growth factor binding protein 6 (<em>P</em> = 0.0135), peptidase D (<em>P</em> = 0.0236) and tetranectin (<em>P</em> = 0.0493). When compared to the control cohort, the SMA cohort had higher concentrations of myoglobin (<em>P</em> = 0.0220) and YKL‐40 (0.0288). Comparisons between the control group and the SMA infants with two copies of <em>SMN2</em> improved the significance of the differences between groups for all analytes except for myoglobin (Table <a href="#acn3283-tbl-0004" class="usa-link">4</a>). In addition, significant differences were found between the control group and the subgroup of SMA infants with two copies of <em>SMN2</em> for complement component C1q receptor (<em>P</em> = 0.0227) and dipeptidyl peptidase IV (<em>P</em> = 0.0260).</p> <section class="tw xbox font-sm" id="acn3283-tbl-0004" lang="en"><h4 class="obj_head">Table 4.</h4> <div class="caption p"><p>SMA‐MAP levels from blood samples in SMA and healthy control infants<strong>.</strong> </p></div> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <col style="border-right:solid 1px #000000" span="1"> <thead valign="top"><tr style="border-bottom:solid 1px #000000"> <th align="left" valign="top" rowspan="1" colspan="1">Analyte</th> <th align="center" valign="top" rowspan="1" colspan="1">SMA (<em>N</em> = 18)</th> <th align="center" valign="top" rowspan="1" colspan="1">SMA: 2 <em>SMN2</em> copy subgroup (<em>N</em> = 13)</th> <th align="center" valign="top" rowspan="1" colspan="1">Control (<em>N</em> = 20)</th> <th align="center" valign="top" rowspan="1" colspan="1"> <em>P</em> value SMA vs Control</th> <th align="center" valign="top" rowspan="1" colspan="1"> <em>P</em> value <em>SMN2</em> = 2 vs Control</th> </tr></thead> <tbody> <tr> <td align="left" rowspan="1" colspan="1">Apolipoprotein B (Apo B) (<em>μ</em>g/mL)</td> <td align="center" rowspan="1" colspan="1">842.3 (310.3)</td> <td align="center" rowspan="1" colspan="1">871.5 (313.2)</td> <td align="center" rowspan="1" colspan="1">645.2 (369.0)</td> <td align="center" rowspan="1" colspan="1">0.0850</td> <td align="center" rowspan="1" colspan="1">0.0779</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">AXL receptor tyrosine kinase (AXL) (ng/mL)</td> <td align="center" rowspan="1" colspan="1">20.17 (6.57)</td> <td align="center" rowspan="1" colspan="1">18.62 (5.87)</td> <td align="center" rowspan="1" colspan="1">23.37 (7.59)</td> <td align="center" rowspan="1" colspan="1">0.1752</td> <td align="center" rowspan="1" colspan="1">0.0650</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">C‐Reactive protein (CRP) (<em>μ</em>g/mL)</td> <td align="center" rowspan="1" colspan="1">1.94 (6.28)</td> <td align="center" rowspan="1" colspan="1">0.58 (0.66)</td> <td align="center" rowspan="1" colspan="1">0.48 (1.06)</td> <td align="center" rowspan="1" colspan="1">0.3423</td> <td align="center" rowspan="1" colspan="1">0.7623</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>Cadherin‐13 (T‐cad) (ng/mL)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>6.83 (3.18)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>6.67 (3.25)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>9.72 (4.39)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0277</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0399</strong> </td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>Cartilage oligomeric matrix protein (COMP) (ng/mL)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>388.4 (221.2)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>298.1 (121.0)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>617.5 (177.7)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0011</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong><0.0001</strong> </td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Cathepsin D (ng/mL)</td> <td align="center" rowspan="1" colspan="1">412.3 (243.5)</td> <td align="center" rowspan="1" colspan="1">358.2 (233.1)</td> <td align="center" rowspan="1" colspan="1">486.8 (494.8)</td> <td align="center" rowspan="1" colspan="1">0.5549</td> <td align="center" rowspan="1" colspan="1">0.3242</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>Complement component C1q receptor (C1qR1) (</strong> <em><strong>μ</strong></em> <strong>g/mL)</strong> </td> <td align="center" rowspan="1" colspan="1">14.62 (8.54)</td> <td align="center" rowspan="1" colspan="1"> <strong>12.24 (6.78)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>20.64 (13.17)</strong> </td> <td align="center" rowspan="1" colspan="1">0.1075</td> <td align="center" rowspan="1" colspan="1"> <strong>0.0227</strong> </td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Complement factor H‐related protein 1 (CFHR1) (<em>μ</em>g/mL)</td> <td align="center" rowspan="1" colspan="1">1005 (675.4)</td> <td align="center" rowspan="1" colspan="1">1000 (738.2)</td> <td align="center" rowspan="1" colspan="1">942.9 (566.0)</td> <td align="center" rowspan="1" colspan="1">0.7588</td> <td align="center" rowspan="1" colspan="1">0.8031</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>Dipeptidyl peptidase IV (DPPIV) (ng/mL)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>232.4 (86.12)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>215.1 (55.69)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>282.1 (92.72)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0969</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0260</strong> </td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Endoglin (ng/mL)</td> <td align="center" rowspan="1" colspan="1">3.31 (0.87)</td> <td align="center" rowspan="1" colspan="1">3.08 (0.85)</td> <td align="center" rowspan="1" colspan="1">3.32 (0.81)</td> <td align="center" rowspan="1" colspan="1">0.9741</td> <td align="center" rowspan="1" colspan="1">0.4143</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Fetuin‐A (<em>μ</em>g/mL)</td> <td align="center" rowspan="1" colspan="1">648.4 (187.2)</td> <td align="center" rowspan="1" colspan="1">653.2 (163.7)</td> <td align="center" rowspan="1" colspan="1">622.0 (141.5)</td> <td align="center" rowspan="1" colspan="1">0.6241</td> <td align="center" rowspan="1" colspan="1">0.5638</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Fibulin‐1C (Fib‐1C) (<em>μ</em>g/mL)</td> <td align="center" rowspan="1" colspan="1">20.67 (4.95)</td> <td align="center" rowspan="1" colspan="1">20.00 (5.58)</td> <td align="center" rowspan="1" colspan="1">19.65 (5.62)</td> <td align="center" rowspan="1" colspan="1">0.5596</td> <td align="center" rowspan="1" colspan="1">0.8620</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Human epidermal growth factor receptor 2 (HER‐2) (ng/mL)</td> <td align="center" rowspan="1" colspan="1">0.69 (0.23)</td> <td align="center" rowspan="1" colspan="1">0.63 (0.18)</td> <td align="center" rowspan="1" colspan="1">0.76 (0.29</td> <td align="center" rowspan="1" colspan="1">0.4375</td> <td align="center" rowspan="1" colspan="1">0.1571</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>Insulin‐like growth factor binding protein 6 (IGFBP6) (ng/mL)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>116.3 (48.25)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>106.2 (44.21)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>153.9 (40.92)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0135</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0034</strong> </td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Leptin (ng/mL)</td> <td align="center" rowspan="1" colspan="1">3.46 (2.59)</td> <td align="center" rowspan="1" colspan="1">3.39 (2.72)</td> <td align="center" rowspan="1" colspan="1">2.58 (1.65)</td> <td align="center" rowspan="1" colspan="1">0.2177</td> <td align="center" rowspan="1" colspan="1">0.3476</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Monocyte chemotactic protein 1 (MCP‐1) (pg/mL)</td> <td align="center" rowspan="1" colspan="1">255.4 (79.99)</td> <td align="center" rowspan="1" colspan="1">252.2 (78.17)</td> <td align="center" rowspan="1" colspan="1">336.7 (160.2)</td> <td align="center" rowspan="1" colspan="1">0.0541</td> <td align="center" rowspan="1" colspan="1">0.0529</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>Myoglobin (ng/mL)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>32.71 (30.17)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>30.56 (28.09)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>14.46 (7.78)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0220</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0645</strong> </td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Osteopontin (ng/mL)</td> <td align="center" rowspan="1" colspan="1">151.0 (63.92)</td> <td align="center" rowspan="1" colspan="1">136.8 (67.08)</td> <td align="center" rowspan="1" colspan="1">168.4 (46.75)</td> <td align="center" rowspan="1" colspan="1">0.3426</td> <td align="center" rowspan="1" colspan="1">0.1204</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>Peptidase D (PEPD) (</strong> <em><strong>μ</strong></em> <strong>g/mL)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>9.39 (2.34)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>8.84 (1.79)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>11.15 (2.24)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0236</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0038</strong> </td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Placenta growth factor (PLGF) (pg/mL)</td> <td align="center" rowspan="1" colspan="1">19.00 (2.85)</td> <td align="center" rowspan="1" colspan="1">18.54 (1.85</td> <td align="center" rowspan="1" colspan="1">20.10 (5.04)</td> <td align="center" rowspan="1" colspan="1">0.4080</td> <td align="center" rowspan="1" colspan="1">0.2183</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Serum amyloid P‐component (SAP) (<em>μ</em>g/mL)</td> <td align="center" rowspan="1" colspan="1">3.53 (1.69)</td> <td align="center" rowspan="1" colspan="1">3.70 (1.84)</td> <td align="center" rowspan="1" colspan="1">3.01 (1.72)</td> <td align="center" rowspan="1" colspan="1">0.3564</td> <td align="center" rowspan="1" colspan="1">0.2823</td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Tenascin‐X (TN‐X) (ng/mL)</td> <td align="center" rowspan="1" colspan="1">184.8 (144.5)</td> <td align="center" rowspan="1" colspan="1">151.5 (114.1)</td> <td align="center" rowspan="1" colspan="1">351.0 (464.9)</td> <td align="center" rowspan="1" colspan="1">0.1424</td> <td align="center" rowspan="1" colspan="1">0.0798</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>Tetranectin (</strong> <em><strong>μ</strong></em> <strong>g/mL)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>7.39 (1.62)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>6.78 (1.23)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>9.06 (3.20)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0493</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0078</strong> </td> </tr> <tr> <td align="left" rowspan="1" colspan="1">Thrombospondin‐4 (TSP4) (<em>μ</em>g/mL)</td> <td align="center" rowspan="1" colspan="1">22.51 (11.55)</td> <td align="center" rowspan="1" colspan="1">18.86 (9.21)</td> <td align="center" rowspan="1" colspan="1">28.66 (21.95)</td> <td align="center" rowspan="1" colspan="1">0.2821</td> <td align="center" rowspan="1" colspan="1">0.0876</td> </tr> <tr> <td align="left" rowspan="1" colspan="1"> <strong>YKL‐40 (ng/mL)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>10.11 (3.96)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>10.45 (3.90)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>7.58 (2.85)</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0288</strong> </td> <td align="center" rowspan="1" colspan="1"> <strong>0.0204</strong> </td> </tr> </tbody> </table></div> <div class="p text-right font-secondary"><a href="table/acn3283-tbl-0004/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <div class="tw-foot p"><div class="fn" id="acn3283-note-0003"><p>Bold rows highlight analytes where <em>P</em> value is equal to or less than 0.05.</p></div></div></section><p>There were nine analytes that had a negative correlation with age at enrollment in the control cohort and ten analytes that had a negative correlation with age at enrollment in the SMA cohort (Table S2). Only six analytes (AXL receptor tyrosine kinase, cartilage oligomeric matrix protein, complement component C1q receptor, Fibulin‐1C, Tenascin‐X, and Thrombospondin‐4) showed this correlation in both the control and SMA cohorts. Interestingly, there were no analytes that demonstrated a positive correlation with age at enrollment in either cohort.</p> <p>In the control infant cohort, there were negative correlations between the TIMPSI motor function score and the plasma concentrations of complement component C1q receptor (<em>r</em> = −0.681, <em>n</em> = 20, <em>P</em> = 0.0010), osteopontin (<em>r</em> = −0.528, <em>n</em> = 20, <em>P</em> = 0.0168) and thrombospondin‐4 (<em>r</em> = −0.521, <em>n</em> = 20, <em>P</em> = 0.0187). In the SMA cohort, there were positive correlations between the TIMPSI motor function score and the plasma concentrations of AXL Receptor Tyrosine Kinase (<em>r</em> = 0.586, <em>n</em> = 18, <em>P</em> = 0.0107), cartilage oligomeric matrix protein (<em>r</em> = 0.834, <em>n</em> = 18, <em>P</em> < 0.0001), dipeptidyl peptidase IV (<em>r</em> = 0.603, <em>n</em> = 18, <em>P</em> = 0.0081), endoglin (<em>r</em> = 0.535, <em>n</em> = 18, <em>P</em> = 0.0223), HER2 (<em>r</em> = 0.544, <em>n</em> = 18, <em>P</em> = 0.0196), Insulin‐like growth factor‐binding protein 6 (0.580, <em>n</em> = 18, 0.0117), PEPD (<em>r</em> = 0.6037, <em>n</em> = 18, <em>P</em> = 0.0080), thrombospondin‐4 (<em>r</em> = 0.615, <em>n</em> = 18, <em>P</em> = 0.0066), and tetranectin (<em>r</em> = 0.669, <em>n</em> = 18, <em>P</em> = 0.0024). The only analyte that correlated with both the TIMPSI and the CHOP‐INTEND score in the SMA cohort was cartilage oligomeric matrix protein (Table S2). C‐reactive protein plasma concentration correlated with the CHOP‐INTEND (0.776, <em>n</em> = 15, 0.0007) but not the TIMPSI (<em>r</em> = 0.288, <em>n</em> = 18, <em>P</em> = 0.2457) in SMA infants.</p></section></section><section id="acn3283-sec-0021"><h2 class="pmc_sec_title">Discussion</h2> <p>We were successful in our efforts to recruit SMA and healthy control infants into the study using 14 clinical sites geographically distributed across the US. Our ability to enroll in this challenging and vulnerable population illustrates the utility and power of the clinical trial infrastructure that the NeuroNEXT Network was designed to provide. Importantly, while some sites within the network had extensive experience in the SMA infant population, many sites did not. Thus, our data set may provide natural history data which are most relatable to large, multi‐center SMA clinical trials involving sites with a heterogeneous experience level in infant SMA. Caution must be made when using this data as a “historical control” in future and current SMA infant clinical trials. The motivation of parents who enter their infant into an interventional trial compared to those who elect not to participate may bias the standard of care, the use of aggressive support and the timing of the initiation of hospice care.</p> <p>By the time infants presented for the enrollment visit, SMA infants have reduced motor function compared to controls as reflected in both TIMPSI and CHOP‐INTEND enrollment scores for the SMA cohort. This finding, while not surprising, is remarkably consistent with prior studies.<a href="#acn3283-bib-0019" class="usa-link" aria-describedby="acn3283-bib-0019">19</a>, <a href="#acn3283-bib-0033" class="usa-link" aria-describedby="acn3283-bib-0033">33</a> This consistency, obtained in a multicenter format similar to what would be expected in a large clinical trial context, is an important replication and validation of earlier single center studies (Finkel, Krosschell, and Swoboda, unpublished data). In addition, both the SMA cohort and control cohort data provide an informed baseline expectation for motor function in Type I infants and may eventually help to inform what should be considered a clinically important difference in the two motor function tests following an intervention.</p> <p>Ulnar CMAP and EIM assessed using multiple sites bilaterally were both able to distinguish between cohorts at the enrollment visit. The CMAP results in the SMA infants closely match those seen in previous studies.<a href="#acn3283-bib-0033" class="usa-link" aria-describedby="acn3283-bib-0033">33</a>, <a href="#acn3283-bib-0034" class="usa-link" aria-describedby="acn3283-bib-0034">34</a> It will be important to see how these already low values change as these infants age. The extent of the loss of CMAP response at the enrollment visit may not indicate that motor unit function is irreversibly lost at the baseline visit; however, it is clear that urgency is required to recruit infants into trials prior to significant CMAP loss, if feasible, to ensure the best possible outcomes. For the subgroup of SMA infants with two copies of <em>SMN2</em>, the CMAP values do not correlate with motor function, whereas when the more mildly affected infants with three or more copies of <em>SMN2</em> are included in the analysis, CMAP does correlate with motor function. This lack of correlation with motor function in the SMA infants with two copies of <em>SMN2</em> may be the result of a sampling error as the ulnar CMAP does not reflect the functional status of motor units involved in proximal muscle function. This study also demonstrates that, for healthy infants, CMAP responses appear stable from birth to 6 months of age, although a full analysis of the longitudinal responses in individual infants will provide more definitive evidence. An analysis of the normal development of CMAP responses for each infant at the end of the longitudinal study will provide important baseline data for future clinical trials.</p> <p>Of all the predetermined EIM measures studied, only the high‐frequency reactance slope distinguished SMA from healthy children; many of the standard measures that have shown differences in older children<a href="#acn3283-bib-0027" class="usa-link" aria-describedby="acn3283-bib-0027">27</a>, <a href="#acn3283-bib-0035" class="usa-link" aria-describedby="acn3283-bib-0035">35</a> did not do so in this group of infants. Moreover, EIM measures only correlated with motor function in the healthy children. Two factors may have impacted these results. First, there was no assessment of data quality. Unlike CMAP, with which the investigators were quite familiar, the impedance data were obtained virtually blindly; thus, poor‐quality data (e.g. due to electrode contact problems) may have been included in this analysis. Second, following the design of the study, it has since become clear that very young individuals have different impedance spectral characteristics (including, e.g., peak reactance values far above the standard 50 kHz frequency) (Rutkove, unpublished observations). Thus, the predetermined metrics utilized in this study were likely not ideal for children of this age. Further analysis of the raw data will be necessary to identify optimized parameters for infants that can then be applied to the forthcoming longitudinal data analysis.</p> <p>SMN mRNA levels were lower in SMA infants as expected, and there was no correlation between age and SMN levels in SMA or control cohorts. Surprisingly, there was a positive correlation detected in control infants between SMN mRNA levels and the scores on the CHOP‐INTEND. It is worth noting, however, that only seven control infants had both the CHOP‐INTEND and a blood draw for SMN mRNA levels. There was no correlation between SMN mRNA levels and the TIMPSI scores in 19 control infants. SMN protein levels were more variable than the SMN mRNA levels. There were no correlations between SMN mRNA levels and SMN protein levels as measured from PBMCs in either cohort (<em>r</em> = −0.0184, <em>n</em> = 31, <em>P</em> = 0.9217). We found variability in PBMC yield from patient samples and were not able to process some samples because of insufficient material. Since the start of this project, it is now clear that measurement of SMN protein levels from PBMC samples collected using the CPT tubes is not optimal and a whole blood methodology is now available.