CINXE.COM

<!DOCTYPE html> <html lang="en" dir="ltr"> <head>  <script async src="https://www.googletagmanager.com/gtag/js?id=G-P63WKM1TM1"></script> <script> window.dataLayer = window.dataLayer || []; function gtag(){dataLayer.push(arguments);} gtag('js', new Date()); gtag('config', 'G-P63WKM1TM1'); </script>  <script type="text/javascript" > (function(m,e,t,r,i,k,a){m[i]=m[i]||function(){(m[i].a=m[i].a||[]).push(arguments)}; m[i].l=1*new Date(); for (var j = 0; j < document.scripts.length; j++) {if (document.scripts[j].src === r) { return; }} k=e.createElement(t),a=e.getElementsByTagName(t)[0],k.async=1,k.src=r,a.parentNode.insertBefore(k,a)}) (window, document, "script", "https://mc.yandex.ru/metrika/tag.js", "ym"); ym(55165297, "init", { clickmap:false, trackLinks:true, accurateTrackBounce:true, webvisor:false }); </script> <noscript><div><img src="https://mc.yandex.ru/watch/55165297" style="position:absolute; left:-9999px;" alt="" /></div></noscript>    <title>Search results for: insecticide resistance</title> <meta name="description" content="Search results for: insecticide resistance"> <meta name="keywords" content="insecticide resistance"> <meta name="viewport" content="width=device-width, initial-scale=1, minimum-scale=1, maximum-scale=1, user-scalable=no"> <meta charset="utf-8"> <link href="https://cdn.waset.org/favicon.ico" type="image/x-icon" rel="shortcut icon"> <link href="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/css/bootstrap.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/plugins/fontawesome/css/all.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/css/site.css?v=150220211555" rel="stylesheet"> </head> <body> <header> <div class="container"> <nav class="navbar navbar-expand-lg navbar-light"> <a class="navbar-brand" href="https://waset.org"> <img src="https://cdn.waset.org/static/images/wasetc.png" alt="Open Science Research Excellence" title="Open Science Research Excellence" /> </a> <button class="d-block d-lg-none navbar-toggler ml-auto" type="button" data-toggle="collapse" data-target="#navbarMenu" aria-controls="navbarMenu" aria-expanded="false" aria-label="Toggle navigation"> <span class="navbar-toggler-icon"></span> </button> <div class="w-100"> <div class="d-none d-lg-flex flex-row-reverse"> <form method="get" action="https://waset.org/search" class="form-inline my-2 my-lg-0"> <input class="form-control mr-sm-2" type="search" placeholder="Search Conferences" value="insecticide resistance" name="q" aria-label="Search"> <button class="btn btn-light my-2 my-sm-0" type="submit"><i class="fas fa-search"></i></button> </form> </div> <div class="collapse navbar-collapse mt-1" id="navbarMenu"> <ul class="navbar-nav ml-auto align-items-center" id="mainNavMenu"> <li class="nav-item"> <a class="nav-link" href="https://waset.org/conferences" title="Conferences in 2024/2025/2026">Conferences</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/disciplines" title="Disciplines">Disciplines</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/committees" rel="nofollow">Committees</a> </li> <li class="nav-item dropdown"> <a class="nav-link dropdown-toggle" href="#" id="navbarDropdownPublications" role="button" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"> Publications </a> <div class="dropdown-menu" aria-labelledby="navbarDropdownPublications"> <a class="dropdown-item" href="https://publications.waset.org/abstracts">Abstracts</a> <a class="dropdown-item" href="https://publications.waset.org">Periodicals</a> <a class="dropdown-item" href="https://publications.waset.org/archive">Archive</a> </div> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/page/support" title="Support">Support</a> </li> </ul> </div> </div> </nav> </div> </header> <main> <div class="container mt-4"> <div class="row"> <div class="col-md-9 mx-auto"> <form method="get" action="https://publications.waset.org/abstracts/search"> <div id="custom-search-input"> <div class="input-group"> <i class="fas fa-search"></i> <input type="text" class="search-query" name="q" placeholder="Author, Title, Abstract, Keywords" value="insecticide resistance"> <input type="submit" class="btn_search" value="Search"> </div> </div> </form> </div> </div> <div class="row mt-3"> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Commenced</strong> in January 2007</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Frequency:</strong> Monthly</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Edition:</strong> International</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Paper Count:</strong> 3324</div> </div> </div> </div> <h1 class="mt-3 mb-3 text-center" style="font-size:1.6rem;">Search results for: insecticide resistance</h1> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3324</span> Insecticide Resistance Detection on Dengue Vector, Aedes albopictus Obtained from Kapit, Kuching and Sibu Districts in Sarawak State, Malaysia</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Koon%20Weng%20Lau">Koon Weng Lau</a>, <a href="https://publications.waset.org/abstracts/search?q=Chee%20Dhang%20Chen"> Chee Dhang Chen</a>, <a href="https://publications.waset.org/abstracts/search?q=Abdul%20Aziz%20Azidah"> Abdul Aziz Azidah</a>, <a href="https://publications.waset.org/abstracts/search?q=Mohd%20Sofian-Azirun"> Mohd Sofian-Azirun</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Recently, Sarawak state of Malaysia encounter an outbreak of dengue fever. Aedes albopictus has incriminated as one of the important vectors of dengue transmission. Without an effective vaccine, approaches to control or prevent dengue will be a focus on the vectors. The control of Aedes mosquitoes is still dependent on the use of chemical insecticides and insecticide resistance represents a threat to the effectiveness of vector control. This study was conducted to determine the resistance status of 11 active ingredients representing four major insecticide classes: DDT, dieldrin, malathion, fenitrothion, bendiocarb, propoxur, etofenprox, deltamethrin, lambda-cyhalothrin, cyfluthrin, and permethrin. Standard WHO test procedures were conducted to determine the insecticide susceptibility. Aedes albopictus collected from Kapit (resistance ratio, RR = 1.04–3.02), Kuching (RR = 1.17–4.61), and Sibu (RR = 1.06–3.59) exhibited low resistance toward all insecticides except dieldrin. This study reveled that dieldrin is still effective against Ae. albopictus, followed by fenitrothion, cyfluthrin, and deltamethrin. In conclusion, Ae. albopictus in Sarawak exhibited different resistance levels toward various insecticides and alternative solutions should be implemented to prevent further deterioration of the condition. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Aedes%20albopictus" title="Aedes albopictus">Aedes albopictus</a>, <a href="https://publications.waset.org/abstracts/search?q=dengue" title=" dengue"> dengue</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=Malaysia" title=" Malaysia"> Malaysia</a> </p> <a href="https://publications.waset.org/abstracts/33656/insecticide-resistance-detection-on-dengue-vector-aedes-albopictus-obtained-from-kapit-kuching-and-sibu-districts-in-sarawak-state-malaysia" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/33656.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">354</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3323</span> Benzpyrimoxan: An Insecticide for the Control of Rice Plant Hoppers</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=E.%20Satoh">E. Satoh</a>, <a href="https://publications.waset.org/abstracts/search?q=R.%20Kasahara"> R. Kasahara</a>, <a href="https://publications.waset.org/abstracts/search?q=T.%20Aoki"> T. Aoki</a>, <a href="https://publications.waset.org/abstracts/search?q=K.%20Fukatsu"> K. Fukatsu</a>, <a href="https://publications.waset.org/abstracts/search?q=D.%20Venkata%20Ramanarao"> D. Venkata Ramanarao</a>, <a href="https://publications.waset.org/abstracts/search?q=H.%20Harayama"> H. Harayama</a>, <a href="https://publications.waset.org/abstracts/search?q=T.%20Murata"> T. Murata</a>, <a href="https://publications.waset.org/abstracts/search?q=A.%20Suwa"> A. Suwa</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Rice plant hoppers (Hemiptera: Delphacidae) have been causing extensive economic damage in rice and are considered as serious threat in rice producing countries of Asia. They have developed resistance to major groups of chemical insecticide, and severe outbreaks occur commonly throughout Asia. To control these nuisance pests, Nihon Nohyaku Co., Ltd., recently discovered an insecticide, benzpyrimoxan (proposed ISO name), which is under development as NNI-1501 (development code). Benzpyrimoxan has a unique chemical structure which contains benzyloxy and cyclic acetal groups on pyrimidine moiety (5-(1,3-dioxan-2-yl)-4-[4- (trifluoromethyl)benzyloxy]pyrimidine). In order to clarify the biological properties of benzpyrimoxan, we conducted several experiments and found the following results. Benzpyrimoxan has high activity against nymphal stages of rice plant hoppers without any adulticidal activity. It provides excellent and long lasting control against rice plant hoppers, including populations that have developed resistance to several other chemical groups of insecticide. The study on its mode of action is undergoing. These features highlight the versatility of this insecticide as an effective and valuable tool from the viewpoints of insecticide resistance management and integrated pest management program. With the use of benzpyrimoxan, farmers shall be able to lead the best yield potential by keeping the population density of rice plant hoppers and associated virus diseases under control. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=acetal" title="acetal">acetal</a>, <a href="https://publications.waset.org/abstracts/search?q=benzpyrimoxan" title=" benzpyrimoxan"> benzpyrimoxan</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide" title=" insecticide"> insecticide</a>, <a href="https://publications.waset.org/abstracts/search?q=NNI-1501" title=" NNI-1501"> NNI-1501</a>, <a href="https://publications.waset.org/abstracts/search?q=pyrimidine" title=" pyrimidine"> pyrimidine</a>, <a href="https://publications.waset.org/abstracts/search?q=rice%20plant%20hoppers" title=" rice plant hoppers"> rice plant hoppers</a> </p> <a href="https://publications.waset.org/abstracts/63842/benzpyrimoxan-an-insecticide-for-the-control-of-rice-plant-hoppers" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/63842.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">209</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3322</span> Creating Risk Maps on the Spatiotemporal Occurrence of Agricultural Insecticides in Sub-Saharan Africa</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Chantal%20Hendriks">Chantal Hendriks</a>, <a href="https://publications.waset.org/abstracts/search?q=Harry%20Gibson"> Harry Gibson</a>, <a href="https://publications.waset.org/abstracts/search?q=Anna%20Trett"> Anna Trett</a>, <a href="https://publications.waset.org/abstracts/search?q=Penny%20Hancock"> Penny Hancock</a>, <a href="https://publications.waset.org/abstracts/search?q=Catherine%20Moyes"> Catherine Moyes</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The use of modern inputs for crop protection, such as insecticides, is strongly underestimated in Sub-Saharan Africa. Several studies measured toxic concentrations of insecticides in fruits, vegetables and fish that were cultivated in Sub-Saharan Africa. The use of agricultural insecticides has impact on human and environmental health, but it also has the potential to impact on insecticide resistance in malaria transmitting mosquitos. To analyse associations between historic use of agricultural insecticides and the distribution of insecticide resistance through space and time, the use and environmental fate of agricultural insecticides needs to be mapped through the same time period. However, data on the use and environmental fate of agricultural insecticides in Africa are limited and therefore risk maps on the spatiotemporal occurrence of agricultural insecticides are created using environmental data. Environmental data on crop density and crop type were used to select the areas that most likely receive insecticides. These areas were verified by a literature review and expert knowledge. Pesticide fate models were compared to select most dominant processes that are involved in the environmental fate of insecticides and that can be mapped at a continental scale. The selected processes include: surface runoff, erosion, infiltration, volatilization and the storing and filtering capacity of soils. The processes indicate the risk for insecticide accumulation in soil, water, sediment and air. A compilation of all available data for traces of insecticides in the environment was used to validate the maps. The risk maps can result in space and time specific measures that reduce the risk of insecticide exposure to non-target organisms. