CINXE.COM

<!DOCTYPE html> <html lang="en" dir="ltr"> <head>  <script async src="https://www.googletagmanager.com/gtag/js?id=G-P63WKM1TM1"></script> <script> window.dataLayer = window.dataLayer || []; function gtag(){dataLayer.push(arguments);} gtag('js', new Date()); gtag('config', 'G-P63WKM1TM1'); </script>  <script type="text/javascript" > (function(m,e,t,r,i,k,a){m[i]=m[i]||function(){(m[i].a=m[i].a||[]).push(arguments)}; m[i].l=1*new Date(); for (var j = 0; j < document.scripts.length; j++) {if (document.scripts[j].src === r) { return; }} k=e.createElement(t),a=e.getElementsByTagName(t)[0],k.async=1,k.src=r,a.parentNode.insertBefore(k,a)}) (window, document, "script", "https://mc.yandex.ru/metrika/tag.js", "ym"); ym(55165297, "init", { clickmap:false, trackLinks:true, accurateTrackBounce:true, webvisor:false }); </script> <noscript><div><img src="https://mc.yandex.ru/watch/55165297" style="position:absolute; left:-9999px;" alt="" /></div></noscript>    <title>Search results for: hydrolytic enzymes</title> <meta name="description" content="Search results for: hydrolytic enzymes"> <meta name="keywords" content="hydrolytic enzymes"> <meta name="viewport" content="width=device-width, initial-scale=1, minimum-scale=1, maximum-scale=1, user-scalable=no"> <meta charset="utf-8"> <link href="https://cdn.waset.org/favicon.ico" type="image/x-icon" rel="shortcut icon"> <link href="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/css/bootstrap.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/plugins/fontawesome/css/all.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/css/site.css?v=150220211555" rel="stylesheet"> </head> <body> <header> <div class="container"> <nav class="navbar navbar-expand-lg navbar-light"> <a class="navbar-brand" href="https://waset.org"> <img src="https://cdn.waset.org/static/images/wasetc.png" alt="Open Science Research Excellence" title="Open Science Research Excellence" /> </a> <button class="d-block d-lg-none navbar-toggler ml-auto" type="button" data-toggle="collapse" data-target="#navbarMenu" aria-controls="navbarMenu" aria-expanded="false" aria-label="Toggle navigation"> <span class="navbar-toggler-icon"></span> </button> <div class="w-100"> <div class="d-none d-lg-flex flex-row-reverse"> <form method="get" action="https://waset.org/search" class="form-inline my-2 my-lg-0"> <input class="form-control mr-sm-2" type="search" placeholder="Search Conferences" value="hydrolytic enzymes" name="q" aria-label="Search"> <button class="btn btn-light my-2 my-sm-0" type="submit"><i class="fas fa-search"></i></button> </form> </div> <div class="collapse navbar-collapse mt-1" id="navbarMenu"> <ul class="navbar-nav ml-auto align-items-center" id="mainNavMenu"> <li class="nav-item"> <a class="nav-link" href="https://waset.org/conferences" title="Conferences in 2024/2025/2026">Conferences</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/disciplines" title="Disciplines">Disciplines</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/committees" rel="nofollow">Committees</a> </li> <li class="nav-item dropdown"> <a class="nav-link dropdown-toggle" href="#" id="navbarDropdownPublications" role="button" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"> Publications </a> <div class="dropdown-menu" aria-labelledby="navbarDropdownPublications"> <a class="dropdown-item" href="https://publications.waset.org/abstracts">Abstracts</a> <a class="dropdown-item" href="https://publications.waset.org">Periodicals</a> <a class="dropdown-item" href="https://publications.waset.org/archive">Archive</a> </div> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/page/support" title="Support">Support</a> </li> </ul> </div> </div> </nav> </div> </header> <main> <div class="container mt-4"> <div class="row"> <div class="col-md-9 mx-auto"> <form method="get" action="https://publications.waset.org/abstracts/search"> <div id="custom-search-input"> <div class="input-group"> <i class="fas fa-search"></i> <input type="text" class="search-query" name="q" placeholder="Author, Title, Abstract, Keywords" value="hydrolytic enzymes"> <input type="submit" class="btn_search" value="Search"> </div> </div> </form> </div> </div> <div class="row mt-3"> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Commenced</strong> in January 2007</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Frequency:</strong> Monthly</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Edition:</strong> International</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Paper Count:</strong> 695</div> </div> </div> </div> <h1 class="mt-3 mb-3 text-center" style="font-size:1.6rem;">Search results for: hydrolytic enzymes</h1> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">605</span> Garlic (Allium sativum) Extract Enhancing Protein Digestive Enzymes and Growth Performance in Marble Goby (Oxyleotris marmorata) Juvenile</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Jaturong%20Matidtor">Jaturong Matidtor</a>, <a href="https://publications.waset.org/abstracts/search?q=Krisna%20R.%20Torrissen"> Krisna R. Torrissen</a>, <a href="https://publications.waset.org/abstracts/search?q=Saengtong%20%20Pongjareankit"> Saengtong Pongjareankit</a>, <a href="https://publications.waset.org/abstracts/search?q=Sudaporn%20Tongsiri"> Sudaporn Tongsiri</a>, <a href="https://publications.waset.org/abstracts/search?q=Jiraporn%20%20Rojtinnakorn"> Jiraporn Rojtinnakorn</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Low survival rate has being particular problem in nursery of marble goby juvenile. The aim of this study was to investigate effect of garlic extract on protein digestive pancreatic enzymes, trypsin (T) and chymotrypsin (C). The marble goby were reared with commercial feed mixed garlic extract at concentration of 0 (control), 0.3, 0.5, 1.0, 3.0 and 5.0% (w/w) for 6 weeks. Analysis of the digestive enzymes at 2 and 6 weeks was performed. Growth parameters; weight gain (WG), specific growth rate (SGR) and feed efficiency (FE), were identified. For T, C and T/C at 2 weeks, values of T and T/C ratio of 0.3% (w/w) group showed significant difference (p < 0.05) with the highest values of 17685.64± 11981.77 U/mg protein and of 51.64 ± 27.46 U/mg protein, respectively. For C at 2 weeks, 0% (w/w) group showed the highest values of 16191.76± 2225.56 U/mg protein. Whereas value of T, C and T/C ratio at 6 weeks, there was no significant difference (p > 0.05). For growth performance, it significantly increased in all garlic extract fed groups (0.3-5.0%, w/w), both at 2 and 6 weeks. At 2 weeks, values of WG and SGR of 0.5% (w/w) group showed the highest values of 71.51 ± 1.60%, and 3.85 ± 0.07%, respectively. For FE, 0.3% (w/w) group showed the highest value of 60.21 ± 6.51%. At 6 weeks, it illustrated that all growth parameters of 5.0% (w/w) group were the highest values; WG = 35.06 ± 5.66%, SGR = 2.14 ± 0.30%, and FE = 5.86 ± 0.68%. We suggested that garlic extract could be available for protein digestive enzyme and growth enhancement in marble goby nursery with artificial feed. This result will be high benefit for commercial aquaculture of marble goby. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=marble%20goby" title="marble goby">marble goby</a>, <a href="https://publications.waset.org/abstracts/search?q=nursery" title=" nursery"> nursery</a>, <a href="https://publications.waset.org/abstracts/search?q=garlic%20extract" title=" garlic extract"> garlic extract</a>, <a href="https://publications.waset.org/abstracts/search?q=digestive%20enzyme" title=" digestive enzyme"> digestive enzyme</a>, <a href="https://publications.waset.org/abstracts/search?q=growth" title=" growth"> growth</a> </p> <a href="https://publications.waset.org/abstracts/64912/garlic-allium-sativum-extract-enhancing-protein-digestive-enzymes-and-growth-performance-in-marble-goby-oxyleotris-marmorata-juvenile" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/64912.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">324</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">604</span> Physiological Regulation of Lignin-Modifying Enzymes Synthesis by Selected Basidiomycetes</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ana%20%20Tsokilauri">Ana Tsokilauri</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The uppermost factor in the regulation of lignin-cellulose activity of decaying white rot or free rot are the substances serving as carbon and nitrogen nutrition of microorganisms and are considered as the most important factor of generative activity of white rot. The research object was Basidiomycete Fungi, peculiar and common in Georgia, and the separation of 10 of them as pure crops. The unidentified pure crops have tasted in order to be determined the potential of synthesis of lignin-degrading enzymes and the substrate of optimal lignocellulose growth. One of the most important aspects of the research conducted on Basidiomycetes was the use of specific lignocellulosic residues for selecting Fungi as a substrate of their growth. In order to increase lignocellulose with the help of substrate, crops were selected from the screening stage that showed good laccase activity. (Dusheti 1; Dusheti 10; Fshavi 5; Fshavi1; Fshavi 8; Fshavi 32; Manglisi 26; Sabaduri20; Dusheti 7; Sabaduri 1 ), Among the selected cultures, the crops with good laccase activity against the following substances, in particular: Dusheti 1- in this case, the rate of enzymatic activity on bran substrate was -105,6 u/ml, mandarin-96,4 u/ml. In case of corn - 102,9 u/ml. In case of Dusheti 7- the indicators were as follows: bananas-121,7 u/ml, mandarin-125,4 u/ml, corn - 117,1 u/ml. In the case of Sanaduri 32, the laccase activity was as follows: pomegranate- 101,2 u/ml. As a result of conducted experiments, the synthesis and activity rates of enzymes depending on plant substrates varied within a fairly wide range, which is still being under research. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Lignocellulosic%20substrate" title="Lignocellulosic substrate">Lignocellulosic substrate</a>, <a href="https://publications.waset.org/abstracts/search?q=Basidiomycetes" title=" Basidiomycetes"> Basidiomycetes</a>, <a href="https://publications.waset.org/abstracts/search?q=white-rot%20basidiomycetes" title=" white-rot basidiomycetes"> white-rot basidiomycetes</a>, <a href="https://publications.waset.org/abstracts/search?q=Laccase" title=" Laccase"> Laccase</a> </p> <a href="https://publications.waset.org/abstracts/138684/physiological-regulation-of-lignin-modifying-enzymes-synthesis-by-selected-basidiomycetes" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/138684.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">196</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">603</span> Cannabis Sativa L as Natural Source of Promising Anti-Alzheimer Drug Candidates: A Comprehensive Computational Approach Including Molecular Docking, Molecular Dynamics, Admet and MM-PBSA Studies</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Hassan%20Nour">Hassan Nour</a>, <a href="https://publications.waset.org/abstracts/search?q=Nouh%20Mounadi"> Nouh Mounadi</a>, <a href="https://publications.waset.org/abstracts/search?q=Oussama%20Abchir"> Oussama Abchir</a>, <a href="https://publications.waset.org/abstracts/search?q=Belaidi%20Salah"> Belaidi Salah</a>, <a href="https://publications.waset.org/abstracts/search?q=Samir%20Chtita"> Samir Chtita</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Cholinesterase enzymes are biological catalysts essential for the transformation of acetylcholine, which is a neurotransmitter implicated in memory and learning, into acetic acid and choline, altering the neurotransmission process in Alzheimer’s disease patients. Therefore, inhibition of cholinesterase enzymes is a relevant strategy for the symptomatic treatment of Alzheimer’s disease. The current investigation aims to explore potential Cholinesterase (ChE) inhibitors through a comprehensive computational approach. Forty-nine phytoconstituents extracted from Cannabis sativa L were in-silico screened using molecular docking, pharmacokinetic and toxicological analysis to evaluate their possible inhibitory effect towards the cholinesterase enzymes. Two phytoconstituents belonging to cannabinoid derivatives were revealed to be promising candidates for Alzheimer therapy by acting as cholinesterase inhibitors. They have exhibited high binding affinities towards the cholinesterase enzymes and showed their ability to interact with key residues involved in cholinesterase enzymatic activity. In addition, they presented good ADMET profiles allowing them to be promising oral drug candidates. Furthermore, molecular dynamics (MD) simulations were executed to explore their interactions stability under mimetic biological conditions and thus support our findings. To corroborate the docking results, the binding free energy corresponding to the more stable ligand-ChE complexes was re-estimated by applying the MM-PBSA method. MD and MM-PBSA studies affirmed that the ligand-ChE recognition is spontaneous reaction leading to stable complexes. The conducted investigations have led to great findings that would strongly guide the pharmaceutical industries towards the rational development of potent anti-Alzheimer agents. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=alzheimer%E2%80%99s%20disease" title="alzheimer’s disease">alzheimer’s disease</a>, <a href="https://publications.waset.org/abstracts/search?q=molecular%20docking" title=" molecular docking"> molecular docking</a>, <a href="https://publications.waset.org/abstracts/search?q=cannabis%20sativa%20l" title=" cannabis sativa l"> cannabis sativa l</a>, <a href="https://publications.waset.org/abstracts/search?q=cholinesterase%20inhibitors" title=" cholinesterase inhibitors"> cholinesterase inhibitors</a> </p> <a href="https://publications.waset.org/abstracts/171130/cannabis-sativa-l-as-natural-source-of-promising-anti-alzheimer-drug-candidates-a-comprehensive-computational-approach-including-molecular-docking-molecular-dynamics-admet-and-mm-pbsa-studies" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/171130.