<a href="#acn3283-bib-0036" class="usa-link" aria-describedby="acn3283-bib-0036">36</a>, <a href="#acn3283-bib-0037" class="usa-link" aria-describedby="acn3283-bib-0037">37</a> The protocol was modified for subsequent longitudinal visits to include collection of whole blood so that future analysis of SMN protein in this study may be improved.</p> <p>There were many serum protein analytes that distinguished between SMA and control cohorts. Most of these were in lower concentrations in the SMA infants compared to the control infants with the exception of myoglobin and YKL‐40 that were found in higher concentrations in SMA infant serum compared to controls. While it is difficult to generalize the results of these disparate proteins, one general observation is that in the control cohort, if a protein analyte concentration correlated with age, then it was a negative correlation; the serum concentration of many of the analytes decreased with increasing age of enrollment. This overall trend was also seen in the SMA cohort with two exceptions (Apolipoprotein B and Serum Amyloid P‐Component) suggesting that the natural history of most serum analytes studied here is to have reduced concentration with increasing age. Determination of the trends in individual infants with increasing age will help to clarify this possibility.</p> <p>Future analysis of the longitudinal data sets from the SMA infant and healthy infant control cohorts described here will contribute to an understanding of the natural history of SMA infants and provide important control data for SMA infant interventional studies. It is clear from our initial data, that infants with SMA presenting prior to 6 months of age can be enrolled into studies readily. However, given the poor motor function and electrophysiological outcomes at enrollment, efforts should be made to enroll infants into interventional clinical trials as soon as possible after diagnosis, and ideally, prior to the onset of significant denervation.</p></section><section id="acn3283-sec-0023"><h2 class="pmc_sec_title">Author Contributions</h2> <p>SJK, AHMB, and JTK conceived the study. SJK, KK, WDA, SBR, KJS, STI, EK, AK, and JTK designed the study. KK, WDA, KJS, AS, BTD, RS, NK, DC, STI, JP, AC, CC, CM, WBB, KW, MT, PS, EF, and the NN101 SMA Biomarker Investigators (Table S1) acquired the clinical data. SRR, VLM, XW, PGZ, and TWP acquired the molecular data. MEC, MMM, AB, and the NeuroNEXT Clinical Trial Network coordinated the data acquisition. SJK, CSC, and JWY analyzed the data. SJK, KK, WDA, SBR, and JTK wrote the manuscript.</p></section><section id="acn3283-sec-0024"><h2 class="pmc_sec_title">Conflict of Interest</h2> <p>S.B.R. has equity in, and serves as a consultant and scientific advisor to, Skulpt, Inc. a company that designs impedance devices for clinical and research use; he is also a member of the company's Board of Directors. The company also has also licensed patented impedance technology of which S.B.R. is named as an inventor.</p></section><section id="sec24"><h2 class="pmc_sec_title">Supporting information</h2> <section class="sm xbox font-sm" id="supplementary-material1"><div class="caption p"> <p> <strong>Table S1.</strong> Enrolling NeuroNEXT sites. Enrolling NeuroNEXT clinical trial sites and NN101 site investigators and staff.</p> <p> <strong>Table S2.</strong> Pearson correlation coefficients between baseline motor function test score and putative SMA biomarkers. Summary table of Pearson correlation coefficients. Shaded rows indicate a correlation with <em>p</em> value that is equal to or less than 0.05.</p> </div> <div class="media p"><div class="caption"> <a href="/articles/instance/4748311/bin/ACN3-3-132-s001.docx" data-ga-action="click_feat_suppl" class="usa-link">Click here for additional data file.</a><sup> (39.8KB, docx) </sup> </div></div></section></section><section id="acn3283-sec-0022" class="ack"><h2 class="pmc_sec_title">Acknowledgments</h2> <p>This study was funded by the NINDS (U01NS079163), Cure SMA, Muscular Dystrophy Association, and the SMA Foundation. The NeuroNEXT Network is supported by the NINDS (Central Coordinating Center: U01NS077179, Data Coordinating Center: U01NS077352). SJK is also supported by grant funding from the NINDS (K08NS067282). WDA is supported by grant funding from NIH‐NICHD (K12HD001097). We thank Dr. Elizabeth McNeil for her steady support throughout this project. We are grateful to Kelly and David Sopp at Wrybaby.com for the use of artwork and material support for this study. We are indebted to Allison Kingsley who served as the patient advocate during the design phase of this study on behalf of her son, Brett Kingsley. This study was made possible by the courage and strength of the infants and their families who volunteered to participate.</p></section><section id="acn3283-bibl-0001" class="ref-list"><h2 class="pmc_sec_title">References</h2> <section id="acn3283-bibl-0001_sec2"><ul class="ref-list font-sm" style="list-style-type:none"> <li id="acn3283-bib-0001"> <span class="label">1.</span><cite> Pearn JH. The gene frequency of acute Werdnig‐Hoffmann disease (SMA type 1). A total population survey in North‐East England. J Med Genet 1973;10:260–265.</cite> [<a href="https://doi.org/10.1136/jmg.10.3.260" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC1013030/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/4774536/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Med%20Genet&title=The%20gene%20frequency%20of%20acute%20Werdnig%E2%80%90Hoffmann%20disease%20(SMA%20type%201).%20A%20total%20population%20survey%20in%20North%E2%80%90East%20England&author=JH%20Pearn&volume=10&publication_year=1973&pages=260-265&pmid=4774536&doi=10.1136/jmg.10.3.260&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0002"> <span class="label">2.</span><cite> Sugarman EA, Nagan N, Zhu H, et al. Pan‐ethnic carrier screening and prenatal diagnosis for spinal muscular atrophy: clinical laboratory analysis of >72,400 specimens. Eur J Hum Genet 2012;20:27–32.</cite> [<a href="https://doi.org/10.1038/ejhg.2011.134" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3234503/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21811307/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Eur%20J%20Hum%20Genet&title=Pan%E2%80%90ethnic%20carrier%20screening%20and%20prenatal%20diagnosis%20for%20spinal%20muscular%20atrophy:%20clinical%20laboratory%20analysis%20of%20>72,400%20specimens&author=EA%20Sugarman&author=N%20Nagan&author=H%20Zhu&volume=20&publication_year=2012&pages=27-32&pmid=21811307&doi=10.1038/ejhg.2011.134&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0003"> <span class="label">3.</span><cite> Lefebvre S, Burlet P, Liu Q, et al. Correlation between severity and SMN protein level in spinal muscular atrophy. Nat Genet 1997;16:265–269.</cite> [<a href="https://doi.org/10.1038/ng0797-265" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/9207792/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Genet&title=Correlation%20between%20severity%20and%20SMN%20protein%20level%20in%20spinal%20muscular%20atrophy&author=S%20Lefebvre&author=P%20Burlet&author=Q%20Liu&volume=16&publication_year=1997&pages=265-269&pmid=9207792&doi=10.1038/ng0797-265&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0004"> <span class="label">4.</span><cite> Coovert DD, Le TT, McAndrew PE, et al. The survival motor neuron protein in spinal muscular atrophy. Hum Mol Genet 1997;6:1205–1214.</cite> [<a href="https://doi.org/10.1093/hmg/6.8.1205" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/9259265/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Hum%20Mol%20Genet&title=The%20survival%20motor%20neuron%20protein%20in%20spinal%20muscular%20atrophy&author=DD%20Coovert&author=TT%20Le&author=PE%20McAndrew&volume=6&publication_year=1997&pages=1205-1214&pmid=9259265&doi=10.1093/hmg/6.8.1205&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0005"> <span class="label">5.</span><cite> Lorson CL, Hahnen E, Androphy EJ, Wirth B. A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. Proc Natl Acad Sci USA 1999;96:6307–6311.</cite> [<a href="https://doi.org/10.1073/pnas.96.11.6307" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC26877/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/10339583/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Proc%20Natl%20Acad%20Sci%20USA&title=A%20single%20nucleotide%20in%20the%20SMN%20gene%20regulates%20splicing%20and%20is%20responsible%20for%20spinal%20muscular%20atrophy&author=CL%20Lorson&author=E%20Hahnen&author=EJ%20Androphy&author=B%20Wirth&volume=96&publication_year=1999&pages=6307-6311&pmid=10339583&doi=10.1073/pnas.96.11.6307&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0006"> <span class="label">6.</span><cite> Monani UR, Lorson CL, Parsons DW, et al. A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2. Hum Mol Genet 1999;8:1177–1183.</cite> [<a href="https://doi.org/10.1093/hmg/8.7.1177" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/10369862/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Hum%20Mol%20Genet&title=A%20single%20nucleotide%20difference%20that%20alters%20splicing%20patterns%20distinguishes%20the%20SMA%20gene%20SMN1%20from%20the%20copy%20gene%20SMN2&author=UR%20Monani&author=CL%20Lorson&author=DW%20Parsons&volume=8&publication_year=1999&pages=1177-1183&pmid=10369862&doi=10.1093/hmg/8.7.1177&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0007"> <span class="label">7.</span><cite> Burnett BG, Munoz E, Tandon A, et al. Regulation of SMN protein stability. Mol Cell Biol 2009;29:1107–1115.</cite> [<a href="https://doi.org/10.1128/MCB.01262-08" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2643817/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19103745/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Mol%20Cell%20Biol&title=Regulation%20of%20SMN%20protein%20stability&author=BG%20Burnett&author=E%20Munoz&author=A%20Tandon&volume=29&publication_year=2009&pages=1107-1115&pmid=19103745&doi=10.1128/MCB.01262-08&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0008"> <span class="label">8.