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=crop%20protection" title="crop protection">crop protection</a>, <a href="https://publications.waset.org/abstracts/search?q=pesticide%20fate" title=" pesticide fate"> pesticide fate</a>, <a href="https://publications.waset.org/abstracts/search?q=tropics" title=" tropics"> tropics</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a> </p> <a href="https://publications.waset.org/abstracts/99182/creating-risk-maps-on-the-spatiotemporal-occurrence-of-agricultural-insecticides-in-sub-saharan-africa" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/99182.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">141</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3321</span> Insecticide Resistance Detection on Filarial Vector, Simulium (Simulium) nobile (Diptera: Simuliidae) in Malaysia</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Chee%20Dhang%20Chen">Chee Dhang Chen</a>, <a href="https://publications.waset.org/abstracts/search?q=Hiroyuki%20Takaoka"> Hiroyuki Takaoka</a>, <a href="https://publications.waset.org/abstracts/search?q=Koon%20Weng%20Lau"> Koon Weng Lau</a>, <a href="https://publications.waset.org/abstracts/search?q=Poh%20Ruey%20Tan"> Poh Ruey Tan</a>, <a href="https://publications.waset.org/abstracts/search?q=Ai%20Chdon%20Chin"> Ai Chdon Chin</a>, <a href="https://publications.waset.org/abstracts/search?q=Van%20Lun%20Low"> Van Lun Low</a>, <a href="https://publications.waset.org/abstracts/search?q=Abdul%20Aziz%20Azidah"> Abdul Aziz Azidah</a>, <a href="https://publications.waset.org/abstracts/search?q=Mohd%20Sofian-Azirun"> Mohd Sofian-Azirun</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Susceptibility status of Simulium (Simulium) nobile (Diptera: Simuliidae) adults obtained from Pahang, Malaysia was evaluated against 11 adulticides representing four major insecticide classes: organochlorines (DDT, dieldrin), organophosphates (malathion, fenitrothion), carbamates (bendiocarb, propoxur) and pyrethroids (etofenprox, deltamethrin, lambdacyhalothrin, permethrin, cyfluthrin). The adult bioassay was conducted according to WHO standard protocol to determine the insecticide susceptibility. Mortality at 24 h post treatment was used as indicator for susceptibility status. The results revealed that S. nobile obtained was susceptible to propoxur, cyfluthrin and bendiocarb with 100% mortality. S. nobile was resistant or exhibited some tolerant against lambdacyhalothrin and deltamethrin with mortality ranged ≥ 90% but < 98%. S. nobile populations in Pahang exhibited different level of resistant against 11 adulticides with mortality ranged from 60.00 ± 10.00 to 100.00 ± 0.00. In conclusion, S. nobile populations in Pahang were susceptible to propoxur, cyfluthrin and bendiocarb. The susceptibility status of S. nobile in descending order was propoxur, cyfluthrin > bendicarb > deltamethrin > lambdacyhalothrin > permethrin > etofenprox > DDT > malathion > fenitrothion > dieldrin. Regular surveys should be conducted to monitor the susceptibility status of this insect vector in order to prevent further development of resistance. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=black%20fly" title="black fly">black fly</a>, <a href="https://publications.waset.org/abstracts/search?q=adult%20bioassay" title=" adult bioassay"> adult bioassay</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=Malaysia" title=" Malaysia"> Malaysia</a> </p> <a href="https://publications.waset.org/abstracts/47792/insecticide-resistance-detection-on-filarial-vector-simulium-simulium-nobile-diptera-simuliidae-in-malaysia" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/47792.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">273</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3320</span> Multiple Insecticide Resistance in Culex quinquefasciatus Say, from Siliguri, West Bengal, India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Minu%20Bharati">Minu Bharati</a>, <a href="https://publications.waset.org/abstracts/search?q=Priyanka%20Rai"> Priyanka Rai</a>, <a href="https://publications.waset.org/abstracts/search?q=Satarupa%20Dutta"> Satarupa Dutta</a>, <a href="https://publications.waset.org/abstracts/search?q=Dhiraj%20Saha"> Dhiraj Saha</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Culex quinquefasciatus Say, is a mosquito of immense public health concern due to its role in transmission of filariasis, which is an endemic disease in 20 states and union territories of India, putting about 600 million people at the risk of infection. The main strategies to control filaria in India include anti-larval measures in urban areas, Indoor Residual Spray (IRS) in rural areas and mass diethylcarbamazine citrate (DEC) administration. Larval destruction measures and IRS are done with the use of insecticides. In this study, Susceptibility/ Resistance to insecticides were assessed in Culex quinquefasciatus mosquitoes collected from eight densely populated areas of Siliguri subdivision, which has a high rate of filarial infection. To unveil the insecticide susceptibility status of Culex quinquefasciatus, bioassays were performed on field-caught mosquitoes against two major groups of insecticides, i.e. Synthetic Pyrethroids (SPs): 0.05% deltamethrin and 0.05% lambda-cyhalothrin and Organophosphates (OPs): 5% malathion and temephos using World Health Organisation (WHO) discriminating doses. The knockdown rates and knockdown times (KDT50) were also noted against deltamethrin, lambda-cyhalothrin and malathion. Also, activities of major detoxifying enzymes, i.e. α-carboxylesterases, β-carboxylesterases and cytochrome P450 (CYP450) monooxygenases were determined to find the involvement of biochemical mechanisms in resistance phenomenon (if any). The results obtained showed that, majority of the mosquito populations were moderately to severely resistant against both the SPs and one OP, i.e. temephos. Whereas, most of the populations showed 100% susceptibility to malathion. The knockdown rates and KDT50 in response to above-mentioned insecticides showed significant variation among different populations. Variability in activities of carboxylesterases and CYP450 monooxygenases were also observed with hints of their involvement in contribution towards insecticide resistance in some of the tested populations. It may be concluded that, Culex quinquefasciatus has started developing resistance against deltamethrin, lambda-cyhalothrin and temephos in Siliguri subdivision. Malathion seems to hold the greatest potentiality for control of these mosquitoes in this area as revealed through this study. Adoption of Integrated mosquito management (IMM) strategy should be the prime objective of the concerned authorities to delimit the insecticide resistance phenomenon and filariasis infections. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Culex%20quinquefasciatus" title="Culex quinquefasciatus">Culex quinquefasciatus</a>, <a href="https://publications.waset.org/abstracts/search?q=detoxifying%20enzymes" title=" detoxifying enzymes"> detoxifying enzymes</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=knockdown%20rate" title=" knockdown rate"> knockdown rate</a> </p> <a href="https://publications.waset.org/abstracts/72552/multiple-insecticide-resistance-in-culex-quinquefasciatus-say-from-siliguri-west-bengal-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/72552.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">255</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3319</span> Bioefficacy of Novel Insecticide Flupyradifurone Sl 200 against Leaf Hoppers, Aphids and Whitefly in Cotton</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=N.%20V.%20V.%20S.%20D.%20Prasad">N. V. V. S. D. Prasad</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Field experiments were conducted at Regional Agricultural Research Station, Lam, Guntur, Andhra Pradesh, India for two seasons during 2011-13 to evaluate the efficacy of flupyradifurone SL 200 a new class of insecticide in butenolide group against leaf hoppers, aphids and whitefly in Cotton. The test insecticide flupyradifurone 200 was evaluated at three doses @ 150, 200 and 250 g ai/ha ha along with imidacloprid 200 SL @ 20g ai/ha, acetamiprid 20 SP @ 20g ai/ha, thiamethoxam 25 WG @ 25g ai/ha and monocrotophos 36 SL @ 360 g ai/ha as standards. Flupyradifurone SL 200 even at lower dose of 150g ai/ha exhibited superior efficacy against cotton leafhopper, Amrasca devastans than the neonicotinoids which are widely used for control of sucking pests in cotton. Against cotton aphids, Aphis gossypii. Flupyradifurone SL 200 @ 200 and 250 g ai/ha ha was proved to be effective and the lower dose @ 150g ai/ha performed better than some of the neonicotinoids. The effect of flupyradifurone SL 200 on cotton against whitefly, Bemisia tabaci was evident at higher doses of 200 and 250 g ai/ha and superior to all standard treatments, however, the lower dose is at par with neonicotinoids. The seed cotton yield of flupyradifurone 200 SL at all the doses tested was superior than imidacloprid 200 SL @ 20g ai/ha and acetamiprid 20 SP @ 20g ai/ha. There is no significant difference among the insecticidal treatments with regards to natural enemies. The results clearly suggest that flupyradifurone is a new tool to combat sucking pest problems in cotton and can well fit in IRM strategies in light of wide spread insecticide resistance in cotton sucking pests. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cotton" title="cotton">cotton</a>, <a href="https://publications.waset.org/abstracts/search?q=flupyradifurone" title=" flupyradifurone"> flupyradifurone</a>, <a href="https://publications.waset.org/abstracts/search?q=neonicotinoids" title=" neonicotinoids"> neonicotinoids</a>, <a href="https://publications.waset.org/abstracts/search?q=sucking%20pests" title=" sucking pests"> sucking pests</a> </p> <a href="https://publications.waset.org/abstracts/77184/bioefficacy-of-novel-insecticide-flupyradifurone-sl-200-against-leaf-hoppers-aphids-and-whitefly-in-cotton" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/77184.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">192</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3318</span> Insecticide Efficacy against Jassids in Egg Plants</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Zunnu%20Raen%20Akhtar">Zunnu Raen Akhtar</a>, <a href="https://publications.waset.org/abstracts/search?q=Farhan%20Ali"> Farhan Ali</a>, <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Saeed-Ur-Rehman"> Muhammad Saeed-Ur-Rehman</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Jassids are considered as serious sucking pests in eggplants. Jassids can be controlled using imidacloprid, but it can also result in non-target ecological impacts on eco-system. It can also result in reduced population of predators of jassids in the field. An experiment was conducted on jassids, Amrasca sp. reared on eggplant leaves were treated with insecticide imidacloprid at lower, recommended and higher doses including 1L, 2L, 3L respectively. 3rd instar larvae and adults of jassids were exposed to lower, recommended, higher doses. Mortality tests were repeated three times for each dose and insect growth stage. Imidacloprid was sprayed on the leaves followed by drying. Data was recorded for 4, 8, 12, 16, 20, 24 hours after spraying insecticide on the leaves. Results showed that higher mortality was observed in higher and recommended doses, while slow mortality was observed in the case of lower dose. It can be asserted that higher and recommended doses causing immediate mortality of insects are better to control Amrasca sp. in the field, it will not cause immediate resistance development in insects against imidacloprid. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Amrasca%20sp." title="Amrasca sp.">Amrasca sp.</a>, <a href="https://publications.waset.org/abstracts/search?q=imidacloprid" title=" imidacloprid"> imidacloprid</a>, <a href="https://publications.waset.org/abstracts/search?q=egg%20plant" title=" egg plant"> egg plant</a>, <a href="https://publications.waset.org/abstracts/search?q=efficacy" title=" efficacy"> efficacy</a> </p> <a href="https://publications.waset.org/abstracts/74423/insecticide-efficacy-against-jassids-in-egg-plants" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/74423.