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">73</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">602</span> Response of Barley Quality Traits, Yield and Antioxidant Enzymes to Water-Stress and Chemical Inducers</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Emad%20Hafez">Emad Hafez</a>, <a href="https://publications.waset.org/abstracts/search?q=Mahmoud%20Seleiman"> Mahmoud Seleiman</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Two field experiments were carried out in order to investigate the effect of chemical inducers [benzothiadiazole 0.9 mM L-1, oxalic acid 1.0 mM L-1, salicylic acid 0.2 mM L-1] on physiological and technological traits as well as on yields and antioxidant enzyme activities of barley grown under abiotic stress (i.e. water surplus and deficit conditions). Results showed that relative water content, leaf area, chlorophyll and yield as well as technological properties of barley were improved with chemical inducers application under water surplus and water-stress conditions. Antioxidant enzymes activity (i.e. catalase and peroxidase) were significantly increased in barley grown under water-stress and treated with chemical inducers. Yield and related parameters of barley presented also significant decrease under water-stress treatment, while chemical inducers application enhanced the yield-related traits. Starch and protein contents were higher in plants treated with salicylic acid than in untreated plants when water-stress was applied. In conclusion, results show that chemical inducers application have a positive interaction and synergetic influence and should be suggested to improve plant growth, yield and technological properties of water stressed barley. Salicylic acid application was better than oxalic acid and benzothiadiazole in terms of plant growth and yield improvement. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antioxidant%20enzymes" title="antioxidant enzymes">antioxidant enzymes</a>, <a href="https://publications.waset.org/abstracts/search?q=drought%20stress" title=" drought stress"> drought stress</a>, <a href="https://publications.waset.org/abstracts/search?q=Hordeum%20vulgare%20L." title=" Hordeum vulgare L."> Hordeum vulgare L.</a>, <a href="https://publications.waset.org/abstracts/search?q=quality" title=" quality"> quality</a>, <a href="https://publications.waset.org/abstracts/search?q=yield" title=" yield"> yield</a> </p> <a href="https://publications.waset.org/abstracts/74163/response-of-barley-quality-traits-yield-and-antioxidant-enzymes-to-water-stress-and-chemical-inducers" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/74163.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">303</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">601</span> The Effect of Bisphenol A and Its Selected Analogues on Antioxidant Enzymes Activity in Human Erythrocytes</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Aneta%20Ma%C4%87czak">Aneta Maćczak</a>, <a href="https://publications.waset.org/abstracts/search?q=Bo%C5%BCena%20Bukowska"> Bożena Bukowska</a>, <a href="https://publications.waset.org/abstracts/search?q=Jaromir%20Micha%C5%82owicz"> Jaromir Michałowicz</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Bisphenols are one of the most widely used chemical compounds worldwide. They are used in the manufacturing of polycarbonates, epoxy resins and thermal paper which are applied in plastic containers, bottles, cans, newspapers, receipt and other products. Among these compounds, bisphenol A (BPA) is produced in the highest amounts. There are concerns about endocrine impact of BPA and its other toxic effects including hepatotoxicity, neurotoxicity and carcinogenicity on human organism. Moreover, BPA is supposed to increase the incidence the obesity, diabetes and heart disease. For this reason the use of BPA in the production of plastic infant feeding bottles and some other consumers products has been restricted in the European Union and the United States. Nowadays, BPA analogues like bisphenol F (BPF) and bisphenol S (BPS) have been developed as alternative compounds. The replacement of BPA with other bisphenols contributed to the increase of the exposure of human population to these substances. Toxicological studies have mainly focused on BPA. In opposite, a small number of studies concerning toxic effects of BPA analogues have been realized, which makes impossible to state whether those substituents are safe for human health. Up to now, the mechanism of bisphenols action on the erythrocytes has not been elucidated. That is why, the aim of this study was to assess the effect of BPA and its selected analogues such as BPF and BPS on the activity of antioxidant enzymes, i.e. catalase (EC 1.11.1.6.), glutathione peroxidase (E.C.1.11.1.9) and superoxide dismutase (EC.1.15.1.1) in human erythrocytes. Red blood cells in respect to their function (transport of oxygen) and very well developed enzymatic and non-enzymatic antioxidative system, are useful cellular model to assess changes in redox balance. Erythrocytes were incubated with BPA, BPF and BPS in the concentration ranging from 0.5 to 100 µg/ml for 24 h. The activity of catalase was determined by the method of Aebi (1984). The activity of glutathione peroxidase was measured according to the method described by Rice-Evans et al. (1991), while the activity of superoxide dismutase (EC.1.15.1.1) was determined by the method of Misra and Fridovich (1972). The results showed that BPA and BPF caused changes in the antioxidative enzymes activities. BPA decreased the activity of examined enzymes in the concentration of 100 µg/ml. We also noted that BPF decreased the activity of catalase (5-100 µg/ml), glutathione peroxidase (50-100 µg/ml) and superoxide dismutase (25-100 µg/ml), while BPS did not cause statistically significant changes in investigated parameters. The obtained results suggest that BPA and BPF disrupt redox balance in human erythrocytes but the observed changes may occur in human organism only during occupational or subacute exposure to these substances. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antioxidant%20enzymes" title="antioxidant enzymes">antioxidant enzymes</a>, <a href="https://publications.waset.org/abstracts/search?q=bisphenol%20A" title=" bisphenol A"> bisphenol A</a>, <a href="https://publications.waset.org/abstracts/search?q=bisphenol%20a%20analogues" title=" bisphenol a analogues"> bisphenol a analogues</a>, <a href="https://publications.waset.org/abstracts/search?q=human%20erythrocytes" title=" human erythrocytes"> human erythrocytes</a> </p> <a href="https://publications.waset.org/abstracts/35582/the-effect-of-bisphenol-a-and-its-selected-analogues-on-antioxidant-enzymes-activity-in-human-erythrocytes" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/35582.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">471</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">600</span> Detoxification and Recycling of the Harvested Microalgae using Eco-friendly Food Waste Recycling Technology with Salt-tolerant Mushroom Strains</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=J.%20M.%20Kim">J. M. Kim</a>, <a href="https://publications.waset.org/abstracts/search?q=Y.%20W.%20Jung"> Y. W. Jung</a>, <a href="https://publications.waset.org/abstracts/search?q=E.%20Lee"> E. Lee</a>, <a href="https://publications.waset.org/abstracts/search?q=Y.%20K.%20Kwack"> Y. K. Kwack</a>, <a href="https://publications.waset.org/abstracts/search?q="></a>, <a href="https://publications.waset.org/abstracts/search?q=S.%20K.