</span><cite> Kashima T, Manley JL. A negative element in SMN2 exon 7 inhibits splicing in spinal muscular atrophy. Nat Genet 2003;34:460–463.</cite> [<a href="https://doi.org/10.1038/ng1207" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/12833158/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Genet&title=A%20negative%20element%20in%20SMN2%20exon%207%20inhibits%20splicing%20in%20spinal%20muscular%20atrophy&author=T%20Kashima&author=JL%20Manley&volume=34&publication_year=2003&pages=460-463&pmid=12833158&doi=10.1038/ng1207&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0009"> <span class="label">9.</span><cite> Zerres K, Rudnik‐Schoneborn S. Natural history in proximal spinal muscular atrophy. Clinical analysis of 445 patients and suggestions for a modification of existing classifications. Arch Neurol 1995;52:518–523.</cite> [<a href="https://doi.org/10.1001/archneur.1995.00540290108025" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/7733848/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Arch%20Neurol&title=Natural%20history%20in%20proximal%20spinal%20muscular%20atrophy.%20Clinical%20analysis%20of%20445%20patients%20and%20suggestions%20for%20a%20modification%20of%20existing%20classifications&author=K%20Zerres&author=S%20Rudnik%E2%80%90Schoneborn&volume=52&publication_year=1995&pages=518-523&pmid=7733848&doi=10.1001/archneur.1995.00540290108025&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0010"> <span class="label">10.</span><cite> Munsat T, Davies K. Spinal muscular atrophy. 32nd ENMC International Workshop. Naarden, The Netherlands, 10‐12 March 1995. Neuromuscul Disord 1996;6:125–127.</cite> [<a href="https://doi.org/10.1016/0960-8966(95)00032-1" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/8664564/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Neuromuscul%20Disord&title=Spinal%20muscular%20atrophy.%2032nd%20ENMC%20International%20Workshop.%20Naarden,%20The%20Netherlands,%2010%E2%80%9012%20March%201995&author=T%20Munsat&author=K.%20Davies&volume=6&publication_year=1996&pages=125-127&pmid=8664564&doi=10.1016/0960-8966(95)00032-1&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0011"> <span class="label">11.</span><cite> McAndrew PE, Parsons DW, Simard LR, et al. Identification of proximal spinal muscular atrophy carriers and patients by analysis of SMNT and SMNC gene copy number. Am J Hum Genet 1997;60:1411–1422.</cite> [<a href="https://doi.org/10.1086/515465" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC1716150/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/9199562/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Am%20J%20Hum%20Genet&title=Identification%20of%20proximal%20spinal%20muscular%20atrophy%20carriers%20and%20patients%20by%20analysis%20of%20SMNT%20and%20SMNC%20gene%20copy%20number&author=PE%20McAndrew&author=DW%20Parsons&author=LR%20Simard&volume=60&publication_year=1997&pages=1411-1422&pmid=9199562&doi=10.1086/515465&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0012"> <span class="label">12.</span><cite> Feldkotter M, Schwarzer V, Wirth R, et al. Quantitative analyses of SMN1 and SMN2 based on real‐time lightCycler PCR: fast and highly reliable carrier testing and prediction of severity of spinal muscular atrophy. Am J Hum Genet 2002;70:358–368.</cite> [<a href="https://doi.org/10.1086/338627" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC419987/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/11791208/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Am%20J%20Hum%20Genet&title=Quantitative%20analyses%20of%20SMN1%20and%20SMN2%20based%20on%20real%E2%80%90time%20lightCycler%20PCR:%20fast%20and%20highly%20reliable%20carrier%20testing%20and%20prediction%20of%20severity%20of%20spinal%20muscular%20atrophy&author=M%20Feldkotter&author=V%20Schwarzer&author=R%20Wirth&volume=70&publication_year=2002&pages=358-368&pmid=11791208&doi=10.1086/338627&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0013"> <span class="label">13.</span><cite> Elsheikh B, Prior T, Zhang X, et al. An analysis of disease severity based on SMN2 copy number in adults with spinal muscular atrophy. Muscle Nerve 2009;40:652–656.</cite> [<a href="https://doi.org/10.1002/mus.21350" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19760790/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Muscle%20Nerve&title=An%20analysis%20of%20disease%20severity%20based%20on%20SMN2%20copy%20number%20in%20adults%20with%20spinal%20muscular%20atrophy&author=B%20Elsheikh&author=T%20Prior&author=X%20Zhang&volume=40&publication_year=2009&pages=652-656&pmid=19760790&doi=10.1002/mus.21350&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0014"> <span class="label">14.</span><cite> Monani UR, Sendtner M, Coovert DD, et al. The human centromeric survival motor neuron gene (SMN2) rescues embryonic lethality in Smn(‐/‐) mice and results in a mouse with spinal muscular atrophy. Hum Mol Genet 2000;9:333–339.</cite> [<a href="https://doi.org/10.1093/hmg/9.3.333" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/10655541/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Hum%20Mol%20Genet&title=The%20human%20centromeric%20survival%20motor%20neuron%20gene%20(SMN2)%20rescues%20embryonic%20lethality%20in%20Smn(%E2%80%90/%E2%80%90)%20mice%20and%20results%20in%20a%20mouse%20with%20spinal%20muscular%20atrophy&author=UR%20Monani&author=M%20Sendtner&author=DD%20Coovert&volume=9&publication_year=2000&pages=333-339&pmid=10655541&doi=10.1093/hmg/9.3.333&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0015"> <span class="label">15.</span><cite> Kolb SJ, Kissel JT. Spinal muscular atrophy: a timely review. Arch Neurol 2011;68:979–984.</cite> [<a href="https://doi.org/10.1001/archneurol.2011.74" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3860273/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21482919/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Arch%20Neurol&title=Spinal%20muscular%20atrophy:%20a%20timely%20review&author=SJ%20Kolb&author=JT%20Kissel&volume=68&publication_year=2011&pages=979-984&pmid=21482919&doi=10.1001/archneurol.2011.74&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0016"> <span class="label">16.</span><cite> Arnold WD, Burghes AH. Spinal muscular atrophy: development and implementation of potential treatments. Ann Neurol 2013;74:348–362.</cite> [<a href="https://doi.org/10.1002/ana.23995" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3876415/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23939659/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Ann%20Neurol&title=Spinal%20muscular%20atrophy:%20development%20and%20implementation%20of%20potential%20treatments&author=WD%20Arnold&author=AH%20Burghes&volume=74&publication_year=2013&pages=348-362&pmid=23939659&doi=10.1002/ana.23995&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0017"> <span class="label">17.</span><cite> Wang CH, Finkel RS, Bertini ES, et al. Consensus statement for standard of care in spinal muscular atrophy. J Child Neurol 2007;22:1027–1049.</cite> [<a href="https://doi.org/10.1177/0883073807305788" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/17761659/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Child%20Neurol&title=Consensus%20statement%20for%20standard%20of%20care%20in%20spinal%20muscular%20atrophy&author=CH%20Wang&author=RS%20Finkel&author=ES%20Bertini&volume=22&publication_year=2007&pages=1027-1049&pmid=17761659&doi=10.1177/0883073807305788&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0018"> <span class="label">18.</span><cite> Oskoui M, Levy G, Garland CJ, et al. The changing natural history of spinal muscular atrophy type 1. Neurology 2007;69:1931–1936.</cite> [<a href="https://doi.org/10.1212/01.wnl.0000290830.40544.b9" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/17998484/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Neurology&title=The%20changing%20natural%20history%20of%20spinal%20muscular%20atrophy%20type%201&author=M%20Oskoui&author=G%20Levy&author=CJ%20Garland&volume=69&publication_year=2007&pages=1931-1936&pmid=17998484&doi=10.1212/01.wnl.0000290830.40544.b9&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0019"> <span class="label">19.</span><cite> Finkel RS, McDermott MP, Kaufmann P, et al. Observational study of spinal muscular atrophy type I and implications for clinical trials. Neurology 2014;83:810–817.</cite> [<a href="https://doi.org/10.1212/WNL.0000000000000741" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4155049/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/25080519/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Neurology&title=Observational%20study%20of%20spinal%20muscular%20atrophy%20type%20I%20and%20implications%20for%20clinical%20trials&author=RS%20Finkel&author=MP%20McDermott&author=P%20Kaufmann&volume=83&publication_year=2014&pages=810-817&pmid=25080519&doi=10.1212/WNL.0000000000000741&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0020"> <span class="label">20.</span><cite> Kaufmann P, O'Rourke PP. Central institutional review board review for an academic trial network. Acad Med 2015;90:321–323.</cite> [<a href="https://doi.org/10.1097/ACM.0000000000000562" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4859204/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/25406606/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Acad%20Med&title=Central%20institutional%20review%20board%20review%20for%20an%20academic%20trial%20network&author=P%20Kaufmann&author=PP.%20O'Rourke&volume=90&publication_year=2015&pages=321-323&pmid=25406606&doi=10.1097/ACM.0000000000000562&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0021"> <span class="label">21.</span><cite> Prior TW, Snyder PJ, Rink BD, et al. Newborn and carrier screening for spinal muscular atrophy. Am J Med Genet A 2010;152A:1608–1616.</cite> [<a href="https://doi.org/10.1002/ajmg.a.33474" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/20578137/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Am%20J%20Med%20Genet%20A&title=Newborn%20and%20carrier%20screening%20for%20spinal%20muscular%20atrophy&author=TW%20Prior&author=PJ%20Snyder&author=BD%20Rink&volume=152A&publication_year=2010&pages=1608-1616&pmid=20578137&doi=10.1002/ajmg.a.33474&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0022"> <span class="label">22.