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">225</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3317</span> Biodegrading Potentials of Plant Growth - Promoting Bacteria on Insecticides Used in Agricultural Soil</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Chioma%20Nwakanma">Chioma Nwakanma</a>, <a href="https://publications.waset.org/abstracts/search?q=Onyeka%20Okoh%20Irene"> Onyeka Okoh Irene</a>, <a href="https://publications.waset.org/abstracts/search?q=Emmanuel%20Eze"> Emmanuel Eze</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Pesticide residues left in agricultural soils after cropping are always accumulative, difficult to degrade and harmful to animals, plants, soil and human health in general. The biodegrading potential of pesticides- resistant PGPB on soil pollution was investigated using in situ remediation technique following recommended standards. In addition, screening for insecticide utilization, maximum insecticide concentration tolerance, insecticide biodegradation and insecticide residues analyses via gas chromatographic/electron column detector were determined. The location of bacterial degradation genes was also determined. Three plant growth-promoting rhizophere (PGPR) were isolated and identified according to 16S rRNA as Paraburkholderia tropica, Burkolderia glumae and Achromobacter insolitus. From the results, all the three isolates showed phosphate solubilizing traits and were able to grow on nitrogen free medium. The isolates were able to utilize the insecticide as sole carbon source and increase in biomass. They were statistically significantly tolerant to all the insecticide concentrations screened. The gas chromatographic profiles of the insecticide residues showed a reduction in the peak areas of the insecticides, indicating degradation. The bacterial consortium had the lowest peak areas, showing the highest degradation efficiency. The genes responsible for degradation were found to be in the plasmids of the isolates. Therefore, the use of PGPR is recommended for bioremediation of agricultural soil insecticide polluted areas and can also enhance soil fertility. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=biodegradation" title="biodegradation">biodegradation</a>, <a href="https://publications.waset.org/abstracts/search?q=rhizosphere" title=" rhizosphere"> rhizosphere</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticides%20utilization" title=" insecticides utilization"> insecticides utilization</a>, <a href="https://publications.waset.org/abstracts/search?q=agricultural%20soil" title=" agricultural soil"> agricultural soil</a> </p> <a href="https://publications.waset.org/abstracts/164308/biodegrading-potentials-of-plant-growth-promoting-bacteria-on-insecticides-used-in-agricultural-soil" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/164308.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">114</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3316</span> Baseline Data for Insecticide Resistance Monitoring in Tobacco Caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae) on Cole Crops</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Prabhjot%20Kaur">Prabhjot Kaur</a>, <a href="https://publications.waset.org/abstracts/search?q=B.K.%20Kang"> B.K. Kang</a>, <a href="https://publications.waset.org/abstracts/search?q=Balwinder%20Singh"> Balwinder Singh</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae) is an agricultural important pest species. S. litura has a wide host range of approximately recorded 150 plant species worldwide. In Punjab, this pest attains sporadic status primarily on cauliflower, Brassica oleracea (L.). This pest destroys vegetable crop and particularly prefers the cruciferae family. However, it is also observed feeding on other crops such as arbi, Colocasia esculenta (L.), mung bean, Vigna radiata (L.), sunflower, Helianthus annuus (L.), cotton, Gossypium hirsutum (L.), castor, Ricinus communis (L.), etc. Larvae of this pest completely devour the leaves of infested plant resulting in huge crop losses which ranges from 50 to 70 per cent. Indiscriminate and continuous use of insecticides has contributed in development of insecticide resistance in insects and caused the environmental degradation as well. Moreover, a base line data regarding the toxicity of the newer insecticides would help in understanding the level of resistance developed in this pest and any possible cross-resistance there in, which could be assessed in advance. Therefore, present studies on development of resistance in S. litura against four new chemistry insecticides (emamectin benzoate, chlorantraniliprole, indoxacarb and spinosad) were carried out in the Toxicology laboratory, Department of Entomology, Punjab Agricultural University, Ludhiana, Punjab, India during the year 2011-12. Various stages of S. litura (eggs, larvae) were collected from four different locations (Malerkotla, Hoshiarpur, Amritsar and Samrala) of Punjab. Resistance is developed in third instars of lepidopterous pests. Therefore, larval bioassays were conducted to estimate the response of field populations of thirty third-instar larvae of S. litura under laboratory conditions at 25±2°C and 65±5 per cent relative humidity. Leaf dip bioassay technique with diluted insecticide formulations recommended by Insecticide Resistance Action Committee (IRAC) was performed in the laboratory with seven to ten treatments depending on the insecticide class, respectively. LC50 values were estimated by probit analysis after correction to record control mortality data which was used to calculate the resistance ratios (RR). The LC50 values worked out for emamectin benzoate, chlorantraniliprole, indoxacarb, spinosad are 0.081, 0.088, 0.380, 4.00 parts per million (ppm) against pest populations collected from Malerkotla; 0.051, 0.060, 0.250, 3.00 (ppm) of Amritsar; 0.002, 0.001, 0.0076, 0.10 ppm for Samrala and 0.000014, 0.00001, 0.00056, 0.003 ppm against pest population of Hoshiarpur, respectively. The LC50 values for populations collected from these four locations were in the order Malerkotla>Amritsar>Samrala>Hoshiarpur for the insecticides (emamectin benzoate, chlorantraniliprole, indoxacarb and spinosad) tested. Based on LC50 values obtained, emamectin benzoate (0.000014 ppm) was found to be the most toxic among all the tested populations, followed by chlorantraniliprole (0.00001 ppm), indoxacarb (0.00056 ppm) and spinosad (0.003 ppm), respectively. The pairwise correlation coefficients of LC50 values indicated that there was lack of cross resistance for emamectin benzoate, chlorantraniliprole, spinosad, indoxacarb in populations of S. litura from Punjab. These insecticides may prove to be promising substitutes for the effective control of insecticide resistant populations of S. litura in Punjab state, India. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Spodoptera%20litura" title="Spodoptera litura">Spodoptera litura</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticides" title=" insecticides"> insecticides</a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity" title=" toxicity"> toxicity</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance" title=" resistance"> resistance</a> </p> <a href="https://publications.waset.org/abstracts/6194/baseline-data-for-insecticide-resistance-monitoring-in-tobacco-caterpillar-spodoptera-litura-fabricius-lepidoptera-noctuidae-on-cole-crops" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/6194.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">342</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3315</span> Effect of Botanical and Synthetic Insecticide on Different Insect Pests and Yield of Pea (Pisum sativum)</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Saeed">Muhammad Saeed</a>, <a href="https://publications.waset.org/abstracts/search?q=Nazeer%20Ahmed"> Nazeer Ahmed</a>, <a href="https://publications.waset.org/abstracts/search?q=Mukhtar%20Alam"> Mukhtar Alam</a>, <a href="https://publications.waset.org/abstracts/search?q=Fazli%20Subhan"> Fazli Subhan</a>, <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Adnan"> Muhammad Adnan</a>, <a href="https://publications.waset.org/abstracts/search?q=Fazli%20Wahid"> Fazli Wahid</a>, <a href="https://publications.waset.org/abstracts/search?q=Hidayat%20Ullah"> Hidayat Ullah</a>, <a href="https://publications.waset.org/abstracts/search?q=Rafiullah"> Rafiullah</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The present experiment evaluated different synthetic insecticides against Jassid (Amrasca devastations) on pea crop at Agriculture Research Institute Tarnab, Peshawar Khyber Pakhtunkhwa. The field was prepared to cultivate okra crop in Randomized Complete Block (RCB) Design having six treatments with four replications. Plant to plant and row to row distance was kept at 15 cm and 30 cm, respectively. Pre and post spray data were recorded randomly from the top, middle and bottom leaves of five selected plants. Five synthetic insecticides, namely Confidor (Proponil), a neonicotinoid insecticide, Chlorpyrifos (chlorinated organophosphate (OP) insecticide), Lazer (dinitroaniline) (Pendimethaline), Imidacloprid (neonicotinoids insecticide) and Thiodan (Endosulfan, organochlorine insecticide), were used against infestation of aphids, pea pod borer, stem fly, leaf minor and pea weevil. Each synthetic insecticide showed significantly more effectiveness than control (untreated plots) but was non-significant among each other. The lowest population density was recorded in the plot treated with synthetic insecticide i.e. Confidor (0.6175 liter.ha-1) (4.24 aphids plant⁻¹) which is followed by Imidacloprid (0.6175 liter.ha⁻¹) (4.64 pea pod borer plant⁻¹), Thiodan (1.729 liter.ha⁻¹) (4.78 leaf minor plant⁻¹), Lazer (2.47 liter.ha-1) (4.91 pea weevil plant⁻¹), Chlorpyrifos (1.86 liter.ha⁻¹) (5.11 stem fly plant⁻¹), respectively while the highest population was recorded from the control plot. It is concluded from the data that the residual effect decreases with time after the application of spray, which may be less dangerous to the environment and human beings and can effectively manage this dread. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=okra%20crop" title="okra crop">okra crop</a>, <a href="https://publications.waset.org/abstracts/search?q=jassids" title=" jassids"> jassids</a>, <a href="https://publications.waset.org/abstracts/search?q=Confidor" title=" Confidor"> Confidor</a>, <a href="https://publications.waset.org/abstracts/search?q=imidacloprid" title=" imidacloprid"> imidacloprid</a>, <a href="https://publications.waset.org/abstracts/search?q=chlorpyrifos" title=" chlorpyrifos"> chlorpyrifos</a>, <a href="https://publications.waset.org/abstracts/search?q=laser" title=" laser"> laser</a>, <a href="https://publications.waset.org/abstracts/search?q=Thiodan" title=" Thiodan"> Thiodan</a> </p> <a href="https://publications.waset.org/abstracts/147696/effect-of-botanical-and-synthetic-insecticide-on-different-insect-pests-and-yield-of-pea-pisum-sativum" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/147696.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">83</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3314</span> Effective of Different Doses of Bacterial Insecticide Against Trogoderma Granarium (Everts)</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Fatima%20Huda%20Hallak">Fatima Huda Hallak</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The current study aimed to evaluate the activity of bacterial insecticide Vertinic against the second star larvae of Trogoderma granarium (Everts) by four treatments: A, B, C, D, at seven concentrations: 0.001, 0.01, 0.1,1,10,100,1000 PPM. The mortality rate of larvae was 100% at concentrations 10 and 100 in treatments A and B after 24 hours and after 48 hours in treatment D at 1 PPM. The efficiency of treatment A was greater as compared to treatment B at all concentrations and all exposure times. The efficiency of treatment D was greater as compared to treatment C; for example, at 0.001, 0.01, 0.1, 1 PPM, after 120 hours, the Mortality rate of larve was 6.76, 13.33, 43.33, 100% in treatment D, which it was 0.00, 0.00, 23.33, 96.67%, respectively in the treatment C. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=bacterial%20insecticide" title="bacterial insecticide">bacterial insecticide</a>, <a href="https://publications.waset.org/abstracts/search?q=trogoderma%20granarium%20%28everts%29" title=" trogoderma granarium (everts)"> trogoderma granarium (everts)</a>, <a href="https://publications.waset.org/abstracts/search?q=fourth%20star%20larvae" title=" fourth star larvae"> fourth star larvae</a>, <a href="https://publications.waset.org/abstracts/search?q=vertimic" title=" vertimic"> vertimic</a> </p> <a href="https://publications.waset.org/abstracts/183232/effective-of-different-doses-of-bacterial-insecticide-against-trogoderma-granarium-everts" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/183232.