%20Sim%2A">S. K. Sim*</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Cyanobacterial blooms in lakes, reservoirs, and rivers have been environmental and social issues due to its toxicity, odor, etc. Among the cyanotoxins, microcystins exist mostly within the cyanobacterial cells, and they are released from the cells. Therefore, an innovative technology is needed to detoxify the harvested microalgae for environment-friendly utilization of the harvested microalgae. This study develops detoxification method of microcystins in the harvested microalgae and recycling harvested microalgae with food waste using salt-tolerant mushroom strains and natural ecosystem decomposer. During this eco-friendly organic waste recycling process, diverse bacteria or various enzymes of the salt-tolerant mushroom strains decompose the microystins and cyclic peptides. Using PHLC/Mass analysis, it was verified that 99.8% of the microcystins of the harvested microalgae was detoxified in the harvested mushroom as well as in the recycled organic biomass. Further study is planned to verify the decomposition mechanisms of the microcystins by the bacteria or enzymes. In this study, the harvested microalgae is mixed with the food waste, and then the mixed toxic organic waste is used as mushroom compost by adjusting the water content of about 70% using cellulose such as sawdust cocopeats and cottonseeds. The mushroom compost is bottled, sterilized, and salt-tolerant mushroom spawn is inoculated. The mushroom is then cultured and growing in the temperature, humidity, and CO2 controlled environment. During the cultivation and growing process of the mushroom, microcystins are decomposed into non-toxic organic or inorganic compounds by diverse bacteria or various enzymes of the mushroom strains. Various enzymes of the mushroom strains decompose organics of the mixed organic waste and produce nutritious and antibiotic mushrooms. Cultured biomass compost after mushroom harvest can be used for organic fertilizer, functional bio-feed, and RE-100 biomass renewable energy source. In this eco-friendly organic waste recycling process, no toxic material, wastewater, nor sludge is generated; thus, sustainable with the circular economy. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=microalgae" title="microalgae">microalgae</a>, <a href="https://publications.waset.org/abstracts/search?q=microcystin" title=" microcystin"> microcystin</a>, <a href="https://publications.waset.org/abstracts/search?q=food%20waste" title=" food waste"> food waste</a>, <a href="https://publications.waset.org/abstracts/search?q=salt-tolerant%20mushroom%20strains" title=" salt-tolerant mushroom strains"> salt-tolerant mushroom strains</a>, <a href="https://publications.waset.org/abstracts/search?q=sustainability" title=" sustainability"> sustainability</a>, <a href="https://publications.waset.org/abstracts/search?q=circular%20economy" title=" circular economy"> circular economy</a> </p> <a href="https://publications.waset.org/abstracts/154121/detoxification-and-recycling-of-the-harvested-microalgae-using-eco-friendly-food-waste-recycling-technology-with-salt-tolerant-mushroom-strains" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/154121.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">143</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">599</span> Cannabis Sativa L as Natural Source of Promising Anti-Alzheimer Drug Candidates: A Comprehensive Computational Approach Including Molecular Docking, Molecular Dynamics, ADMET and MM-PBSA Studies</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Hassan%20Nour">Hassan Nour</a>, <a href="https://publications.waset.org/abstracts/search?q=Nouh%20Mounadi"> Nouh Mounadi</a>, <a href="https://publications.waset.org/abstracts/search?q=Oussama%20Abchir"> Oussama Abchir</a>, <a href="https://publications.waset.org/abstracts/search?q=Belaidi%20Salah"> Belaidi Salah</a>, <a href="https://publications.waset.org/abstracts/search?q=Samir%20Chtita"> Samir Chtita</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Cholinesterase enzymes are biological catalysts essential for the transformation of acetylcholine, which is a neurotransmitter implicated in memory and learning, into acetic acid and choline, altering the neurotransmission process in Alzheimer’s disease patients. Therefore, inhibition of cholinesterase enzymes is a relevant strategy for the symptomatic treatment of Alzheimer’s disease. The current investigation aims to explore potential cholinesterase (ChE) inhibitors through a comprehensive computational approach. Forty-nine phytoconstituents extracted from Cannabis sativa L. were in-silico screened using molecular docking and pharmacokinetic and toxicological analysis to evaluate their possible inhibitory effect on the cholinesterase enzymes. Two phytoconstituents belonging to cannabinoid derivatives were revealed to be promising candidates for Alzheimer's therapy by acting as cholinesterase inhibitors. They have exhibited high binding affinities towards the cholinesterase enzymes and showed their ability to interact with key residues involved in cholinesterase enzymatic activity. In addition, they presented good ADMET profiles allowing them to be promising oral drug candidates. Furthermore, molecular dynamics (MD) simulations were executed to explore their interaction stability under mimetic biological conditions and thus support our findings. To corroborate the docking results, the binding free energy corresponding to the more stable ligand-ChE complexes was re-estimated by applying the MM-PBSA method. MD and MM-PBSA studies affirmed that the ligand-ChE recognition is a spontaneous reaction leading to stable complexes. The conducted investigations have led to great findings that would strongly guide the pharmaceutical industries toward the rational development of potent anti-Alzheimer agents. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Alzheimer%E2%80%99s%20disease" title="Alzheimer’s disease">Alzheimer’s disease</a>, <a href="https://publications.waset.org/abstracts/search?q=molecular%20docking" title=" molecular docking"> molecular docking</a>, <a href="https://publications.waset.org/abstracts/search?q=Cannabis%20sativa%20L." title=" Cannabis sativa L."> Cannabis sativa L.</a>, <a href="https://publications.waset.org/abstracts/search?q=cholinesterase%20inhibitors" title=" cholinesterase inhibitors"> cholinesterase inhibitors</a>, <a href="https://publications.waset.org/abstracts/search?q=molecular%20dynamics" title=" molecular dynamics"> molecular dynamics</a>, <a href="https://publications.waset.org/abstracts/search?q=ADMET" title=" ADMET"> ADMET</a>, <a href="https://publications.waset.org/abstracts/search?q=MM-PBSA" title=" MM-PBSA"> MM-PBSA</a> </p> <a href="https://publications.waset.org/abstracts/171128/cannabis-sativa-l-as-natural-source-of-promising-anti-alzheimer-drug-candidates-a-comprehensive-computational-approach-including-molecular-docking-molecular-dynamics-admet-and-mm-pbsa-studies" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/171128.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">83</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">598</span> Comparative Analysis of Soil Enzyme Activities between Laurel-Leaved and Cryptomeria japonica Forests</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ayuko%20Itsuki">Ayuko Itsuki</a>, <a href="https://publications.waset.org/abstracts/search?q=Sachiyo%20Aburatani"> Sachiyo Aburatani</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Soil enzyme activities in Kasuga-yama Hill Primeval Forest (Nara, Japan) were examined to determine levels of mineralization and metabolism. Samples were selected from the soil surrounding laurel-leaved (B<sub>B-1</sub>) and <em>C</em><em>arpinus</em><em> japonica</em> (B<sub>B-2</sub> and P<sub>w</sub>) trees for analysis. Cellulase, β-xylosidase, and protease activities were higher in B<sub>B-1</sub> samples those in B<sub>B-2 </sub>samples. These activity levels corresponded to the distribution of cellulose and hemicellulose in the soil horizons. Cellulase, β-xylosidase, and chymotrypsin activities were higher in soil from the P<sub>w</sub> forest than in that from the B<sub>B-2 </sub>forest. The relationships between the soil enzymes calculated by Spearman’s rank correlation indicate that the interactions between enzymes in B<sub>B-2</sub> samples were more complex than those in P<sub>w</sub> samples. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=comparative%20analysis" title="comparative analysis">comparative analysis</a>, <a href="https://publications.waset.org/abstracts/search?q=enzyme%20activities" title=" enzyme activities"> enzyme activities</a>, <a href="https://publications.waset.org/abstracts/search?q=forest%20soil" title=" forest soil"> forest soil</a>, <a href="https://publications.waset.org/abstracts/search?q=Spearman%27s%20rank%20correlation" title=" Spearman's rank correlation"> Spearman's rank correlation</a> </p> <a href="https://publications.waset.org/abstracts/20200/comparative-analysis-of-soil-enzyme-activities-between-laurel-leaved-and-cryptomeria-japonica-forests" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/20200.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">591</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">597</span> Sinapic Acid Attenuation of Cyclophosphamide-Induced Liver Toxicity in Mice by Modulating Oxidative Stress, Nf-κB, and Caspase-3</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Shiva%20Rezaei">Shiva Rezaei</a>, <a href="https://publications.waset.org/abstracts/search?q=Seyed%20Jalal%20Hosseinimehr"> Seyed Jalal Hosseinimehr</a>, <a href="https://publications.waset.org/abstracts/search?q=Abbasali%20Karimpour%20Malekshah"> Abbasali Karimpour Malekshah</a>, <a href="https://publications.waset.org/abstracts/search?q=Mansooreh%20Mirzaei"> Mansooreh Mirzaei</a>, <a href="https://publications.waset.org/abstracts/search?q=Fereshteh%20Talebpour%20Amiri"> Fereshteh Talebpour Amiri</a>, <a href="https://publications.waset.org/abstracts/search?q=Mehryar%20Zargari"> Mehryar Zargari</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Objective(s): Cyclophosphamide (CP), as an antineoplastic drug, is widely used in cancer patients, and liver toxicity is one of its complications. Sinapic acid (SA), as a natural phenylpropanoid, has antioxidant, anti-inflammatory, and anti-cancer properties. Materials and Methods: The purpose of the current study was to determine the protective effect of SA versus CP-induced liver toxicity. In this research, BALB/c mice were treated with SA (5 and 10 mg/kg) orally for one week, and CP (200 mg/kg) was injected on day 3 of the study. Oxidative stress markers, serum liver-specific enzymes, histopathological features, caspase-3, and nuclear factor kappa-B cells were then checked. Results: CP induced hepatotoxicity in mice and showed structural changes in liver tissue. CP significantly increased liver enzymes and lipid peroxidation and decreased glutathione. The immunoreactivity of caspase-3 and nuclear factor kappa-B cells was significantly increased. Administration of SA significantly maintained histochemical parameters and liver function enzymes in mice treated with CP. Immunohistochemical examination showed SA reduced apoptosis and inflammation. Conclusion: The data confirmed that SA with anti-apoptotic, anti-oxidative, and anti-inflammatory activities was able to preserve CP-induced liver injury in mice. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=apoptosis" title="apoptosis">apoptosis</a>, <a href="https://publications.waset.org/abstracts/search?q=cyclophosphamide" title=" cyclophosphamide"> cyclophosphamide</a>, <a href="https://publications.waset.org/abstracts/search?q=liver%20injury" title=" liver injury"> liver injury</a>, <a href="https://publications.waset.org/abstracts/search?q=inflammation" title=" inflammation"> inflammation</a>, <a href="https://publications.waset.org/abstracts/search?q=oxidative%20stress" title=" oxidative stress"> oxidative stress</a>, <a href="https://publications.waset.org/abstracts/search?q=sinapic%20acid" title=" sinapic acid"> sinapic acid</a> </p> <a href="https://publications.waset.org/abstracts/182692/sinapic-acid-attenuation-of-cyclophosphamide-induced-liver-toxicity-in-mice-by-modulating-oxidative-stress-nf-kb-and-caspase-3" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/182692.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">56</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">596</span> Screening of Nickel-Tolerant Genotype of Mung Bean (Vigna radiata) Based on Photosynthesis and Antioxidant System</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Mohammad%20Yusuf">Mohammad Yusuf</a>, <a href="https://publications.waset.org/abstracts/search?q=Qazi%20Fariduddin"> Qazi Fariduddin</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The main aim of this study was to explore the different cultivars of Vigna radiata on basis of photosynthesis, antioxidants and proline to assess Ni-sensitive and Ni-tolerant cultivar. Seeds of five different cultivars were sown in soil amended with different levels of Ni (0, 50, 100, or 150 mg kg 1). At 30 d stage, plants were harvested to assess the various parameters. The Ni treatment diminished growth, leaf water potential, chlorophyll content and net photosynthesis along with nitrate reductase and carbonic anhydrase activities in the concentration dependent manner whereas, it enhanced proline content and various antioxidant enzymes. The varieties T-44 found least affected, whereas PDM-139 experienced maximum damage at 150 mg kg-1 of Ni. Moreover, T-44 possessed maximum activity of antioxidant enzymes and proline content at all the levels of metal whereas PDM-139 possessed minimum values. Therefore, T-44 and PDM-139 were established as the most resistant and sensitive varieties, respectively. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Vigna%20radiata" title="Vigna radiata">Vigna radiata</a>, <a href="https://publications.waset.org/abstracts/search?q=antioxidants" title=" antioxidants"> antioxidants</a>, <a href="https://publications.waset.org/abstracts/search?q=nickel" title=" nickel"> nickel</a>, <a href="https://publications.waset.org/abstracts/search?q=photosynthesis" title=" photosynthesis"> photosynthesis</a>, <a href="https://publications.waset.org/abstracts/search?q=proline" title=" proline"> proline</a> </p> <a href="https://publications.waset.org/abstracts/41897/screening-of-nickel-tolerant-genotype-of-mung-bean-vigna-radiata-based-on-photosynthesis-and-antioxidant-system" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/41897.