</span><cite> Prior TW, Krainer AR, Hua Y, et al. A positive modifier of spinal muscular atrophy in the SMN2 gene. Am J Hum Genet 2009;85:408–413.</cite> [<a href="https://doi.org/10.1016/j.ajhg.2009.08.002" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2771537/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19716110/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Am%20J%20Hum%20Genet&title=A%20positive%20modifier%20of%20spinal%20muscular%20atrophy%20in%20the%20SMN2%20gene&author=TW%20Prior&author=AR%20Krainer&author=Y%20Hua&volume=85&publication_year=2009&pages=408-413&pmid=19716110&doi=10.1016/j.ajhg.2009.08.002&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0023"> <span class="label">23.</span><cite> Krosschell KJ, Maczulski JA, Scott C, et al. Reliability and validity of the TIMPSI for infants with spinal muscular atrophy type I. Pediatr Phys Ther 2013;25:140–148; discussion 9.</cite> [<a href="https://doi.org/10.1097/PEP.0b013e31828a205f" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4381541/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23542189/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Pediatr%20Phys%20Ther&title=Reliability%20and%20validity%20of%20the%20TIMPSI%20for%20infants%20with%20spinal%20muscular%20atrophy%20type%20I&author=KJ%20Krosschell&author=JA%20Maczulski&author=C%20Scott&volume=25&publication_year=2013&pages=140-148&pmid=23542189&doi=10.1097/PEP.0b013e31828a205f&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0024"> <span class="label">24.</span><cite> Glanzman AM, Mazzone E, Main M, et al. The Children's Hospital of Philadelphia Infant Test of Neuromuscular Disorders (CHOP INTEND): test development and reliability. Neuromuscul Disord 2010;20:155–161.</cite> [<a href="https://doi.org/10.1016/j.nmd.2009.11.014" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3260046/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/20074952/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Neuromuscul%20Disord&title=The%20Children's%20Hospital%20of%20Philadelphia%20Infant%20Test%20of%20Neuromuscular%20Disorders%20(CHOP%20INTEND):%20test%20development%20and%20reliability&author=AM%20Glanzman&author=E%20Mazzone&author=M%20Main&volume=20&publication_year=2010&pages=155-161&pmid=20074952&doi=10.1016/j.nmd.2009.11.014&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0025"> <span class="label">25.</span><cite> Piper MC, Darrah J. Motor assessment of the developing infant. In: Company WS, editor; Philadelphia, 1994.</cite> [<a href="https://scholar.google.com/scholar_lookup?title=Motor%20assessment%20of%20the%20developing%20infant&author=MC%20Piper&author=J%20Darrah&publication_year=1994&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0026"> <span class="label">26.</span><cite> Blanchard Y, Neilan E, Busanich J, et al. Interrater reliability of early intervention providers scoring the Alberta infant motor scale. Pediatr Phys Ther 2004. Spring;16(1):13–18.</cite> [<a href="https://doi.org/10.1097/01.PEP.0000113272.34023.56" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/17057466/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Pediatr%20Phys%20Ther&title=Interrater%20reliability%20of%20early%20intervention%20providers%20scoring%20the%20Alberta%20infant%20motor%20scale&author=Y%20Blanchard&author=E%20Neilan&author=J%20Busanich&volume=16&publication_year=2004&pages=13-18&pmid=17057466&doi=10.1097/01.PEP.0000113272.34023.56&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0027"> <span class="label">27.</span><cite> Rutkove SB, Gregas MC, Darras BT. Electrical impedance myography in spinal muscular atrophy: a longitudinal study. Muscle Nerve 2012;45:642–647.</cite> [<a href="https://doi.org/10.1002/mus.23233" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/22499089/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Muscle%20Nerve&title=Electrical%20impedance%20myography%20in%20spinal%20muscular%20atrophy:%20a%20longitudinal%20study&author=SB%20Rutkove&author=MC%20Gregas&author=BT%20Darras&volume=45&publication_year=2012&pages=642-647&pmid=22499089&doi=10.1002/mus.23233&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0028"> <span class="label">28.</span><cite> Sumner CJ, Kolb SJ, Harmison GG, et al. SMN mRNA and protein levels in peripheral blood: biomarkers for SMA clinical trials. Neurology 2006;66:1067–1073.</cite> [<a href="https://doi.org/10.1212/01.wnl.0000201929.56928.13" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/16481599/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Neurology&title=SMN%20mRNA%20and%20protein%20levels%20in%20peripheral%20blood:%20biomarkers%20for%20SMA%20clinical%20trials&author=CJ%20Sumner&author=SJ%20Kolb&author=GG%20Harmison&volume=66&publication_year=2006&pages=1067-1073&pmid=16481599&doi=10.1212/01.wnl.0000201929.56928.13&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0029"> <span class="label">29.</span><cite> Kolb SJ, Gubitz AK, Olszewski RF Jr, et al. A novel cell immunoassay to measure survival of motor neurons protein in blood cells. BMC Neurol 2006;6:6.</cite> [<a href="https://doi.org/10.1186/1471-2377-6-6" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC1413553/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/16451734/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=BMC%20Neurol&title=A%20novel%20cell%20immunoassay%20to%20measure%20survival%20of%20motor%20neurons%20protein%20in%20blood%20cells&author=SJ%20Kolb&author=AK%20Gubitz&author=RF%20Olszewski&volume=6&publication_year=2006&pages=6&pmid=16451734&doi=10.1186/1471-2377-6-6&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0030"> <span class="label">30.</span><cite> Liu Q, Dreyfuss G. A novel nuclear structure containing the survival of motor neurons protein. EMBO J 1996;15:3555–3565.</cite> [<a href="/articles/PMC451956/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/8670859/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=EMBO%20J&title=A%20novel%20nuclear%20structure%20containing%20the%20survival%20of%20motor%20neurons%20protein&author=Q%20Liu&author=G%20Dreyfuss&volume=15&publication_year=1996&pages=3555-3565&pmid=8670859&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0031"> <span class="label">31.</span><cite> Finkel RS, Crawford TO, Swoboda KJ, et al. Candidate proteins, metabolites and transcripts in the Biomarkers for Spinal Muscular Atrophy (BforSMA) clinical study. PLoS One 2012;7:e35462.</cite> [<a href="https://doi.org/10.1371/journal.pone.0035462" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3338723/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/22558154/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=PLoS%20One&title=Candidate%20proteins,%20metabolites%20and%20transcripts%20in%20the%20Biomarkers%20for%20Spinal%20Muscular%20Atrophy%20(BforSMA)%20clinical%20study&author=RS%20Finkel&author=TO%20Crawford&author=KJ%20Swoboda&volume=7&publication_year=2012&pages=e35462&pmid=22558154&doi=10.1371/journal.pone.0035462&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0032"> <span class="label">32.</span><cite> Kobayashi DT, Shi J, Stephen L, et al. SMA‐MAP: a plasma protein panel for spinal muscular atrophy. PLoS One 2013;8:e60113.</cite> [<a href="https://doi.org/10.1371/journal.pone.0060113" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3615018/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23565191/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=PLoS%20One&title=SMA%E2%80%90MAP:%20a%20plasma%20protein%20panel%20for%20spinal%20muscular%20atrophy&author=DT%20Kobayashi&author=J%20Shi&author=L%20Stephen&volume=8&publication_year=2013&pages=e60113&pmid=23565191&doi=10.1371/journal.pone.0060113&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0033"> <span class="label">33.</span><cite> Swoboda KJ, Prior TW, Scott CB, et al. Natural history of denervation in SMA: Relation to age, SMN2 copy number, and function. Ann Neurol 2005;57:704–712.</cite> [<a href="https://doi.org/10.1002/ana.20473" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4334582/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/15852397/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Ann%20Neurol&title=Natural%20history%20of%20denervation%20in%20SMA:%20Relation%20to%20age,%20SMN2%20copy%20number,%20and%20function&author=KJ%20Swoboda&author=TW%20Prior&author=CB%20Scott&volume=57&publication_year=2005&pages=704-712&pmid=15852397&doi=10.1002/ana.20473&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0034"> <span class="label">34.</span><cite> Finkel RS. Electrophysiological and motor function scale association in a pre‐symptomatic infant with spinal muscular atrophy type I. Neuromuscul Disord 2013;23:112–115.</cite> [<a href="https://doi.org/10.1016/j.nmd.2012.09.006" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23146148/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Neuromuscul%20Disord&title=Electrophysiological%20and%20motor%20function%20scale%20association%20in%20a%20pre%E2%80%90symptomatic%20infant%20with%20spinal%20muscular%20atrophy%20type%20I&author=RS%20Finkel&volume=23&publication_year=2013&pages=112-115&pmid=23146148&doi=10.1016/j.nmd.2012.09.006&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0035"> <span class="label">35.</span><cite> Rutkove SB, Shefner JM, Gregas M, et al. Characterizing spinal muscular atrophy with electrical impedance myography. Muscle Nerve 2010;42:915–921.</cite> [<a href="https://doi.org/10.1002/mus.21784" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21104866/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Muscle%20Nerve&title=Characterizing%20spinal%20muscular%20atrophy%20with%20electrical%20impedance%20myography&author=SB%20Rutkove&author=JM%20Shefner&author=M%20Gregas&volume=42&publication_year=2010&pages=915-921&pmid=21104866&doi=10.1002/mus.21784&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0036"> <span class="label">36.