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">51</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3313</span> Current Status of Mosquitoes Vector Research and Control in Iran</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Seyed%20Hassan%20Moosa-kazemi">Seyed Hassan Moosa-kazemi</a>, <a href="https://publications.waset.org/abstracts/search?q=Hassan%20Vatandoost"> Hassan Vatandoost</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Malaria, Dirofilaria immitis (dog heart worm), and D. repens (dirofilariasis), which are transmitted by mosquitoes, have been reported in Iran. The Iranian mosquito fauna includes seven genera, 65 species, and three subspecies. Aedes albopictus has been reported since. West Nile, Sindbis, Dengue, Japanese encephalitis viruses, and the nematode Setaria (setariasis) has been reported in the country but there are no information about their vectors in Iran. Iran is malaria elimination phase. Insecticides residual spraying (IRS), distributed of insecticides long lasting treated nets (ITNs), fogging, release of larvivours fishes and Bacillus thuringiensis, chemical larviciding, as well as case finding and manipulation and modification of breeding places carried out thought the IVM program in the country. Prolonged exposure to insecticides over several generations of the vectors, develop resistance, a capacity to survive contact with insecticides. However, use of insecticides in agriculture has often been implicated as contributing to resistance in mosquito’s vectors. Resistance of mosquitoes to some insecticides has been documented just within a few years after the insecticides were introduced. Some enzymes such as monooxygenases, esterases and glutathione S-transferases have been considered as a reason for resistance to pyrethroid insecticides. In conclusion, regarding to documented resistance and tolerance of mosquitoes vectors to some insecticides, resistance management is suggested by using new insecticide with novel mode of action. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=control" title="control">control</a>, <a href="https://publications.waset.org/abstracts/search?q=Iran" title=" Iran"> Iran</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance" title=" resistance"> resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=vector" title=" vector"> vector</a> </p> <a href="https://publications.waset.org/abstracts/38715/current-status-of-mosquitoes-vector-research-and-control-in-iran" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/38715.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">303</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3312</span> Evaluation of Acetylcholinesterase, Glutathione S-Transferase and Catalase Activities in the Land Snail Helix aspersa Exposed to Thiamethoxam</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ait%20Hamlet%20Smina">Ait Hamlet Smina</a>, <a href="https://publications.waset.org/abstracts/search?q=Bensoltane%20Samira"> Bensoltane Samira</a>, <a href="https://publications.waset.org/abstracts/search?q=Djekoun%20Mohamed"> Djekoun Mohamed</a>, <a href="https://publications.waset.org/abstracts/search?q=Berrebbah%20Houria"> Berrebbah Houria</a> </p> <p class="card-text"><strong>Abstract:</strong></p> In Algeria, the use of insecticides and other phytosanitary products are considerably spreading with the development of agriculture. But, the analyses of the residues of pesticides are not systematically made. In this context, we estimated through an experimental study, the effect of a neonicotinoid insecticide, the thiamethoxam which is used as a commercial preparation on the land snail Helix aspersa. This snail is one of the most abundant gastropod in North-East Algeria. Little information is available in the literature concerning the study of the biochemical markers of mollusks which are exposed to insecticides and especially, thiamethoxam.In this work, adult snails Helix aspersa were used to estimate the effect of a neonicotinoid insecticide (thiamethoxam) on the acetylcholinesterase (AChE), glutathione S-transferase (GST) and catalase (CAT) activities in this gastropod after a treatment of 6 weeks. During this period, snails were exposed by ingestion and contact to fresh lettuce leaves which were soaked with an insecticide solution. The thiamethoxam test solutions were 0, 25, 50, 100 and 200 mg/L, which are lower or equal to the concentrations that are applied in field. The results showed that the enzymatic activities of AChE and GST and CAT increased significantly with a dose-dependent manner. These results confirmed the toxic effect of thiamethoxam on snails exposed to the lettuce contaminated with this neonicotinoid insecticide, likely to be used as biomarker of exposure, at first to thiamethoxam then to other insecticides belonging to the same chemical family, currently present in the environment. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=helix%20aspersa" title="helix aspersa">helix aspersa</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide" title=" insecticide"> insecticide</a>, <a href="https://publications.waset.org/abstracts/search?q=thiamethoxam" title=" thiamethoxam"> thiamethoxam</a>, <a href="https://publications.waset.org/abstracts/search?q=AChE" title=" AChE"> AChE</a>, <a href="https://publications.waset.org/abstracts/search?q=GST" title=" GST"> GST</a>, <a href="https://publications.waset.org/abstracts/search?q=CAT" title=" CAT "> CAT </a> </p> <a href="https://publications.waset.org/abstracts/13086/evaluation-of-acetylcholinesterase-glutathione-s-transferase-and-catalase-activities-in-the-land-snail-helix-aspersa-exposed-to-thiamethoxam" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/13086.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">452</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3311</span> Studies on Knockdown Resistance Mutations in Aedes aegypti and Aedes albopictus in India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Neera%20Kapoor">Neera Kapoor</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Background: Knockdown Resistance (KDR) is one of the mechanisms of insecticide resistance in insects caused by the reduced target site sensitivity i.e. voltage gated sodium channel (VGSC) rendering it less sensitive to the toxic effects of DDT and pyrethroids. In this study, we evaluated insecticide susceptibility and its underlying KDR mechanism in eight Ae. aegypti and five Ae. albopictus field populations. Methodology: Field population was collected from four different geographical regions of India covering 18 districts of ten states. For genotyping of twelve KDR alleles in Ae. aegypti field populations, three PCR based assays were used; with DNA sequencing; ASPCR; PCR-RFLP. Genomic DNA was isolated, and three partial domains (II, III, and IV) of VGSC were amplified and sequenced. Results: Molecular screening for common KDR mutations, revealed the presence of five mutations viz. S989P, V1016G, T1520I, F1534C/L. Two novel mutations were observed, first at T1520 (ACC) residue where a C > T substitution at the second position of codon results in amino acid change to Isoleucine (ATC). Second mutation was an alternative point mutation at F1534 (TTC) residue where a substitution of T > C at the first position of codon results in an amino acid change to Leucine (CTC). ASPCRs were not accurate, so three PCR-RFLP assays were developed for genotyping of five KDR alleles in Ae. aegypti; viz. T1520I, F1534C/L. Representative samples of all genotypes (n=200) were sequenced to validate the newly developed PCR based assays for Ae. aegypti. Genotyping results showed that 989P is linked to 1016G and novel mutation 1520I was always found with 1534C allele. Conclusion: Present study confirmed the presence of DDT and pyrethroid resistance among Ae. aegypti populations in India and for the first time reported KDR mutations in this species from India including two novel mutations. Results of present study lead us to infer that, at least five KDR mutations (S989P, V1016G, T1530I, F1534C, and F1534L) can be seen as a potential marker for DDT/pyrethroid resistance. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=F1534C" title="F1534C">F1534C</a>, <a href="https://publications.waset.org/abstracts/search?q=F1534L" title=" F1534L"> F1534L</a>, <a href="https://publications.waset.org/abstracts/search?q=S989P" title=" S989P"> S989P</a>, <a href="https://publications.waset.org/abstracts/search?q=T1530I" title=" T1530I"> T1530I</a>, <a href="https://publications.waset.org/abstracts/search?q=V1016G" title=" V1016G"> V1016G</a> </p> <a href="https://publications.waset.org/abstracts/74533/studies-on-knockdown-resistance-mutations-in-aedes-aegypti-and-aedes-albopictus-in-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/74533.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">193</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3310</span> Variation in Carboxylesterase Activity in Spodoptera litura Fabricious (Noctuidae: Lepidoptera) Populations from India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=V.%20Karuppaiah">V. Karuppaiah</a>, <a href="https://publications.waset.org/abstracts/search?q=J.%20C.%20Padaria"> J. C. Padaria</a>, <a href="https://publications.waset.org/abstracts/search?q=C.%20Srivastava"> C. Srivastava</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura Fab (Lepidoptera: Noctuidae) is a polyphagous pest various field and horticulture crops in India. Pest had virtually developed resistance to all commonly used insecticides. Enhanced detoxification is the prime mechanism that is dictated by detoxification different enzymes and carboxylesterase is one of the major enzyme responsible development of resistance. In India, insecticide resistance studies on S. litura are mainly deployed on detoxification enzymes activity and investigation at gene level alteration i.e. at nucleotide level is very merger. In the present study, we collected the S. litura larvae from three different cauliflower growing belt viz., IARI, New Delhi (Delhi), Palari, Sonepat (Haryana) and Varanasi (Uttar Pradesh) to study the role of carboxylesterase activity and its gene level variation The CarE activity was measured using UV-VIS spectrophotometer with 3rd instar larvae of S. litura. The elevated activity of CarE was observed in Sonepat strain (28.09 ± 0.09 µmol/min/mg of protein) followed by Delhi (26.72 ± 0.04 µmol/min/mg of protein) and Varanasi strain (10.00 ± 0.44 µmol/min/mg of protein) of S. litura. The genomic DNA was isolated from 3rd instar larvae and CarE gene was amplified using a primer sequence, F:5’tccagagttccttgtcaggcac3’; R:5’ctgcatcaagcatgtctc3. CarE gene, about 500bp was partially amplified, sequenced and submitted to NCBI (Accession No. KF835886, KF835887 and KF835888). The sequence data revealed polymorphism at nucleotide level in all the three strains and gene found to have 88 to 97% similarity with previous available nucleotide sequences of S. litura, S. littoralis and S. exiqua. The polymorphism at the nucleotide level could be a reason for differential activity of carboxylesterase enzymes among the strains. However, investigation at gene expression level would be useful to analyze the overproduction of carboxylesterase enzyme. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=carboxylesterase" title="carboxylesterase">carboxylesterase</a>, <a href="https://publications.waset.org/abstracts/search?q=CarE%20gene" title=" CarE gene"> CarE gene</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide%20polymorphism" title=" nucleotide polymorphism"> nucleotide polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a> </p> <a href="https://publications.waset.org/abstracts/13619/variation-in-carboxylesterase-activity-in-spodoptera-litura-fabricious-noctuidae-lepidoptera-populations-from-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/13619.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">922</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3309</span> Genetic Diversity of Exon-20 of the IIS6 of the Voltage Gated Sodium Channel Gene from Pyrethroid Resistant Anopheles Mosquitoes in Sudan Savannah Region of Jigawa State</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Asma%27u%20Mahe">Asma'u Mahe</a>, <a href="https://publications.waset.org/abstracts/search?q=Abdullahi%20A.%20Imam"> Abdullahi A. Imam</a>, <a href="https://publications.waset.org/abstracts/search?q=Adamu%20J.%20Alhassan"> Adamu J. Alhassan</a>, <a href="https://publications.waset.org/abstracts/search?q=Nasiru%20Abdullahi"> Nasiru Abdullahi</a>, <a href="https://publications.waset.org/abstracts/search?q=Sadiya%20A.%20Bichi"> Sadiya A. Bichi</a>, <a href="https://publications.waset.org/abstracts/search?q=Nura%20Lawal"> Nura Lawal</a>, <a href="https://publications.waset.org/abstracts/search?q=Kamaluddeen%20Babagana"> Kamaluddeen Babagana</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Malaria is a disease with global health significance. It is caused by parasites and transmitted by Anopheles mosquitoes. Increase in insecticide resistance threatens the disease vector control. The strength of selection pressure acting on a mosquito population in relation to insecticide resistance can be assess by determining the genetic diversity of a fragment spanning exon- 20 of IIS6 of the voltage gated sodium channel (VGSC). Larval samples reared to adulthood were identified and kdr (knock down resistance) profile was determined. The DNA sequences were used to assess the patterns of genetic differentiation by determining the levels of genetic variability between the Anopheles mosquitoes. Genetic differentiation of the Anopheles mosquitoes based on a portion of the voltage gated sodium channel gene was obtained. Polymorphisms were detected; sequence variation and analysis were presented as a phylogenetic tree. Phylogenetic tree of VGSC haplotypes was constructed for samples of the Anopheles mosquitoes using the maximum likelihood method in MEGA 6.0 software. DNA sequences were edited using BioEdit sequence editor. The edited sequences were aligned with reference sequence (Kisumu strain). Analyses were performed as contained in dnaSP 5.10. Results of genetic parameters of polymorphism and haplotype reconstruction were presented in count. Twenty sequences were used for the analysis. Regions selected were 1- 576, invariable (monomorphic) sites were 460 while variable (polymorphic) sites were 5 giving the number of total mutations observed in this study. Mutations obtained from the study were at codon 105: TTC- Phenylalanine replaces TCC- Serine, codon 513: TAG- Termination replaces TTG- Leucine, codon 153, 300 and 553 mutations were non-synonymous. From the constructed phylogenetic tree, some groups were shown to be closer with Exon20Gambiae Kisumu (Reference strain) having some genetic distance, while 5-Exon20Gambiae-F I13.ab1, 18-Exon20Gambiae-F C17.ab1, and 2-Exon20Gambiae-F C13.ab1 clustered together genetically differentiated away from others. Mutations observed in this study can be attributed to the high insecticide resistance profile recorded in the study areas. Haplotype networks of pattern of genetic variability and polymorphism for the fragment of the VGSC sequences of sampled Anopheles mosquitoes revealed low haplotypes for the present study. Haplotypes are set of closely linked DNA variation on X-chromosome. Haplotypes were scaled accordingly to reflect their respective frequencies. Low haplotype number, four VGSC-1014F haplotypes were observed in this study. A positive association was previously established between low haplotype number of VGSC diversity and pyrethroid resistance through kdr mechanism. Significant values at (P < 0.05) of Tajima D and Fu and Li D’ were observed for some of the results indicating possible signature of positive selection on the fragment of VGSC in the study. This is the first report of VGSC-1014F in the study site. Based on the results, the mutation was present in low frequencies. However, the roles played by the observed mutations need further investigation. Mutations, environmental factors among others can affect genetic diversity. The study area has recorded increase in insecticide resistance that can affect vector control in the area. This finding might affect the efforts made against malaria. Sequences were deposited in GenBank for Accession Number. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=anopheles%20mosquitoes" title="anopheles mosquitoes">anopheles mosquitoes</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=kdr" title=" kdr"> kdr</a>, <a href="https://publications.waset.org/abstracts/search?q=malaria" title=" malaria"> malaria</a>, <a href="https://publications.waset.org/abstracts/search?q=voltage%20gated%20sodium%20channel" title=" voltage gated sodium channel"> voltage gated sodium channel</a> </p> <a href="https://publications.waset.org/abstracts/183431/genetic-diversity-of-exon-20-of-the-iis6-of-the-voltage-gated-sodium-channel-gene-from-pyrethroid-resistant-anopheles-mosquitoes-in-sudan-savannah-region-of-jigawa-state" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/183431.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">63</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3308</span> Pyrethroid Resistance and Its Mechanism in Field Populations of the Sand Termite, Psammotermes hypostoma Desneux</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Mai.%20M.%20Toughan">Mai. M. Toughan</a>, <a href="https://publications.waset.org/abstracts/search?q=Ahmed%20A.%20A.%20Sallam"> Ahmed A. A. Sallam</a>, <a href="https://publications.waset.org/abstracts/search?q=Ashraf%20O.%20Abd%20El-Latif"> Ashraf O. Abd El-Latif</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Termites are eusocial insects that are found on all continents except Antarctica. Termites have serious destructive impact, damaging local huts and crops of poor subsistence. The annual cost of termite damage and its control is determined in the billions globally. In Egypt, most of these damages are due to the subterranean termite species especially the sand termite, <em>P. hypostoma</em>. Pyrethroids became the primary weapon for subterranean termite control, after the use of chlorpyrifos as a soil termiticide was banned. Despite the important role of pyrethroids in termite control, its extensive use in pest control led to the eventual rise of insecticide resistance which may make many of the pyrethroids ineffective. The ability to diagnose the precise mechanism of pyrethroid resistance in any insect species would be the key component of its management at specified location for a specific population. In the present study, detailed toxicological and biochemical studies was conducted on the mechanism of pyrethroid resistance in <em>P. hypostoma</em>. The susceptibility of field populations of <em>P. hypostoma</em> against deltamethrin, α-cypermethrin and ƛ-cyhalothrin was evaluated. The obtained results revealed that the workers of <em>P. hypostoma</em> have developed high resistance level against the tested pyrethroids. Studies carried out through estimation of detoxification enzyme activity indicated that enhanced esterase and cytochrome P450 activities were probably important mechanisms for pyrethroid resistance in field populations. Elevated esterase activity and also additional esterase isozyme were observed in the pyrethroid-resistant populations compared to the susceptible populations. Strong positive correlation between cytochrome P450 activity and pyrethroid resistance was also reported. |Deltamethrin could be recommended as a resistance-breaking pyrethroid that is active against resistant populations of <em>P. hypostoma.</em> <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Psammotermes%20hypostoma" title="Psammotermes hypostoma">Psammotermes hypostoma</a>, <a href="https://publications.waset.org/abstracts/search?q=pyrethroid%20resistance" title=" pyrethroid resistance"> pyrethroid resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=esterase" title=" esterase"> esterase</a>, <a href="https://publications.waset.org/abstracts/search?q=cytochrome%20P450" title=" cytochrome P450"> cytochrome P450</a> </p> <a href="https://publications.waset.org/abstracts/71638/pyrethroid-resistance-and-its-mechanism-in-field-populations-of-the-sand-termite-psammotermes-hypostoma-desneux" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/71638.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">175</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3307</span> Role of ABC Transporters in Non-Target Site Herbicide Resistance in Black Grass (Alopecurus myosuroides)</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Alina%20Goldberg%20Cavalleri">Alina Goldberg Cavalleri</a>, <a href="https://publications.waset.org/abstracts/search?q=Sara%20Franco%20Ortega"> Sara Franco Ortega</a>, <a href="https://publications.waset.org/abstracts/search?q=Nawaporn%20Onkokesung"> Nawaporn Onkokesung</a>, <a href="https://publications.waset.org/abstracts/search?q=Richard%20Dale"> Richard Dale</a>, <a href="https://publications.waset.org/abstracts/search?q=Melissa%20Brazier-Hicks"> Melissa Brazier-Hicks</a>, <a href="https://publications.waset.org/abstracts/search?q=Robert%20%20Edwards"> Robert Edwards</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Non-target site based resistance (NTSR) to herbicides in weeds is a polygenic trait associated with the upregulation of proteins involved in xenobiotic detoxification and translocation we have termed the xenome. Among the xenome proteins, ABC transporters play a key role in enhancing herbicide metabolism by effluxing conjugated xenobiotics from the cytoplasm into the vacuole. The importance of ABC transporters is emphasized by the fact that they often contribute to multidrug resistance in human cells and antibiotic resistance in bacteria. They also play a key role in insecticide resistance in major vectors of human diseases and crop pests. By surveying available databases, transcripts encoding ABCs have been identified as being enhanced in populations exhibiting NTSR in several weed species. Based on a transcriptomics data in black grass (Alopecurus myosuroides, Am), we have identified three proteins from the ABC-C subfamily that are upregulated in NTSR populations. ABC-C transporters are poorly characterized proteins in plants, but in Arabidopsis localize to the vacuolar membrane and have functional roles in transporting glutathionylated (GSH)-xenobiotic conjugates. We found that the up-regulation of AmABCs strongly correlates with the up-regulation of a glutathione transferase termed AmGSTU2, which can conjugate GSH to herbicides. The expression profile of the ABC transcripts was profiled in populations of black grass showing different degree of resistance to herbicides. This, together with a phylogenetic analysis, revealed that AmABCs cluster in different groups which might indicate different substrate and roles in the herbicide resistance phenotype in the different populations <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=black%20grass" title="black grass">black grass</a>, <a href="https://publications.waset.org/abstracts/search?q=herbicide" title=" herbicide"> herbicide</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance" title=" resistance"> resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=transporters" title=" transporters "> transporters </a> </p> <a href="https://publications.waset.org/abstracts/124743/role-of-abc-transporters-in-non-target-site-herbicide-resistance-in-black-grass-alopecurus-myosuroides" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/124743.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">155</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3306</span> The Effect of Aromatherapy Candle as Insecticide from Citrus Extract of Lemongrass (Cymbopogon) to Increase Ae. aegypti Mortality</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Nurul%20Hidayah">Nurul Hidayah</a>, <a href="https://publications.waset.org/abstracts/search?q=Farida%20Rahmatika"> Farida Rahmatika</a>, <a href="https://publications.waset.org/abstracts/search?q=Fathimah%20Azzahra"> Fathimah Azzahra</a>, <a href="https://publications.waset.org/abstracts/search?q=Nesty%20Herennadia"> Nesty Herennadia</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Aromatherapy candles are one of the insecticide media that have not been much researched. The active ingredient that is proven to have the effect of insecticide is a citrus extract from lemongrass oil (Cymbopogon). Aromatherapy candles are added by citrus compounds to be insecticidal for Ae. aegypti mosquito that was related to the infectious disease such as dengue fever. This research aims to find out if aromatherapy candles of citrus compounds have an insecticidal effect on Ae. aegypti mosquito. We used true experimental design including posttest only with control group design. The samples are 20 male and female Ae. aegypti mosquitos with aged 1-7 days belong to the inclusion criteria. The subjects were divided into 6 groups, consisting of 1 negative control group and 5 treatment groups with variation concentration are 1%; 2%; 3%; 4%; 5%. Each group will be treated for 2 hours and observed death after 24 hours. Replication in each group is done 4 times. The results were then tested statistically using Kruskal-Wallis and probit test. Mean of death in negative control group, and treatment group 1%; 2%; 3%; 4%; 5% respectively 0; 1; 0.25; 0; 1 and 1 mosquito. The Kruskal-Wallis test in the study group found no significant difference (p = 0.178). The probit analysis showed that LC50 and LC90 were 20.069% and 31.557%. The aromatherapy candle of a citrus compound has an insecticidal effect on the Ae aegypti mosquito. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ae.%20aegypti%20insecticide" title="Ae. aegypti insecticide">Ae. aegypti insecticide</a>, <a href="https://publications.waset.org/abstracts/search?q=aromatherapy%20candle" title=" aromatherapy candle"> aromatherapy candle</a>, <a href="https://publications.waset.org/abstracts/search?q=citrus%20compound" title=" citrus compound"> citrus compound</a>, <a href="https://publications.waset.org/abstracts/search?q=lemongrass%20oil%20%28Cymbopogon%29" title=" lemongrass oil (Cymbopogon)"> lemongrass oil (Cymbopogon)</a> </p> <a href="https://publications.waset.org/abstracts/83514/the-effect-of-aromatherapy-candle-as-insecticide-from-citrus-extract-of-lemongrass-cymbopogon-to-increase-ae-aegypti-mortality" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/83514.