</span><cite> Kobayashi DT, Decker D, Zaworski P, et al. Evaluation of peripheral blood mononuclear cell processing and analysis for Survival Motor Neuron protein. PLoS One 2012;7:e50763.</cite> [<a href="https://doi.org/10.1371/journal.pone.0050763" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3511312/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23226377/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=PLoS%20One&title=Evaluation%20of%20peripheral%20blood%20mononuclear%20cell%20processing%20and%20analysis%20for%20Survival%20Motor%20Neuron%20protein&author=DT%20Kobayashi&author=D%20Decker&author=P%20Zaworski&volume=7&publication_year=2012&pages=e50763&pmid=23226377&doi=10.1371/journal.pone.0050763&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="acn3283-bib-0037"> <span class="label">37.</span><cite> Li J, Geisbush TR, Arnold WD, et al. A comparison of three electrophysiological methods for the assessment of disease status in a mild spinal muscular atrophy mouse model. PLoS One 2014;9:e111428.</cite> [<a href="https://doi.org/10.1371/journal.pone.0111428" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4210182/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/25347197/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=PLoS%20One&title=A%20comparison%20of%20three%20electrophysiological%20methods%20for%20the%20assessment%20of%20disease%20status%20in%20a%20mild%20spinal%20muscular%20atrophy%20mouse%20model&author=J%20Li&author=TR%20Geisbush&author=WD%20Arnold&volume=9&publication_year=2014&pages=e111428&pmid=25347197&doi=10.1371/journal.pone.0111428&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> </ul></section></section><section id="_ad93_" lang="en" class="associated-data"><h2 class="pmc_sec_title">Associated Data</h2> <p class="font-secondary"><em>This section collects any data citations, data availability statements, or supplementary materials included in this article.</em></p> <section id="_adsm93_" lang="en" class="supplementary-materials"><h3 class="pmc_sec_title">Supplementary Materials</h3> <section class="sm xbox font-sm" id="db_ds_supplementary-material1_reqid_"><div class="caption p"> <p> <strong>Table S1.</strong> Enrolling NeuroNEXT sites. Enrolling NeuroNEXT clinical trial sites and NN101 site investigators and staff.</p> <p> <strong>Table S2.</strong> Pearson correlation coefficients between baseline motor function test score and putative SMA biomarkers. Summary table of Pearson correlation coefficients. Shaded rows indicate a correlation with <em>p</em> value that is equal to or less than 0.05.</p> </div> <div class="media p"><div class="caption"> <a href="/articles/instance/4748311/bin/ACN3-3-132-s001.docx" data-ga-action="click_feat_suppl" class="usa-link">Click here for additional data file.</a><sup> (39.8KB, docx) </sup> </div></div></section></section></section></section><footer class="p courtesy-note font-secondary font-sm text-center"><hr class="headless"> <p>Articles from Annals of Clinical and Translational Neurology are provided here courtesy of <strong>Wiley</strong></p></footer></section></article> </main> </div> </div> </div>  <div class="pmc-sidenav desktop:grid-col-4 display-flex"> <section class="pmc-sidenav__container" aria-label="Article resources and navigation"> <button type="button" class="usa-button pmc-sidenav__container__close usa-button--unstyled"> <img src="/static/img/usa-icons/close.svg" role="img" alt="Close" /> </button> <div class="display-none desktop:display-block"> <section class="margin-top-4 desktop:margin-top-0"> <h2 class="margin-top-0">ACTIONS</h2> <ul class="usa-list usa-list--unstyled usa-list--actions"> <li> <a href="https://doi.org/10.1002/acn3.283" class="usa-button usa-button--outline width-24 font-xs usa-link--external padding-left-0 padding-right-0" target="_blank" rel="noreferrer noopener" data-ga-category="actions" data-ga-action="click" data-ga-label="publisher_link_desktop" > <span class="height-3 display-inline-flex flex-align-center">View on publisher site</span> </a> </li> <li> <a href="pdf/ACN3-3-132.pdf" class="usa-button usa-button--outline width-24 display-inline-flex flex-align-center flex-justify-start padding-left-1" data-ga-category="actions" data-ga-action="click" data-ga-label="pdf_download_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1">PDF (481.5 KB)</span> </a> </li> <li> <button role="button" class="usa-button width-24 citation-dialog-trigger display-inline-flex flex-align-center flex-justify-start padding-left-1" aria-label="Open dialog with citation text in different styles" data-ga-category="actions" data-ga-action="open" data-ga-label="cite_desktop" data-all-citations-url="/resources/citations/4748311/" data-citation-style="nlm" data-download-format-link="/resources/citations/4748311/export/" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#format_quote"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 button-label">Cite</span> </button> </li> <li> <button class="usa-button width-24 collections-dialog-trigger collections-button display-inline-flex flex-align-center flex-justify-start padding-left-1 collections-button-empty" aria-label="Save article in MyNCBI collections." data-ga-category="actions" data-ga-action="click" data-ga-label="collections_button_desktop" data-collections-open-dialog-enabled="false" data-collections-open-dialog-url="https://account.ncbi.nlm.nih.gov/?back_url=https%3A%2F%2Fpmc.ncbi.nlm.nih.gov%2Farticles%2FPMC4748311%2F%23open-collections-dialog" data-in-collections="false"> <svg class="usa-icon width-3 height-3 usa-icon--bookmark-full" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-full.svg#icon"></use> </svg> <svg class="usa-icon width-3 height-3 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-empty.svg#icon"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1">Collections</span> </button> </li> <li class="pmc-permalink"> <button type="button" class="usa-button usa-button--outline width-24 display-inline-flex flex-align-center flex-justify padding-left-1 shadow-none" aria-label="Show article permalink" aria-expanded="false" aria-haspopup="true" data-ga-category="actions" data-ga-action="open" data-ga-label="permalink_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#share"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 button-label">Permalink</span> </button> <div class="pmc-permalink__dropdown" hidden> <div class="pmc-permalink__dropdown__container"> <h2 class="usa-modal__heading margin-top-0 margin-bottom-2">PERMALINK</h2> <div class="pmc-permalink__dropdown__content"> <input type="text" class="usa-input" value="https://pmc.ncbi.nlm.nih.gov/articles/PMC4748311/" aria-label="Article permalink"> <button class="usa-button display-inline-flex pmc-permalink__dropdown__copy__btn margin-right-0" title="Copy article permalink" data-ga-category="save_share" data-ga-action="link" data-ga-label="copy_link"> <svg class="usa-icon" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span class="margin-left-1">Copy</span> </button> </div> </div> </div> </li> </ul> </section> </div> <section class="pmc-resources margin-top-6 desktop:margin-top-4" data-page-path="/articles/PMC4748311/"> <h2 class="margin-top-0">RESOURCES</h2> <div class="usa-accordion usa-accordion--multiselectable" data-allow-multiple> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-similar-articles" data-ga-category="resources_accordion" data-ga-action="open_similar_articles" data-ga-label="/articles/PMC4748311/" data-action-open="open_similar_articles" data-action-close="close_similar_articles" > Similar articles </button> </h3> <div id="resources-similar-articles" class="usa-accordion__content usa-prose" data-source-url="/resources/similar-article-links/26900585/" > </div> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-cited-by-other-articles" data-ga-category="resources_accordion" data-ga-action="open_cited_by" data-ga-label="/articles/PMC4748311/" data-action-open="open_cited_by" data-action-close="close_cited_by" > Cited by other articles </button> </h3> <div id="resources-cited-by-other-articles" class="usa-accordion__content usa-prose" data-source-url="/resources/cited-by-links/26900585/" > </div> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-links-to-ncbi-databases" data-ga-category="resources_accordion" data-ga-action="open_NCBI_links" data-ga-label="/articles/PMC4748311/" data-action-open="open_NCBI_links" data-action-close="close_NCBI_link" > Links to NCBI Databases </button> </h3> <div id="resources-links-to-ncbi-databases" class="usa-accordion__content usa-prose" data-source-url="/resources/db-links/4748311/" > </div> </div> </section> <section class="usa-in-page-nav usa-in-page-nav--wide margin-top-6 desktop:margin-top-4" data-title-text="On this page" data-title-heading-level="h2" data-scroll-offset="0" data-root-margin="-10% 0px -80% 0px" data-main-content-selector="main" data-threshold="1" hidden ></section> </section> </div> <div class="overlay" role="dialog" aria-label="Citation Dialog" hidden> <div class="dialog citation-dialog" aria-hidden="true"> <div class="display-inline-flex flex-align-center flex-justify width-full margin-bottom-2"> <h2 class="usa-modal__heading margin-0">Cite</h2> <button type="button" class="usa-button usa-button--unstyled close-overlay text-black width-auto" tabindex="1"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#close"></use> </svg> </button> </div> <div class="citation-text-block"> <div class="citation-text margin-bottom-2"></div> <ul class="usa-list usa-list--unstyled display-inline-flex flex-justify width-full flex-align-center"> <li> <button class="usa-button usa-button--unstyled text-no-underline display-flex flex-align-center copy-button dialog-focus" data-ga-category="save_share" data-ga-action="cite" data-ga-label="copy" tabindex="2"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span>Copy</span> </button> </li> <li> <a href="#" role="button" class="usa-button usa-button--unstyled text-no-underline display-flex flex-align-center export-button" data-ga-category="save_share" data-ga-action="cite" data-ga-label="download" title="Download a file for external citation management software" tabindex="3"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> <span