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">189</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3305</span> Development of a New Characterization Method to Analyse Cypermethrin Penetration in Wood Material by Immunolabelling</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Sandra%20Tapin-Lingua">Sandra Tapin-Lingua</a>, <a href="https://publications.waset.org/abstracts/search?q=Katia%20Ruel"> Katia Ruel</a>, <a href="https://publications.waset.org/abstracts/search?q=Jean-Paul%20Joseleau"> Jean-Paul Joseleau</a>, <a href="https://publications.waset.org/abstracts/search?q=Daouia%20Messaoudi"> Daouia Messaoudi</a>, <a href="https://publications.waset.org/abstracts/search?q=Olivier%20Fahy"> Olivier Fahy</a>, <a href="https://publications.waset.org/abstracts/search?q=Michel%20Petit-Conil"> Michel Petit-Conil</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The preservative efficacy of organic biocides is strongly related to their capacity of penetration and retention within wood tissues. The specific detection of the pyrethroid insecticide is currently obtained after extraction followed by chemical analysis by chromatography techniques. However visualizing the insecticide molecule within the wood structure requires specific probes together with microscopy techniques. Therefore, the aim of the present work was to apply a new methodology based on antibody-antigen recognition and electronic microscopy to visualize directly pyrethroids in the wood material. A polyclonal antibody directed against cypermethrin was developed and implement it on Pinus sylvestris wood samples coated with technical cypermethrin. The antibody was tested on impregnated wood and the specific recognition of the insecticide was visualized in transmission electron microscopy (TEM). The immunogold-TEM assay evidenced the capacity of the synthetic biocide to penetrate in the wood. The depth of penetration was measured on sections taken at increasing distances from the coated surface of the wood. Such results correlated with chemical analyzes carried out by GC-ECD after extraction. In addition, the immuno-TEM investigation allowed visualizing, for the first time at the ultrastructure scale of resolution, that cypermethrin was able to diffuse within the secondary wood cell walls. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cypermethrin" title="cypermethrin">cypermethrin</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide" title=" insecticide"> insecticide</a>, <a href="https://publications.waset.org/abstracts/search?q=wood%20penetration" title=" wood penetration"> wood penetration</a>, <a href="https://publications.waset.org/abstracts/search?q=wood%20retention" title=" wood retention"> wood retention</a>, <a href="https://publications.waset.org/abstracts/search?q=immuno-transmission%20electron%20microscopy" title=" immuno-transmission electron microscopy"> immuno-transmission electron microscopy</a>, <a href="https://publications.waset.org/abstracts/search?q=polyclonal%20antibody" title=" polyclonal antibody"> polyclonal antibody</a> </p> <a href="https://publications.waset.org/abstracts/36690/development-of-a-new-characterization-method-to-analyse-cypermethrin-penetration-in-wood-material-by-immunolabelling" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/36690.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">413</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3304</span> Entomopathogenic Bacteria as Biological Control Agents: Review Paper</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Tadesse%20Kebede%20Dabsu">Tadesse Kebede Dabsu</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Insect pest is one the major limiting factor for sustainable food production. To overtake insect pest problem, since Second World War, producers have used excessive insecticide for insect pest management. However, in the era of 21st Century, the excessive use of insecticide caused insect resistant, insecticide bioaccumulation, insecticide hazard to environment, human health problem, and the like. Due to these problems, research efforts have been focused on the development of environmental free sustainable insect pest management method. To minimize all above mentioned risk utilizing of biological control such as entomopathogenicmicroorganism include bacteria, virus, fungus, and their productsare the best option for suppress insect population below certain density level. The objective of this review was to review the updated available studies and recent developments on the entomopathogenic bacteria (EPB) as biological control of insect pest and challenge of using them for control of insect pest. EPB’s mechanisms of insecticidal activities, type, taxonomy, and history are included in this paper body. EPB has been successfully used for the suppression of populations of insect pests. Controlling of harmful insect by entomopathogenic bacteria is an effective, low bioaccumulation in environment and food, very specific, reduce resistance risk in insect pest, economically and sustainable method of major insect pest management method. Identified and reported as potential major common type of entomopathogenic bacteria include Bacillus thuringiensis, Photorhabdus sp., Xenorhabdus spp.Walbachiaspp, Actinomycetesspp.etc. These bacteria being enter into insect body through natural opening or by vector release toxin protein inside of insect and disrupt the cell’s content cause natural mortality under natural condition. As per reported by different scientists, insect orders like Lepidoptera, Hemiptera, Hymenoptera, Coleoptera, and Dipterahave been successful controlled by entomopathogenic bacteria. As per coming across in different scientific research journals, much of the work was emphasised on Bacillus thuringiensisbsp. Therefore, for commercial production like Bacillus thuringiensi, detail research should be done on other bacteria species. The efficacy and practical application of EPB are restricted to some crops and greenhouse area, but their field application at farmers’ level very less. So still much work needs to be done to the practical application of the EPB at widely application. Their efficacy, pathogenicity, and host range test should be tested under environmental condition. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=insect%20pest" title="insect pest">insect pest</a>, <a href="https://publications.waset.org/abstracts/search?q=entomopathogenic%20bacteria" title=" entomopathogenic bacteria"> entomopathogenic bacteria</a>, <a href="https://publications.waset.org/abstracts/search?q=biological%20control" title=" biological control"> biological control</a>, <a href="https://publications.waset.org/abstracts/search?q=agent" title=" agent"> agent</a> </p> <a href="https://publications.waset.org/abstracts/145140/entomopathogenic-bacteria-as-biological-control-agents-review-paper" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/145140.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">139</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3303</span> Selection Effects on the Molecular and Abiotic Evolution of Antibiotic Resistance</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Abishek%20Rajkumar">Abishek Rajkumar</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Antibiotic resistance can occur naturally given the selective pressure placed on antibiotics. Within a large population of bacteria, there is a significant chance that some of those bacteria can develop resistance via mutations or genetic recombination. However, a growing public health concern has arisen over the fact that antibiotic resistance has increased significantly over the past few decades. This is because humans have been over-consuming and producing antibiotics, which has ultimately accelerated the antibiotic resistance seen in these bacteria. The product of all of this is an ongoing race between scientists and the bacteria as bacteria continue to develop resistance, which creates even more demand for an antibiotic that can still terminate the newly resistant strain of bacteria. This paper will focus on a myriad of aspects of antibiotic resistance in bacteria starting with how it occurs on a molecular level and then focusing on the antibiotic concentrations and how they affect the resistance and fitness seen in bacteria. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antibiotic" title="antibiotic">antibiotic</a>, <a href="https://publications.waset.org/abstracts/search?q=molecular" title=" molecular"> molecular</a>, <a href="https://publications.waset.org/abstracts/search?q=mutation" title=" mutation"> mutation</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance" title=" resistance"> resistance</a> </p> <a href="https://publications.waset.org/abstracts/66066/selection-effects-on-the-molecular-and-abiotic-evolution-of-antibiotic-resistance" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/66066.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">323</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3302</span> Resistance of Field Populations of Rhipicephalus bursa (Acari:Ixodidae) to Lambda-Cyhalothrin Acaricide in Mazandaran Province, North of Iran</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Seyyed%20Payman%20Ziapour">Seyyed Payman Ziapour</a>, <a href="https://publications.waset.org/abstracts/search?q=Ahmadali%20Enayati"> Ahmadali Enayati</a>, <a href="https://publications.waset.org/abstracts/search?q=Sadegh%20Kheiri"> Sadegh Kheiri</a>, <a href="https://publications.waset.org/abstracts/search?q=Farzaneh%20Sahraei-Rostami"> Farzaneh Sahraei-Rostami</a>, <a href="https://publications.waset.org/abstracts/search?q=Reza%20Ali%20Mohammadpour"> Reza Ali Mohammadpour</a>, <a href="https://publications.waset.org/abstracts/search?q=Mahmoud%20Fazeli-Dinan"> Mahmoud Fazeli-Dinan</a>, <a href="https://publications.waset.org/abstracts/search?q=Mohsen%20Aarabi"> Mohsen Aarabi</a>, <a href="https://publications.waset.org/abstracts/search?q=Fatemeh%20Asgarian"> Fatemeh Asgarian</a>, <a href="https://publications.waset.org/abstracts/search?q=Seyed%20Hassan%20Nikookar"> Seyed Hassan Nikookar</a>, <a href="https://publications.waset.org/abstracts/search?q=Mohammad%20Sarafrazi"> Mohammad Sarafrazi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Rhipicephalus bursa (R. bursa) is a two-host ixodid tick with wide distribution in north of Iran especially in domestic animals of Mazandaran Province. The prolonged or incorrect use of chemical insecticides has led to build up of resistance in hard ticks in many areas of the world. Lack of basic information on resistance status of R. bursa was the reason behind this study to determine the susceptibility status of the species to lambda-cyhalothrin insecticide in Mazandaran Province. From May 2013 to March 2014, R. bursa ticks were collected on sheep, goat and cattle in different districts of Mazandaran Province. The engorged female ticks were reared in a controlled insectary for producing 12-18 days old larvae for larval packet test (LPT) bioassay against discriminant doses of lambda-cyhalothrin 5% EC (MAC SILAT®). 80% of ten pooled tick populations were susceptible to lambda-cyhalothrin as resistance ratios (RR50s) varied from 1 to 2.94 when compared with the most susceptible population NH-16. Only GK-12 and BF-6 populations (from plain areas of Galugah and Fereydunkenar Counties, respectively) were classified as resistant level I at LC50 level. Population NK-2 (from woodland areas of Kojour district in Nowshahr County) showed the highest resistance ratio of RR99 = 4.32 and 30% of tick populations were resistant at LC99 level. Our research showed initiation of lambda-cyhalothrin resistance in Rhipicephalus bursa populations in Mazandaran Province, Northern Iran. This is considered a warning to policy makers for disease control in the study area. This research is a part of the PhD thesis of SP. Ziapour by grant No. 92-89 in Student Research Committee, Mazandaran University of Medical Sciences, Iran. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Rhipicephalus%20bursa" title="Rhipicephalus bursa">Rhipicephalus bursa</a>, <a href="https://publications.waset.org/abstracts/search?q=hard%20tick" title=" hard tick"> hard tick</a>, <a href="https://publications.waset.org/abstracts/search?q=lambda-cyhalothrin%20resistance" title=" lambda-cyhalothrin resistance"> lambda-cyhalothrin resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=Iran" title=" Iran"> Iran</a> </p> <a href="https://publications.waset.org/abstracts/41957/resistance-of-field-populations-of-rhipicephalus-bursa-acariixodidae-to-lambda-cyhalothrin-acaricide-in-mazandaran-province-north-of-iran" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/41957.