class="display-none mobile-lg:display-inline">Download .nbib</span> <span class="display-inline mobile-lg:display-none">.nbib</span> </a> </li> <li> <div class="display-inline-flex flex-align-center"> <label class="usa-label margin-top-0">Format:</label> <select aria-label="Format" class="usa-select citation-style-selector padding-1 margin-top-0 border-0 padding-right-4" tabindex="4" > <option data-style-url-name="ama" value="AMA" > AMA </option> <option data-style-url-name="apa" value="APA" > APA </option> <option data-style-url-name="mla" value="MLA" > MLA </option> <option data-style-url-name="nlm" value="NLM" selected="selected"> NLM </option> </select> </div> </li> </ul> </div> </div> </div> <div class="overlay" role="dialog" hidden> <div id="collections-action-dialog" class="dialog collections-dialog" aria-hidden="true"> <div class="display-inline-flex flex-align-center flex-justify width-full margin-bottom-2"> <h2 class="usa-modal__heading margin-0">Add to Collections</h2> </div> <div class="collections-action-panel action-panel"> <form id="collections-action-dialog-form" class="usa-form maxw-full collections-action-panel-form action-panel-content action-form action-panel-smaller-selectors" data-existing-collections-url="/list-existing-collections/" data-add-to-existing-collection-url="/add-to-existing-collection/" data-create-and-add-to-new-collection-url="/create-and-add-to-new-collection/" data-myncbi-max-collection-name-length="100" data-collections-root-url="https://www.ncbi.nlm.nih.gov/myncbi/collections/"> <input type="hidden" name="csrfmiddlewaretoken" value="NWaeNWUeXfa8TEe7FyAQjBgNsUu6DTIs2DSaIK6XxLcmwigPvD5lwzgAlcJkNcOT"> <fieldset class="usa-fieldset margin-bottom-2"> <div class="usa-radio"> <input type="radio" id="collections-action-dialog-new" class="usa-radio__input usa-radio__input--tile collections-new margin-top-0" name="collections" value="new" data-ga-category="collections_button" data-ga-action="click" data-ga-label="collections_radio_new" /> <label class="usa-radio__label" for="collections-action-dialog-new">Create a new collection</label> </div> <div class="usa-radio"> <input type="radio" id="collections-action-dialog-existing" class="usa-radio__input usa-radio__input--tile collections-existing" name="collections" value="existing" checked="true" data-ga-category="collections_button" data-ga-action="click" data-ga-label="collections_radio_existing" /> <label class="usa-radio__label" for="collections-action-dialog-existing">Add to an existing collection</label> </div> </fieldset> <fieldset class="usa-fieldset margin-bottom-2"> <div class="action-panel-control-wrap new-collections-controls"> <label for="collections-action-dialog-add-to-new" class="usa-label margin-top-0"> Name your collection <abbr title="required" class="usa-hint usa-hint--required text-no-underline">*</abbr> </label> <input type="text" name="add-to-new-collection" id="collections-action-dialog-add-to-new" class="usa-input collections-action-add-to-new" pattern="[^"&=<>/]*" title="The following characters are not allowed in the Name field: "&=<>/" maxlength="" data-ga-category="collections_button" data-ga-action="create_collection" data-ga-label="non_favorties_collection" required /> </div> <div class="action-panel-control-wrap existing-collections-controls"> <label for="collections-action-dialog-add-to-existing" class="usa-label margin-top-0"> Choose a collection </label> <select id="collections-action-dialog-add-to-existing" class="usa-select collections-action-add-to-existing" data-ga-category="collections_button" data-ga-action="select_collection" data-ga-label="($('.collections-action-add-to-existing').val() === 'Favorites') ? 'Favorites' : 'non_favorites_collection'"> </select> <div class="collections-retry-load-on-error usa-input-error-message selection-validation-message"> Unable to load your collection due to an error<br> <a href="#">Please try again</a> </div> </div> </fieldset> <div class="display-inline-flex"> <button class="usa-button margin-top-0 action-panel-submit" type="submit" data-loading-label="Adding..." data-pinger-ignore data-ga-category="collections_button" data-ga-action="click" data-ga-label="add"> Add </button> <button class="usa-button usa-button--outline margin-top-0 action-panel-cancel" aria-label="Close 'Add to Collections' panel" ref="linksrc=close_collections_panel" data-ga-category="collections_button" data-ga-action="click" data-ga-label="cancel"> Cancel </button> </div> </form> </div> </div> </div> </div> </div> </div> <footer class="ncbi-footer ncbi-dark-background " > <div class="ncbi-footer__icon-section"> <div class="ncbi-footer__social-header"> Follow NCBI </div> <div class="grid-container ncbi-footer__ncbi-social-icons-container"> <a href="https://twitter.com/ncbi" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="40" height="40" viewBox="0 0 40 40" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="m6.067 8 10.81 13.9L6 33.2h4.2l8.4-9.1 7.068 9.1H34L22.8 18.5 31.9 8h-3.5l-7.7 8.4L14.401 8H6.067Zm3.6 1.734h3.266l16.8 21.732H26.57L9.668 9.734Z"> </path> </svg> <span class="usa-sr-only">NCBI on X (formerly known as Twitter)</span> </a> <a href="https://www.facebook.com/ncbi.nlm" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="16" height="29" focusable="false" aria-hidden="true" viewBox="0 0 16 29" fill="none" xmlns="http://www.w3.org/2000/svg"> <path d="M3.8809 21.4002C3.8809 19.0932 3.8809 16.7876 3.8809 14.478C3.8809 14.2117 3.80103 14.1452 3.54278 14.1492C2.53372 14.1638 1.52334 14.1492 0.514288 14.1598C0.302626 14.1598 0.248047 14.0972 0.248047 13.8936C0.256034 12.4585 0.256034 11.0239 0.248047 9.58978C0.248047 9.37013 0.302626 9.30224 0.528931 9.3049C1.53798 9.31688 2.54837 9.3049 3.55742 9.31555C3.80103 9.31555 3.8809 9.26097 3.87957 9.00272C3.87158 8.00565 3.85428 7.00592 3.90753 6.00884C3.97142 4.83339 4.31487 3.73115 5.04437 2.78467C5.93095 1.63318 7.15699 1.09005 8.56141 0.967577C10.5582 0.79319 12.555 0.982221 14.5518 0.927641C14.7102 0.927641 14.7462 0.99287 14.7449 1.13664C14.7449 2.581 14.7449 4.02668 14.7449 5.47104C14.7449 5.67604 14.6517 5.68669 14.4946 5.68669C13.4523 5.68669 12.4113 5.68669 11.3703 5.68669C10.3506 5.68669 9.92057 6.10868 9.90593 7.13904C9.89661 7.7647 9.91525 8.39303 9.89794 9.01869C9.88995 9.26364 9.96583 9.31822 10.2015 9.31688C11.7204 9.30623 13.2393 9.31688 14.7595 9.3049C15.0257 9.3049 15.0723 9.3728 15.0444 9.62439C14.89 10.9849 14.7515 12.3467 14.6144 13.7085C14.5691 14.1571 14.5785 14.1585 14.1458 14.1585C12.8386 14.1585 11.5313 14.1665 10.2254 14.1518C9.95119 14.1518 9.89794 14.2317 9.89794 14.4899C9.90593 19.0799 9.89794 23.6752 9.91125 28.2612C9.91125 28.5674 9.8407 28.646 9.53186 28.6433C7.77866 28.6273 6.02414 28.6366 4.27094 28.634C3.82499 28.634 3.87158 28.6992 3.87158 28.22C3.87602 25.9472 3.87913 23.6739 3.8809 21.4002Z"> </path> </svg> <span class="usa-sr-only">NCBI on Facebook</span> </a> <a href="https://www.linkedin.com/company/ncbinlm" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="25" height="23" viewBox="0 0 26 24" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M14.6983 9.98423C15.6302 9.24808 16.5926 8.74754 17.6762 8.51991C19.673 8.09126 21.554 8.30824 23.1262 9.7526C24.2351 10.7723 24.7529 12.1115 25.0165 13.5612C25.1486 14.3363 25.2105 15.1218 25.2015 15.9081C25.2015 18.3043 25.2015 20.6898 25.2082 23.0806C25.2082 23.3468 25.1549 23.444 24.8621 23.4414C23.1297 23.4272 21.3992 23.4272 19.6704 23.4414C19.4041 23.4414 19.3429 23.3588 19.3442 23.1019C19.3535 20.5194 19.3442 17.9368 19.3442 15.3543C19.3442 14.0005 18.3258 12.9448 17.0266 12.9488C15.7273 12.9528 14.6983 14.0071 14.6983 15.361C14.6983 17.9328 14.6917 20.5047 14.6983 23.0753C14.6983 23.3708 14.6198 23.444 14.3296 23.4427C12.6185 23.4294 10.9079 23.4294 9.19779 23.4427C8.93155 23.4427 8.86099 23.3735 8.86232 23.1086C8.8783 19.7619 8.88628 16.4144 8.88628 13.066C8.88628 11.5688 8.87874 10.0708 8.86365 8.57182C8.86365 8.3575 8.90758 8.27896 9.14054 8.28029C10.9048 8.29094 12.6687 8.29094 14.4321 8.28029C14.6464 8.28029 14.6983 8.34818 14.6983 8.54653C14.6903 9.00047 14.6983 9.45441 14.6983 9.98423Z"> </path> <path d="M6.55316 15.8443C6.55316 18.2564 6.55316 20.6699 6.55316 23.082C6.55316 23.3629 6.48127 23.4388 6.19906 23.4374C4.47737 23.4241 2.75568 23.4241 1.03399 23.4374C0.767751 23.4374 0.69986 23.3629 0.701191 23.1006C0.709178 18.2648 0.709178 13.4281 0.701191 8.59053C0.701191 8.34026 0.765089 8.27237 1.01669 8.2737C2.74991 8.28435 4.48048 8.28435 6.20838 8.2737C6.47462 8.2737 6.5465 8.33627 6.54517 8.6065C6.54783 11.0186 6.55316 13.4308 6.55316 15.8443Z"> </path> <path d="M3.65878 0.243898C5.36804 0.243898 6.58743 1.45529 6.58743 3.1406C6.58743 4.75801 5.32145 5.95742 3.60819 5.96807C3.22177 5.97614 2.83768 5.90639 2.47877 5.76299C2.11985 5.61959 1.79344 5.40546 1.51897 5.13334C1.24449 4.86123 1.02755 4.53668 0.881058 4.17902C0.734563 3.82136 0.661505 3.43788 0.666231 3.05141C0.67555 1.42601 1.9362 0.242566 3.65878 0.243898Z"> </path> </svg> <span class="usa-sr-only">NCBI on LinkedIn</span> </a> <a href="https://github.com/ncbi" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="28" height="27" viewBox="0 0 28 28" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M16.7228 20.6334C17.5057 20.5527 18.2786 20.3944 19.0301 20.1608C21.3108 19.4193 22.5822 17.8259 22.963 15.4909C23.1228 14.5112 23.1814 13.5287 22.9883 12.5437C22.8106 11.6423 22.4013 10.8028 21.8007 10.1076C21.7526 10.0605 21.7197 10 21.7064 9.934C21.6931 9.86799 21.7 9.79952 21.7262 9.73748C22.0856 8.6206 21.9711 7.51969 21.601 6.42677C21.582 6.3497 21.5345 6.2827 21.468 6.23923C21.4016 6.19577 21.3211 6.17906 21.2429 6.19248C20.7329 6.21649 20.2313 6.33051 19.7611 6.52928C19.1103 6.7908 18.4899 7.12198 17.9104 7.51703C17.84 7.56996 17.7581 7.60551 17.6713 7.62078C17.5846 7.63605 17.4954 7.6306 17.4112 7.60489C15.2596 7.05882 13.0054 7.06203 10.8554 7.61421C10.7806 7.63586 10.7018 7.63967 10.6253 7.62534C10.5487 7.611 10.4766 7.57892 10.4148 7.53167C9.64788 7.03247 8.85171 6.58918 7.96368 6.33359C7.65781 6.24338 7.34123 6.19458 7.02239 6.18849C6.94879 6.17986 6.87462 6.19893 6.81432 6.242C6.75402 6.28507 6.71191 6.34904 6.69621 6.42145C6.32342 7.51437 6.2209 8.61527 6.56307 9.73348C6.59635 9.84264 6.64694 9.93316 6.54177 10.0516C5.47666 11.2604 5.09988 12.6834 5.19574 14.2676C5.2663 15.4244 5.46201 16.5466 6.01454 17.5769C6.84399 19.1171 8.21664 19.9119 9.85158 20.3352C10.3938 20.4706 10.9444 20.5698 11.4998 20.632C11.5384 20.7492 11.4506 20.7798 11.408 20.8291C11.1734 21.1179 10.9894 21.4441 10.8634 21.7942C10.7622 22.0458 10.8315 22.4039 10.6065 22.5516C10.263 22.7766 9.83827 22.8485 9.42421 22.8871C8.17936 23.0056 7.26471 22.4877 6.6283 21.4348C6.25552 20.8184 5.76956 20.3325 5.08523 20.0663C4.76981 19.9325 4.42139 19.8967 4.08537 19.9638C3.7898 20.029 3.73788 20.1901 3.93891 20.4111C4.03639 20.5234 4.14989 20.6207 4.27575 20.6999C4.9796 21.1318 5.51717 21.7884 5.80152 22.5636C6.37002 23.9973 7.48039 24.5697 8.93825 24.6323C9.43741 24.6575 9.93768 24.615 10.4254 24.5058C10.5892 24.4672 10.6531 24.4872 10.6517 24.6762C10.6451 25.4936 10.6637 26.3123 10.6517 27.131C10.6517 27.6635 10.1684 27.9297 9.58663 27.7393C8.17396 27.2671 6.84977 26.5631 5.66838 25.656C2.59555 23.2891 0.720966 20.1861 0.217704 16.3376C-0.357453 11.9127 0.911353 8.00824 3.98551 4.73881C6.11909 2.42656 8.99932 0.939975 12.1203 0.540191C16.5351 -0.0601815 20.4347 1.14323 23.7232 4.16373C26.2449 6.47869 27.724 9.37672 28.1048 12.7726C28.5828 17.0325 27.3686 20.7945 24.4768 23.9827C22.9762 25.6323 21.0956 26.8908 18.9982 27.6488C18.8783 27.6927 18.7585 27.738 18.636 27.7726C18.0356 27.9404 17.6189 27.6395 17.6189 27.0098C17.6189 25.7452 17.6308 24.4806 17.6295 23.2159C17.6329 22.9506 17.6128 22.6856 17.5696 22.4238C17.4325 21.6664 17.3419 21.484 16.7228 20.6334Z"> </path> </svg> <span class="usa-sr-only">NCBI on GitHub</span> </a> <a href="https://ncbiinsights.ncbi.nlm.nih.gov/" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="26" height="26" viewBox="0 0 27 27" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M23.7778 26.4574C23.1354 26.3913 22.0856 26.8024 21.636 26.3087C21.212 25.8444 21.4359 24.8111 21.324 24.0347C19.9933 14.8323 14.8727 8.80132 6.09057 5.85008C4.37689 5.28406 2.58381 4.99533 0.779072 4.99481C0.202773 4.99481 -0.0229751 4.83146 0.00455514 4.21479C0.0660406 3.08627 0.0660406 1.95525 0.00455514 0.826734C-0.0413285 0.0815827 0.259669 -0.0193618 0.896534 0.00266238C6.96236 0.222904 12.3693 2.24179 16.9889 6.16209C22.9794 11.2478 26.1271 17.7688 26.4372 25.648C26.4629 26.294 26.3179 26.5271 25.6609 26.4684C25.0827 26.417 24.4991 26.4574 23.7778 26.4574Z"> </path> <path d="M14.8265 26.441C14.0924 26.441 13.2371 26.6795 12.6626 26.3786C12.0092 26.0372 12.3781 25.0644 12.246 24.378C11.1154 18.5324 6.6849 14.5497 0.74755 14.1001C0.217135 14.0615 -0.0104482 13.9422 0.0134113 13.3659C0.0519536 12.1454 0.0482829 10.9213 0.0134113 9.69524C-0.00127145 9.14464 0.196946 9.03268 0.703502 9.04736C9.21217 9.27128 16.5994 16.2511 17.2804 24.7231C17.418 26.4446 17.418 26.4446 15.6579 26.4446H14.832L14.8265 26.441Z"> </path> <path d="M3.58928 26.4555C2.64447 26.4618 1.73584 26.0925 1.06329 25.4289C0.39073 24.7653 0.00933763 23.8617 0.0030097 22.9169C-0.00331824 21.9721 0.365937 21.0635 1.02954 20.3909C1.69315 19.7184 2.59675 19.337 3.54156 19.3306C4.48637 19.3243 5.39499 19.6936 6.06755 20.3572C6.7401 21.0208 7.1215 21.9244 7.12782 22.8692C7.13415 23.814 6.7649 24.7226 6.10129 25.3952C5.43768 26.0677 4.53409 26.4491 3.58928 26.4555Z"> </path> </svg> <span class="usa-sr-only">NCBI RSS feed</span> </a> </div> </div> <div data-testid="gridContainer" class="grid-container ncbi-footer__container"> <div class="grid-row ncbi-footer__main-content-container" data-testid="grid"> <div class="ncbi-footer__column"> <p class="ncbi-footer__circled-icons-heading"> Connect with NLM </p> <div class="ncbi-footer__circled-icons-list"> <a href=https://twitter.com/nlm_nih class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="32" height="32" viewBox="0 0 40 40" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="m6.067 8 10.81 13.9L6 33.2h4.2l8.4-9.1 7.068 9.1H34L22.8 18.5 31.9 8h-3.5l-7.7 8.4L14.401 8H6.067Zm3.6 1.734h3.266l16.8 21.732H26.57L9.668 9.734Z"> </path> </svg> <span class="usa-sr-only">NLM on X (formerly known as Twitter)</span> </a> <a href=https://www.facebook.com/nationallibraryofmedicine class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="13" height="24" viewBox="0 0 13 24" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M4.11371 23.1369C4.11371 23.082 4.11371 23.0294 4.11371 22.9745V12.9411H0.817305C0.6709 12.9411 0.670898 12.9411 0.670898 12.8016C0.670898 11.564 0.670898 10.3287 0.670898 9.09341C0.670898 8.97903 0.705213 8.95158 0.815017 8.95158C1.8673 8.95158 2.91959 8.95158 3.97417 8.95158H4.12057V8.83263C4.12057 7.8055 4.12057 6.7738 4.12057 5.74897C4.1264 4.92595 4.31387 4.11437 4.66959 3.37217C5.12916 2.38246 5.94651 1.60353 6.95717 1.1921C7.64827 0.905008 8.3913 0.764035 9.13953 0.778051C10.0019 0.791777 10.8644 0.830666 11.7268 0.860404C11.8869 0.860404 12.047 0.894717 12.2072 0.90158C12.2964 0.90158 12.3261 0.940469 12.3261 1.02968C12.3261 1.5421 12.3261 2.05452 12.3261 2.56465C12.3261 3.16857 12.3261 3.7725 12.3261 4.37642C12.3261 4.48165 12.2964 4.51367 12.1912 4.51138C11.5369 4.51138 10.8804 4.51138 10.2261 4.51138C9.92772 4.51814 9.63058 4.5526 9.33855 4.61433C9.08125 4.6617 8.84537 4.78881 8.66431 4.97766C8.48326 5.16652 8.3662 5.40755 8.32972 5.66661C8.28476 5.89271 8.26027 6.1224 8.25652 6.35289C8.25652 7.19014 8.25652 8.02969 8.25652 8.86923C8.25652 8.89439 8.25652 8.91955 8.25652 8.95615H12.0219C12.1797 8.95615 12.182 8.95616 12.1614 9.10714C12.0768 9.76596 11.9876 10.4248 11.9029 11.0813C11.8312 11.6319 11.7626 12.1824 11.697 12.733C11.6719 12.9434 11.6787 12.9434 11.4683 12.9434H8.26338V22.899C8.26338 22.979 8.26338 23.0591 8.26338 23.1392L4.11371 23.1369Z"> </path> </svg> <span class="usa-sr-only">NLM on Facebook</span> </a> <a href=https://www.youtube.com/user/NLMNIH class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="21" height="15" viewBox="0 0 21 15" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M19.2561 1.47914C18.9016 1.15888 18.5699 0.957569 17.2271 0.834039C15.5503 0.678484 13.2787 0.655608 11.563 0.65332H9.43556C7.71987 0.65332 5.4483 0.678484 3.77151 0.834039C2.43098 0.957569 2.097 1.15888 1.74242 1.47914C0.813665 2.32097 0.619221 4.62685 0.598633 6.89384C0.598633 7.31781 0.598633 7.74101 0.598633 8.16345C0.626084 10.4121 0.827391 12.686 1.74242 13.521C2.097 13.8412 2.4287 14.0425 3.77151 14.1661C5.4483 14.3216 7.71987 14.3445 9.43556 14.3468H11.563C13.2787 14.3468 15.5503 14.3216 17.2271 14.1661C18.5676 14.0425 18.9016 13.8412 19.2561 13.521C20.1712 12.6929 20.3725 10.451 20.3999 8.22064C20.3999 7.74025 20.3999 7.25986 20.3999 6.77946C20.3725 4.54907 20.1689 2.30724 19.2561 1.47914ZM8.55942 10.5311V4.65201L13.5601 7.50005L8.55942 10.5311Z" fill="white" /> </svg> <span class="usa-sr-only">NLM on YouTube</span> </a> </div> </div> <address class="ncbi-footer__address ncbi-footer__column"> <p> <a class="usa-link usa-link--external" href="https://www.google.com/maps/place/8600+Rockville+Pike,+Bethesda,+MD+20894/%4038.9959508, -77.101021,17z/data%3D!3m1!4b1!4m5!3m4!1s0x89b7c95e25765ddb%3A0x19156f88b27635b8!8m2!3d38.9959508! 4d-77.0988323" rel="noopener noreferrer" target="_blank">National Library of Medicine <br/> 8600 Rockville Pike<br/> Bethesda, MD 20894</a> </p> </address> <ul class="usa-list usa-list--unstyled ncbi-footer__vertical-list ncbi-footer__column"> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/web_policies.html" class="usa-link usa-link--alt ncbi-footer__link" > Web Policies </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nih.gov/institutes-nih/nih-office-director/office-communications-public-liaison/freedom-information-act-office" class="usa-link usa-link--alt ncbi-footer__link" > FOIA </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.hhs.gov/vulnerability-disclosure-policy/index.html" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > HHS Vulnerability Disclosure </a> </li> </ul> <ul class="usa-list usa-list--unstyled ncbi-footer__vertical-list ncbi-footer__column"> <li class="ncbi-footer__vertical-list-item"> <a href="https://support.nlm.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > Help </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/accessibility.html" class="usa-link usa-link--alt ncbi-footer__link" > Accessibility </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/careers/careers.html" class="usa-link usa-link--alt ncbi-footer__link" > Careers </a> </li> </ul> </div> <div class="grid-row grid-col-12" data-testid="grid"> <ul class="ncbi-footer__bottom-links-list"> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.nlm.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > NLM </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > NIH </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.hhs.gov/" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > HHS </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.usa.gov/" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > USA.gov </a> </li> </ul> </div> </div> </footer> <script type="text/javascript" src="https://cdn.ncbi.nlm.nih.gov/core/pinger/pinger.js"> </script> <button class="back-to-top" data-ga-category="pagination" data-ga-action="back_to_top"> <label>Back to Top</label> <svg class="usa-icon order-0" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#arrow_upward"></use> </svg> </button> <script src="https://code.jquery.com/jquery-3.5.0.min.js" integrity="sha256-xNzN2a4ltkB44Mc/Jz3pT4iU1cmeR0FkXs4pru/JxaQ=" crossorigin="anonymous"> </script> <script type="text/javascript">var exports = {};</script> <script src="/static/CACHE/js/output.13b077bc3ffd.js"></script> <script type="application/javascript"> window.ncbi = window.ncbi || {}; window.ncbi.pmc = window.ncbi.pmc || {}; window.ncbi.pmc.options = { logLevel: 'INFO', staticEndpoint: '/static/', citeCookieName: 'pmc-cf', }; </script> <script type="module" crossorigin="" src="/static/assets/base-9bea7450.js"></script> <script type="module" crossorigin="" src="/static/assets/article-722d91a2.js"></script> </body> </html>

CINXE.COM

Baseline results of the NeuroNEXT spinal muscular atrophy infant biomarker study - PMC