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">397</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3301</span> Effects of Five Local Spices on the Mortality and Development of Larvae of Dermestes Maculatusdegeer (Coleoptera: Dermestidae) Reared on Dried Smoked Fish</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=A.%20Jatau">A. Jatau</a>, <a href="https://publications.waset.org/abstracts/search?q=Q.%20Majeed"> Q. Majeed</a>, <a href="https://publications.waset.org/abstracts/search?q=H.%20M.%20Bandiya"> H. M. Bandiya</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The efficacy of five local spices, namely; Hot pepper (Capsicum annum L.), Black pepper (Piper guinese Schum and Thonn), Sweet basil (Occimum canum Sim), African nut-meg (Monodora myristica Dunal), and Ginger (Zingiber officianale Ross) with conventional insecticide against the D. maculatus was studied under ambient laboratory conditions. The plants were pulverized into powders and applied at the rate of 1.0, 2.0 and 3.0g per 25g of disinfected dried fish. The same amount of fish (25g) was treated with 5ml of 1.0, 2.0 and 3.0 percent solution of conventional insecticide (dichlorvos) and air dried for 2hrs. Ten newly hatched 1st instar larvae (24hrs old) were introduced into each powdered smoked fish in separate beakers. Untreated control was also set up. Observation on the mortality and development were recorded daily until the larvae pupated. Each of the treated smoked fish showed significant (p<0.05) effect on the larval mortality and development when compared with the control. The Piper guinense was as efficacious as dichlorvos in killing all the larvae (100%) at all concentrations before pupation. Ocimum Canunm gave the second best results (50.00, 63.33 and 100%), while the other three spices resulted in less than 50% mortalities at all rate of application. The spice powders were also observed to have extended the larval developmental period. Thus, the spices tested can be recommended for the control of D. maculatus. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=development" title="development">development</a>, <a href="https://publications.waset.org/abstracts/search?q=dermestes%20maculatus" title=" dermestes maculatus"> dermestes maculatus</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide" title=" insecticide"> insecticide</a>, <a href="https://publications.waset.org/abstracts/search?q=local%20spices" title=" local spices"> local spices</a>, <a href="https://publications.waset.org/abstracts/search?q=mortality" title=" mortality"> mortality</a> </p> <a href="https://publications.waset.org/abstracts/11659/effects-of-five-local-spices-on-the-mortality-and-development-of-larvae-of-dermestes-maculatusdegeer-coleoptera-dermestidae-reared-on-dried-smoked-fish" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/11659.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">260</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3300</span> Isolation of a Bacterial Community with High Removal Efficiencies of the Insecticide Bendiocarb</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Eusebio%20A.%20Jim%C3%A9nez-Ar%C3%A9valo">Eusebio A. Jiménez-Arévalo</a>, <a href="https://publications.waset.org/abstracts/search?q=Deifilia%20Ahuatzi-Chac%C3%B3n"> Deifilia Ahuatzi-Chacón</a>, <a href="https://publications.waset.org/abstracts/search?q=Juvencio%20Gal%C3%ADndez-Mayer"> Juvencio Galíndez-Mayer</a>, <a href="https://publications.waset.org/abstracts/search?q=Cleotilde%20Ju%C3%A1rez-Ram%C3%ADrez"> Cleotilde Juárez-Ramírez</a>, <a href="https://publications.waset.org/abstracts/search?q=Nora%20Ruiz-Ordaz"> Nora Ruiz-Ordaz</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Bendiocarb is a known toxic xenobiotic that presents acute and chronic risks for freshwater invertebrates and estuarine and marine biota; thus, the treatment of water contaminated with the insecticide is of concern. In this paper, a bacterial community with the capacity to grow in bendiocarb as its sole carbon and nitrogen source was isolated by enrichment techniques in batch culture, from samples of a composting plant located in the northeast of Mexico City. Eight cultivable bacteria were isolated from the microbial community, by PCR amplification of 16 rDNA; <em>Pseudoxanthomonas spadix</em> (NC_016147.2, 98%), <em>Ochrobacterium anthropi</em> (NC_009668.1, 97%), <em>Staphylococcus capitis</em> (NZ_CP007601.1, 99%), <em>Bosea thiooxidans</em>. (NZ_LMAR01000067.1, 99%), <em>Pseudomonas denitrificans</em>. (NC_020829.1, 99%), <em>Agromyces </em>sp. (NZ_LMKQ01000001.1, 98%), <em>Bacillus thuringiensis</em>. (NC_022873.1, 97%), <em>Pseudomonas alkylphenolia </em>(NZ_CP009048.1, 98%). NCBI accession numbers and percentage of similarity are indicated in parentheses. These bacteria were regarded as the isolated species for having the best similarity matches. The ability to degrade bendiocarb by the immobilized bacterial community in a packed bed biofilm reactor, using as support volcanic stone fragments (tezontle), was evaluated. The reactor system was operated in batch using mineral salts medium and 30 mg/L of bendiocarb as carbon and nitrogen source. With this system, an overall removal efficiency (η<sub>bend</sub>) rounding 90%, was reached. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=bendiocarb" title="bendiocarb">bendiocarb</a>, <a href="https://publications.waset.org/abstracts/search?q=biodegradation" title=" biodegradation"> biodegradation</a>, <a href="https://publications.waset.org/abstracts/search?q=biofilm%20reactor" title=" biofilm reactor"> biofilm reactor</a>, <a href="https://publications.waset.org/abstracts/search?q=carbamate%20insecticide" title=" carbamate insecticide"> carbamate insecticide</a> </p> <a href="https://publications.waset.org/abstracts/55702/isolation-of-a-bacterial-community-with-high-removal-efficiencies-of-the-insecticide-bendiocarb" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/55702.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">279</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3299</span> The Toxicity Effects of HICIDE VD-9 on the Mortality of Lucilia cuprina under Laboratory Conditions</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Mehdi%20Shahmoradi%20Moghadam">Mehdi Shahmoradi Moghadam</a>, <a href="https://publications.waset.org/abstracts/search?q=Saba%20Kavian"> Saba Kavian</a>, <a href="https://publications.waset.org/abstracts/search?q=Mehdi%20Zabihzadeh"> Mehdi Zabihzadeh</a>, <a href="https://publications.waset.org/abstracts/search?q=Amir%20Mohammad%20Alborzi"> Amir Mohammad Alborzi</a>, <a href="https://publications.waset.org/abstracts/search?q=Reza%20Sadeghi"> Reza Sadeghi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Cypermethrin is one of the most widely used synthetic insecticides to control pests in veterinary, industrial and agricultural environments. In the present study, the mortalities of Lucilia Cuprina as the key pest of meat were studied after being exposed to HICIDE VD-9 (a ready-to-use disinfectant/insecticide containing cypermethrin, polyhexanide and quaternary ammonium compounds produced by Dana pharmed lotus Co., Iran) within 15 minutes. The experimental results showed that moralities percentage of egg, larvae and adults of Lucilia Cuprina were 48%, 81% and 70%, respectively. Based on the obtained results, it can be predicted that in addition to controlling the insect pests of blow flies, HICIDE VD-9, as a cost-effective and environmentally friendly disinfectant/insecticide, can be effective against other insects, e.g., biting flies, fleas, midges, mosquitoes and ticks. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cypermethrin" title="cypermethrin">cypermethrin</a>, <a href="https://publications.waset.org/abstracts/search?q=HICIDE%20VD-9" title=" HICIDE VD-9"> HICIDE VD-9</a>, <a href="https://publications.waset.org/abstracts/search?q=Lucilia%20cuprina" title=" Lucilia cuprina"> Lucilia cuprina</a>, <a href="https://publications.waset.org/abstracts/search?q=mortality" title=" mortality"> mortality</a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity" title=" toxicity"> toxicity</a> </p> <a href="https://publications.waset.org/abstracts/176093/the-toxicity-effects-of-hicide-vd-9-on-the-mortality-of-lucilia-cuprina-under-laboratory-conditions" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/176093.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">110</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3298</span> Host Preference, Impact of Host Transfer and Insecticide Susceptibility among Aphis gossypii Group (Order: Hemiptera) in Jamaica</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Desireina%20Delancy">Desireina Delancy</a>, <a href="https://publications.waset.org/abstracts/search?q=Tannice%20Hall"> Tannice Hall</a>, <a href="https://publications.waset.org/abstracts/search?q=Eric%20Garraway"> Eric Garraway</a>, <a href="https://publications.waset.org/abstracts/search?q=Dwight%20Robinson"> Dwight Robinson</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Aphis gossypii, as a pest, directly damages its host plant by extracting phloem sap (sucking) and indirectly damages it by the transmission of viruses, ultimately affecting the yield of the host. Due to its polyphagous nature, this species affects a wide range of host plants, some of which may serve as a reservoir for colonisation of important crops. In Jamaica, there have been outbreaks of viral plant pathogens that were transmitted by Aphis gossypii. Three such examples are Citrus tristeza virus, the Watermelon mosaic virus, and Papaya ringspot virus. Aphis gossypii also heavily colonized economically significant host plants, including pepper, eggplant, watermelon, cucumber, and hibiscus. To facilitate integrated pest management, it is imperative to understand the biology of the aphid and its host preference. Preliminary work in Jamaica has indicated differences in biology and host preference, as well as host variety within the species. However, specific details of fecundity, colony growth, host preference, distribution, and insecticide resistance of Aphis gossypii were unknown to the best of our knowledge. The aim was to investigate the following in relation to Aphis gossypii: influence of the host plant on colonization, life span, fecundity, population size, and morphology; the impact of host transfer on fecundity and population size as a measure of host preference and host transfer success and susceptibility to four commonly used insecticides. Fecundity and colony size were documented daily from aphids acclimatized on Capsicum chinense Jacquin 1776, Cucumis sativus Linnaeus 1630, Gossypium hirsutum Linnaeus 1751 and Abelmoschus esculentus (L.) Moench 1794 for three generations. The same measures were used after third instar aphids were transferred among the hosts as a measure of suitability and success. Mortality, and fecundity of survivors, were determined after aphids were exposed to varying concentrations of Actara®, Diazinon™, Karate Zeon®, and Pegasus®. Host preference results indicated that, over a 24-day period, Aphis gossypii reached its largest colony size on G. hirsutum (x̄ 381.80), with January – February being the most fecund period. Host transfer experiments were all significantly different, with the most significant occurring between transfers from C. chinense to C. sativus (p < 0.05). Colony sizes were found to increase significantly every 5 days, which has implications for regimes implemented to monitor and evaluate plots. Insecticides ranked on lethality are Karate Zeon®> Actara®> Pegasus® > Diazinon™. The highest LC50 values were obtained for aphids on G. hirsutum and C. chinense was with Pegasus® and for those on C. sativus with Diazinon™. Survivors of insecticide treatments had colony sizes on average that were 98 % less than untreated aphids. Cotton was preferred both in the field and in the glasshouse. It is on cotton the aphids settled first, had the highest fecundity, and the lowest mortality. Cotton can serve as reservoir for (re)populating other cotton or different host species based on migration due to overcrowding, heavy showers, high wind, or ant attendance. Host transfer success between all three hosts is highly probable within an intercropping system. Survivors of insecticide treatments can successfully repopulate host plants. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Aphis%20gossypii" title="Aphis gossypii">Aphis gossypii</a>, <a href="https://publications.waset.org/abstracts/search?q=host-plant%20preference" title=" host-plant preference"> host-plant preference</a>, <a href="https://publications.waset.org/abstracts/search?q=colonization%20sequence" title=" colonization sequence"> colonization sequence</a>, <a href="https://publications.waset.org/abstracts/search?q=host%20transfers" title=" host transfers"> host transfers</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20susceptibility" title=" insecticide susceptibility"> insecticide susceptibility</a> </p> <a href="https://publications.waset.org/abstracts/162191/host-preference-impact-of-host-transfer-and-insecticide-susceptibility-among-aphis-gossypii-group-order-hemiptera-in-jamaica" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/162191.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">95</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3297</span> Antibiotic Resistance and Tolerance to Biocides in Enterobacter</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Rebiahi%20Sid%20Ahmed">Rebiahi Sid Ahmed</a>, <a href="https://publications.waset.org/abstracts/search?q=Boutarfi%20Zakaria"> Boutarfi Zakaria</a>, <a href="https://publications.waset.org/abstracts/search?q=Rahmoun%20Malika"> Rahmoun Malika</a>, <a href="https://publications.waset.org/abstracts/search?q=Antonio%20Galvez"> Antonio Galvez</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The objective of this study was to explore the possible correlation between resistance to antibiotics and tolerance to biocides in Gram-negative bacilli isolated from the University Hospital Center of Tlemcen. This study focused on 175 clinical isolates of Gram-negative bacilli, it is a question of exploring: their level and profile of resistance to antibiotics, their tolerance to biocides, as well as the identification of the genetic supports of this resistance. Enterobacter spp. was the most predominant bacterial genus, all isolates harbored at least one of the studied genes with significant resistance capacity. Our results show, in some cases, a possible positive correlation between the presence of biocide tolerance genes and those of antibiotic resistance; in fact, tolerance to biocides could be one of the co-selection factors for antibiotic resistance. The results of this study should encourage the good practice of hygiene measures as well as the rational use of antimicrobials in order to hinder the development and emergence of resistance in our hospital departments.Mots clés : Antibiotiques, Biocides, Enterobacter, Hôpital, Résistance, <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antibiotic" title="antibiotic">antibiotic</a>, <a href="https://publications.waset.org/abstracts/search?q=biocides" title=" biocides"> biocides</a>, <a href="https://publications.waset.org/abstracts/search?q=enterobacter" title=" enterobacter"> enterobacter</a>, <a href="https://publications.waset.org/abstracts/search?q=hospital" title=" hospital"> hospital</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance" title=" resistance"> resistance</a> </p> <a href="https://publications.waset.org/abstracts/159663/antibiotic-resistance-and-tolerance-to-biocides-in-enterobacter" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/159663.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">116</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3296</span> Four-Week Plyometric and Resistance Training on Muscle Strength and Sprint Performance in Wheelchair Racing Athletes</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=K.%20Thawichai">K. Thawichai</a>, <a href="https://publications.waset.org/abstracts/search?q=R.%20Pornthep"> R. Pornthep</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The purpose of this study was to compare the effects of a four week training period of combined plyometric and resistance training or resistance training alone on muscle strength and sprint performance in wheelchair racing athletes. The participants were sixteen healthy male wheelchair racing athletes of the Thai national team. All participants were randomly assignments into two groups in the plyometric and resistance training group (n = 8) performed plyometric exercises followed by resistance training, whereas the resistance training group (n = 8) performed static stretching and the same resistance training program. At baseline and after training all participants were tested on 1-RM bench press for muscle strength and 100-m cycling sprint performance. The results of this study show that the plyometric and resistance training group made significantly greater improvements in overall muscle strength and sprint performance than the resistance training group following training. In conclusion, these findings suggest that the addition of a four week plyometric and resistance training program more beneficial than resistance training alone on muscle strength and sprint performance in wheelchair racing athletes. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=plyometric" title="plyometric">plyometric</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance%20training" title=" resistance training"> resistance training</a>, <a href="https://publications.waset.org/abstracts/search?q=strength" title=" strength"> strength</a>, <a href="https://publications.waset.org/abstracts/search?q=sprint" title=" sprint"> sprint</a>, <a href="https://publications.waset.org/abstracts/search?q=wheelchair%20athletes" title=" wheelchair athletes"> wheelchair athletes</a> </p> <a href="https://publications.waset.org/abstracts/36004/four-week-plyometric-and-resistance-training-on-muscle-strength-and-sprint-performance-in-wheelchair-racing-athletes" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/36004.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">538</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3295</span> Insecticidal Activity of Piper aduncum Fruit and Tephrosia vogelii Leaf Mixed Formulations against Cabbage Pest Plutella xylostella (L.) (Lepidoptera: Plutellidae) </h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Eka%20Candra%20Lina">Eka Candra Lina</a>, <a href="https://publications.waset.org/abstracts/search?q=Indah%20Widhianingrum"> Indah Widhianingrum</a>, <a href="https://publications.waset.org/abstracts/search?q=Mita%20Eka%20Putri"> Mita Eka Putri</a>, <a href="https://publications.waset.org/abstracts/search?q=Nur%20Afni%20Evalia"> Nur Afni Evalia</a>, <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Makky"> Muhammad Makky</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The emulsifiable concentrate (EC) and wettable powder (WP) of Piper aduncum and Tephrosia vogelii mixed formulations were tested for their activities in the laboratory and their effectiveness in the field against cabbage pest Plutella xyostella. Cabbage leaves soaked in six different mixed formulation concentrations were tested to 2ⁿᵈ instar larvae of P. xylostella with six replications. The observation was conducted everyday until larvae reached 4ᵗʰ instar stage. Correlation between concentration and larvae mortality was analyzed using probit (POLO-PC). The survived larvae was observed by looking at the growth and development, as well as the antifeedant effects. Field efficacy test was based on LC₉₅ value from laboratory test result. The experiment used a randomized block design with 5 treatments and 3 replications to test the populations of P. xylostella larvae and insecticide effectivity. The results showed that the EC and WP mixed formulations showed insecticidal activity against P. xylostella larvae, with LC₉₅ value of 0.35% and 0.37%, respectively. The highest antifeedant effect on EC mixed formulation was 85.01% and WP mixed formulation was 86.23%. Both mixed formulations also slowed the development of larvae when compared with control. Field effication result showed that applications of EC mixed formulation were able to restrain the population of P. xylostella, with effectivity value of 71.06%. Insecticide effectivity value of EC mixed formulation was higher than WP mixed formulation and Bacillus thuringiensis formulation. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=botanical%20insecticide" title="botanical insecticide">botanical insecticide</a>, <a href="https://publications.waset.org/abstracts/search?q=efficacy" title=" efficacy"> efficacy</a>, <a href="https://publications.waset.org/abstracts/search?q=emulsifiable%20concentrate%20%28EC%29" title=" emulsifiable concentrate (EC)"> emulsifiable concentrate (EC)</a>, <a href="https://publications.waset.org/abstracts/search?q=Plutella%20xylostella" title=" Plutella xylostella"> Plutella xylostella</a>, <a href="https://publications.waset.org/abstracts/search?q=wettable%20powder%20%28WP%29" title=" wettable powder (WP)"> wettable powder (WP)</a> </p> <a href="https://publications.waset.org/abstracts/86856/insecticidal-activity-of-piper-aduncum-fruit-and-tephrosia-vogelii-leaf-mixed-formulations-against-cabbage-pest-plutella-xylostella-l-lepidoptera-plutellidae" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/86856.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">242</span> </span> </div> </div> <ul class="pagination"> <li class="page-item disabled"><span class="page-link">&lsaquo;</span></li> <li class="page-item active"><span class="page-link">1</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=2">2</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=3">3</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=4">4</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=5">5</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=6">6</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=7">7</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=8">8</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=9">9</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=10">10</a></li> <li class="page-item disabled"><span class="page-link">...</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=110">110</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=111">111</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance&page=2" rel="next">&rsaquo;</a></li> </ul> </div> </main> <footer> <div id="infolinks" class="pt-3 pb-2"> <div class="container"> <div style="background-color:#f5f5f5;" class="p-3"> <div class="row"> <div class="col-md-2"> <ul class="list-unstyled"> About <li><a href="https://waset.org/page/support">About Us</a></li> <li><a href="https://waset.org/page/support#legal-information">Legal</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/WASET-16th-foundational-anniversary.pdf">WASET celebrates its 16th foundational anniversary</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Account <li><a href="https://waset.org/profile">My Account</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Explore <li><a href="https://waset.org/disciplines">Disciplines</a></li> <li><a href="https://waset.org/conferences">Conferences</a></li> <li><a href="https://waset.org/conference-programs">Conference Program</a></li> <li><a href="https://waset.org/committees">Committees</a></li> <li><a href="https://publications.waset.org">Publications</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Research <li><a href="https://publications.waset.org/abstracts">Abstracts</a></li> <li><a href="https://publications.waset.org">Periodicals</a></li> <li><a href="https://publications.waset.org/archive">Archive</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Open Science <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Philosophy.pdf">Open Science Philosophy</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Award.pdf">Open Science Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Society-Open-Science-and-Open-Innovation.pdf">Open Innovation</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Postdoctoral-Fellowship-Award.pdf">Postdoctoral Fellowship Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Scholarly-Research-Review.pdf">Scholarly Research Review</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Support <li><a href="https://waset.org/page/support">Support</a></li> <li><a href="https://waset.org/profile/messages/create">Contact Us</a></li> <li><a href="https://waset.org/profile/messages/create">Report Abuse</a></li> </ul> </div> </div> </div> </div> </div> <div class="container text-center"> <hr style="margin-top:0;margin-bottom:.3rem;"> <a href="https://creativecommons.org/licenses/by/4.0/" target="_blank" class="text-muted small">Creative Commons Attribution 4.0 International License</a> <div id="copy" class="mt-2">© 2024 World Academy of Science, Engineering and Technology</div> </div> </footer> <a href="javascript:" id="return-to-top"><i class="fas fa-arrow-up"></i></a> <div class="modal" id="modal-template"> <div class="modal-dialog"> <div class="modal-content"> <div class="row m-0 mt-1"> <div class="col-md-12"> <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">×</span></button> </div> </div> <div class="modal-body"></div> </div> </div> </div> <script src="https://cdn.waset.org/static/plugins/jquery-3.3.1.min.js"></script> <script src="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/js/bootstrap.bundle.min.js"></script> <script src="https://cdn.waset.org/static/js/site.js?v=150220211556"></script> <script> jQuery(document).ready(function() { /*jQuery.get("https://publications.waset.org/xhr/user-menu", function (response) { jQuery('#mainNavMenu').append(response); });*/ jQuery.get({ url: "https://publications.waset.org/xhr/user-menu", cache: false }).then(function(response){ jQuery('#mainNavMenu').append(response); }); }); </script> </body> </html>