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">223</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">595</span> Enzyme Redesign: From Metal-Dependent to Metal-Independent, a Symphony Orchestra without Concertmasters</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Li%20Na%20Zhao">Li Na Zhao</a>, <a href="https://publications.waset.org/abstracts/search?q=Arieh%20Warshel"> Arieh Warshel</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The design of enzymes is an extremely challenging task, and this is also true for metalloenzymes. In the case of naturally evolved enzymes, one may consider the active site residues as the musicians in the enzyme orchestra, while the metal can be considered as their concertmaster. Together they catalyze reactions as if they performed a masterpiece written by nature. The Lactonase can be thought as a member of the amidohydrolase family, with two concertmasters, Fe and Zn, at its active site. It catalyzes the quorum sensing signal- N-acyl homoserine lactones (AHLs or N-AHLs)- by hydrolyzing the lactone ring. This process, known as quorum quenching, provides a strategy in the treatment of infectious diseases without introducing selection pressure. However, the activity of lactonase is metal-dependent, and this dependence hampers the clinic usage. In our study, we use the empirical valence bond (EVB) approach to evaluate the catalytic contributions decomposing them to electrostatic and other components. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=enzyme%20redesign" title="enzyme redesign">enzyme redesign</a>, <a href="https://publications.waset.org/abstracts/search?q=empirical%20valence%20%20bond" title=" empirical valence bond"> empirical valence bond</a>, <a href="https://publications.waset.org/abstracts/search?q=lactonase" title=" lactonase"> lactonase</a>, <a href="https://publications.waset.org/abstracts/search?q=quorum%20quenching" title=" quorum quenching"> quorum quenching</a> </p> <a href="https://publications.waset.org/abstracts/84437/enzyme-redesign-from-metal-dependent-to-metal-independent-a-symphony-orchestra-without-concertmasters" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/84437.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">253</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">594</span> Enzyme Immobilization: A Strategy to Overcome Enzyme Limitations and Expand Their Applications</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Charline%20Monnier">Charline Monnier</a>, <a href="https://publications.waset.org/abstracts/search?q=Rudolf%20Andrys"> Rudolf Andrys</a>, <a href="https://publications.waset.org/abstracts/search?q=Irene%20Castellino"> Irene Castellino</a>, <a href="https://publications.waset.org/abstracts/search?q=Lucie%20Zemanova"> Lucie Zemanova</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Due to their inherent sustainability and compatibility with green chemistry principles, enzymes are attracting increasing attention for various applications like bioremediation or biocatalysis. These natural catalysts boast remarkable substrate specificity and operate under mild biological conditions. However, their intrinsic limitations, such as instability at high temperatures or in organic solvents, impede their wider applicability. Enzyme immobilization on supportive matrices emerges as a promising strategy to address these challenges. This approach not only facilitates enzyme reusability but also offers the potential to modulate their stability, activity, and selectivity. The present study investigates the immobilization and application of two distinct groups of hydrolases on supportive matrices: PETases, naturally capable of PolyEthylene Terephthalate (PET) degradation, and cholinesterases (ChEs), key enzymes in neurotransmitter regulation. All tested enzymes will be immobilized on porous and non-porous particles using both covalent and non-covalent methods. Additionally, the stability of PETases and cholinesterases will be explored, followed by exposure to denaturing conditions to assess their resilience under harsh conditions. Furthermore, due to the exceptional catalytic efficiency and selectivity, their biocatalytic efficiency will be tested using xenobiotic substrates, aiming to establish them as replacements for conventional chemical catalysts in environmentally friendly processes. By exploiting the power of enzyme immobilization, this research strives to unlock the full potential of these biocatalysts for sustainable and efficient technological advancements. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=biocatalysis" title="biocatalysis">biocatalysis</a>, <a href="https://publications.waset.org/abstracts/search?q=bioremediation" title=" bioremediation"> bioremediation</a>, <a href="https://publications.waset.org/abstracts/search?q=enzyme%20efficiency" title=" enzyme efficiency"> enzyme efficiency</a>, <a href="https://publications.waset.org/abstracts/search?q=enzyme%20immobilization" title=" enzyme immobilization"> enzyme immobilization</a>, <a href="https://publications.waset.org/abstracts/search?q=green%20chemistry" title=" green chemistry"> green chemistry</a> </p> <a href="https://publications.waset.org/abstracts/182976/enzyme-immobilization-a-strategy-to-overcome-enzyme-limitations-and-expand-their-applications" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/182976.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">57</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">593</span> Fungal Diversity and Bioprospecting of Termite-Associated Fungi from Nothern-Western Ghats of India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Gajanan%20V.%20Mane">Gajanan V. Mane</a>, <a href="https://publications.waset.org/abstracts/search?q=Rashmi%20More"> Rashmi More</a>, <a href="https://publications.waset.org/abstracts/search?q=Mahesh%20S.%20Sonawane"> Mahesh S. Sonawane</a>, <a href="https://publications.waset.org/abstracts/search?q=Tushar%20Lodha"> Tushar Lodha</a>, <a href="https://publications.waset.org/abstracts/search?q=Rohit%20Sharma"> Rohit Sharma</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The diversity of fungi isolated from two different termite species viz., Odontoterms assmuthi and O. abesus was investigated by dilution- plate method, combined with morphological characteristics and sequencing of internal transcribed spacer region. In total, ninety-six fungi were isolated and purified, out of which 69 isolates were obtained from O. assmuthi belonging to 18 genera and 31 species, whereas 27 isolates were obtained from O. abesus belonging to 15 genera and 17 species. The fungal strains were screened for laccase, amylase, cellulase and pectinase enzymes production. Twenty-seven strains were positive for laccase, 59 strains were positive for amylase, 71 strains were positive for cellulase and 72 strains were positive for pectinase enzymes. The antimicrobial activities of the isolated fungi were tested by the dual plate culture method against standard pathogens. Bioactive secondary metabolites were identified by HPLC and LCMS. Four isolates viz., Penicillium goetzii MG 57, Epicoccum sp. MG 39, Penicillium tanzanicum MG 30, Aspergillus polyporicola MG 54, showed positive antimicrobial activity against standard pathogens, Streptococcus pneumonia MCC 2425, Staphylococcus aureus MCC 2408, Pseudomonas aeruginosa MCC 2080, Escherichia coli MCC 2412, Enterococcus faecalis MCC 2409, Klebsiella pneumonia MCC 2451, Micrococcus luteus MCC 2155 and Candida albicans MCC 1151. In conclusion, the study showed that the insect gut harbor fungal diversity, which is futuristic with biotechnological potential and could be a good source of enzymes and antibiotics. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=termites" title="termites">termites</a>, <a href="https://publications.waset.org/abstracts/search?q=fungi" title=" fungi"> fungi</a>, <a href="https://publications.waset.org/abstracts/search?q=its" title=" its"> its</a>, <a href="https://publications.waset.org/abstracts/search?q=enzyme" title=" enzyme"> enzyme</a>, <a href="https://publications.waset.org/abstracts/search?q=antimicrobial%20activity" title=" antimicrobial activity"> antimicrobial activity</a> </p> <a href="https://publications.waset.org/abstracts/149528/fungal-diversity-and-bioprospecting-of-termite-associated-fungi-from-nothern-western-ghats-of-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/149528.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">104</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">592</span> Therapeutic Role of Polygonum bistorta and Zingiber roseum by in vivo and in vitro Study</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Deepak%20Kumar%20Mittal">Deepak Kumar Mittal</a>, <a href="https://publications.waset.org/abstracts/search?q=Alok%20Kumar%20Jena"> Alok Kumar Jena</a>, <a href="https://publications.waset.org/abstracts/search?q=Deepmala%20Joshi"> Deepmala Joshi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The present study was carried out to observe the hepatoprotective effect and antioxidant activity of the aqueous extract of the roots of Polygonum bistorta (PB) (200 mg/kg) and Zingiber roseum (ZR) (250 mg/kg) in rats treated with carbon tetrachloride (0.15 ml/kg, i.p.). Extract of PB and ZR at the tested doses restored the levels of liver homogenate enzymes, glutathione peroxidase, glutathione-S-transferase, superoxide dismutase and catalase enzymes, significantly. The activities of MTT assay significantly recovered the damage and supported the biochemical observations. This study suggests that Zingiber roseum has a higher protective effect on liver, compared to Polygonum bistorta, against carbon tetrachloride-induced hepatotoxicity and possesses antioxidant activities. Also, extracts exhibited moderate anticancer activity towards cell viability at higher concentration. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Polygonum%20bistorta" title="Polygonum bistorta">Polygonum bistorta</a>, <a href="https://publications.waset.org/abstracts/search?q=Zingiber%20roseum" title=" Zingiber roseum"> Zingiber roseum</a>, <a href="https://publications.waset.org/abstracts/search?q=hepatoprotective%20effect" title=" hepatoprotective effect"> hepatoprotective effect</a>, <a href="https://publications.waset.org/abstracts/search?q=carbon%20tetrachloride" title=" carbon tetrachloride"> carbon tetrachloride</a>, <a href="https://publications.waset.org/abstracts/search?q=anti-cancerous" title=" anti-cancerous"> anti-cancerous</a> </p> <a href="https://publications.waset.org/abstracts/1374/therapeutic-role-of-polygonum-bistorta-and-zingiber-roseum-by-in-vivo-and-in-vitro-study" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/1374.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">430</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">591</span> Relation between Low Thermal Stress and Antioxidant Enzymes Activity in a Sweetening Plant: Stevia Rebaudiana Bert</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=T.%20Bettaieb">T. Bettaieb</a>, <a href="https://publications.waset.org/abstracts/search?q=S.%20Soufi"> S. Soufi</a>, <a href="https://publications.waset.org/abstracts/search?q=S.%20Arbaoui"> S. Arbaoui</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Stevia rebaudiana Bert. is a natural sweet plant. The leaves contain diterpene glycosides stevioside, rebaudiosides A-F, steviolbioside and dulcoside, which are responsible for its sweet taste and have commercial value all over the world as sugar substitute in foods and medicines. Stevia rebaudiana Bert. is sensitive temperature lower than 9°C. The possibility of its outdoor culture in Tunisian conditions demand genotypes tolerant to low temperatures. In order to evaluate the low temperature tolerance of eight genotypes of Stevia rebaudiana, the activities of superoxide dismutase (SOD), ascorbate peroxidase (APX) and catalases (CAT) were measured. Before carrying out the analyses, three genotypes of Stevia were exposed for 1 month at a temperature regime of 18°C during the day and 7°C at night similar to winter conditions in Tunisia. In response to the stress generated by low temperature, antioxidant enzymes activity revealed on native gel and quantified by spectrophotometry showed variable levels according to their degree of tolerance to low temperatures. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=chilling%20tolerance" title="chilling tolerance">chilling tolerance</a>, <a href="https://publications.waset.org/abstracts/search?q=enzymatic%20activity" title=" enzymatic activity"> enzymatic activity</a>, <a href="https://publications.waset.org/abstracts/search?q=stevia%20rebaudiana%20bert" title=" stevia rebaudiana bert"> stevia rebaudiana bert</a>, <a href="https://publications.waset.org/abstracts/search?q=low%20thermal%20stress" title=" low thermal stress"> low thermal stress</a> </p> <a href="https://publications.waset.org/abstracts/16932/relation-between-low-thermal-stress-and-antioxidant-enzymes-activity-in-a-sweetening-plant-stevia-rebaudiana-bert" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/16932.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">442</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">590</span> Protective Effect of Nigella sativa Oil and Its Neutral Lipid Fraction on Ethanol-Induced Hepatotoxicity in Rat Model</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Asma%20Mosbah">Asma Mosbah</a>, <a href="https://publications.waset.org/abstracts/search?q=Hanane%20Khither"> Hanane Khither</a>, <a href="https://publications.waset.org/abstracts/search?q=Kamelia%20Mosbah"> Kamelia Mosbah</a>, <a href="https://publications.waset.org/abstracts/search?q=Noreddine%20Kacem%20Chaouche"> Noreddine Kacem Chaouche</a>, <a href="https://publications.waset.org/abstracts/search?q=Mustapha%20Benboubetra"> Mustapha Benboubetra</a> </p> <p class="card-text"><strong>Abstract:</strong></p> In the present investigation, total oil (TO) and its neutral lipid fraction (NLF) extracted from the seed of the well know studied medicinal plant Nigella sativa were tested for their therapeutically effect on alcohol-induced liver injury in rat model. Male Albino rats were divided into five groups of eight animals each and fed a Lieber–DeCarli liquid diet containing 5% ethanol for experimental groups and dextran for control group, for a period of six weeks. Afterwards, rats received, orally, treatments with Nigella sativa extracts (TO, NLF) and N- acetylcysteine (NAC) as a positive control for four weeks. Activities of antioxidant enzymes; superoxide dismutase (SOD) and catalase (CAT), as well as malondialdehyde (MDA) and reduced glutathione (GSH). Biochemical parameters for kidney and liver functions, in treated and non treated rats, were evaluated throughout the time course of an experiment. Liver histological changes were taken into account. Enzymatic activities of both SOD and CAT increased significantly in rats treated with NLF and TO. While MDA level decreased in TO and NLF treated rats, GSH level increased significantly in TO and NLF treated rats. We noted equally a decrease in liver enzymes AST, ALT, and ALP. Microscopic observation of slides from the liver of ethanol treated rats showed a severe hepatotoxicity with lesions. Treatment with fractions leads to an improvement in liver lesions and a marked reduction in necrosis and infiltration. As a conclusion, both extracts of Nigella sativa seeds, TO and NLF, possess an important therapeutic protective potential against ethanol-induced hepatotoxicity in rats. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=alcohol-induced%20hepatotoxicity" title="alcohol-induced hepatotoxicity">alcohol-induced hepatotoxicity</a>, <a href="https://publications.waset.org/abstracts/search?q=antioxidant%20enzymes" title=" antioxidant enzymes"> antioxidant enzymes</a>, <a href="https://publications.waset.org/abstracts/search?q=Nigella%20sativa%20seeds" title=" Nigella sativa seeds"> Nigella sativa seeds</a>, <a href="https://publications.waset.org/abstracts/search?q=oil%20fractions" title=" oil fractions"> oil fractions</a> </p> <a href="https://publications.waset.org/abstracts/86395/protective-effect-of-nigella-sativa-oil-and-its-neutral-lipid-fraction-on-ethanol-induced-hepatotoxicity-in-rat-model" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/86395.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">167</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">589</span> The Selective Reduction of a Morita-baylis-hillman Adduct-derived Ketones Using Various Ketoreductase Enzyme Preparations</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Nompumelelo%20P.%20Mathebula">Nompumelelo P. Mathebula</a>, <a href="https://publications.waset.org/abstracts/search?q=Roger%20A.%20Sheldon"> Roger A. Sheldon</a>, <a href="https://publications.waset.org/abstracts/search?q=Daniel%20P.%20Pienaar"> Daniel P. Pienaar</a>, <a href="https://publications.waset.org/abstracts/search?q=Moira%20L.%20Bode"> Moira L. Bode</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The preparation of enantiopure Morita-Baylis-Hillman (MBH) adducts remains a challenge in organic chemistry. MBH adducts are highly functionalised compounds which act as key intermediates in the preparation of compounds of medicinal importance. MBH adducts are prepared in racemic form by reacting various aldehydes and activated alkenes in the presence of DABCO. Enantiopure MBH adducts can be obtained by employing Enzymatic kinetic resolution (EKR). This technique has been successfully demonstrated in our group, amongst others, using lipases in either hydrolysis or transesterification reactions. As these methods only allow 50% of each enantiomer to be obtained, our interest grew in exploring other enzymatic methods for the synthesis of enantiopure MBH adducts where, theoretically, 100% of the desired enantiomer could be obtained.Dehydrogenase enzymes can be employed on prochiral substrates to obtain optically pure compounds by reducing carbon-carbon double bonds or carbonyl groups of ketones. Ketoreductases have been used historically to obtain enantiopure secondary alcohols on an industrial scale. Ketoreductases are NAD(P)H-dependent enzymes and thus require nicotinamide as a cofactor. This project focuses on employing ketoreductase enzymes to selectively reduce ketones derived from Morita-Baylis-Hillman (MBH) adducts in order to obtain these adducts in enantiopure form.Results obtained from this study will be reported. Good enantioselectivity was observed using a range of different ketoreductases, however, reactions were complicated by the formation of an unexpected by-product, which was characterised employing single crystal x-ray crystallography techniques. Methods to minimise by-product formation are currently being investigated. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=ketoreductase" title="ketoreductase">ketoreductase</a>, <a href="https://publications.waset.org/abstracts/search?q=morita-baylis-hillman" title=" morita-baylis-hillman"> morita-baylis-hillman</a>, <a href="https://publications.waset.org/abstracts/search?q=selective%20reduction" title=" selective reduction"> selective reduction</a>, <a href="https://publications.waset.org/abstracts/search?q=x-ray%20crystallography" title=" x-ray crystallography"> x-ray crystallography</a> </p> <a href="https://publications.waset.org/abstracts/179204/the-selective-reduction-of-a-morita-baylis-hillman-adduct-derived-ketones-using-various-ketoreductase-enzyme-preparations" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/179204.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">66</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">588</span> Effects of Ascophyllum nodosum in Tomato in the Tropical Caribbean Climate: Effects and Molecular Insights into Mechanisms</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Omar%20Ali">Omar Ali</a>, <a href="https://publications.waset.org/abstracts/search?q=Adesh%20Ramsubhag"> Adesh Ramsubhag</a>, <a href="https://publications.waset.org/abstracts/search?q=Jayaraj%20Jayaraman"> Jayaraj Jayaraman</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Seaweed extracts have been reported as plant biostimulants which could be a safer, organic alternative to harsh pesticides. The incentive to use seaweed-based biostimulants is becoming paramount in sustainable agriculture. The current study, therefore, screened a commercial extract of A. nodosum in tomatoes, cultivated in Trinidad to showcase the multiple beneficial effects. Foliar treatment with an A. nodosum commercial extract led to significant increases in fruit yield and a significant reduction of incidence of bacterial spots and early blight diseases under both greenhouse and field conditions. Investigations were carried out to reveal the possible mechanisms of action of this biostimulant through defense enzyme assays and transcriptome profiling via RNA sequencing of tomato. Studies into disease control mechanisms by A. nodosum showed that the extract stimulated the activity of enzymes such as peroxidase, phenylalanine ammonia-lyase, chitinase, polyphenol oxidase, and β-1,3-glucanase. Additionally, the transcriptome survey revealed the upregulation and enrichment of genes responsible for the biosynthesis of growth hormones, defense enzymes, PR proteins and defense-related secondary metabolites, as well as genes involved in the nutrient mobilization, photosynthesis and primary and secondary metabolic pathways. The results of the transcriptome study also demonstrated the cross-talks between growth and defense responses, confirming the bioelicitor and biostimulant value of seaweed extracts in plants. These effects could potentially implicate the benefits of seaweed extract and validate its usage in sustainable crop production. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=A.%20nodosum" title="A. nodosum">A. nodosum</a>, <a href="https://publications.waset.org/abstracts/search?q=biostimulants" title=" biostimulants"> biostimulants</a>, <a href="https://publications.waset.org/abstracts/search?q=elicitor" title=" elicitor"> elicitor</a>, <a href="https://publications.waset.org/abstracts/search?q=enzymes" title=" enzymes"> enzymes</a>, <a href="https://publications.waset.org/abstracts/search?q=growth%20responses" title=" growth responses"> growth responses</a>, <a href="https://publications.waset.org/abstracts/search?q=seaweeds" title=" seaweeds"> seaweeds</a>, <a href="https://publications.waset.org/abstracts/search?q=tomato" title=" tomato"> tomato</a>, <a href="https://publications.waset.org/abstracts/search?q=transcriptome%20analysis" title=" transcriptome analysis"> transcriptome analysis</a> </p> <a href="https://publications.waset.org/abstracts/141553/effects-of-ascophyllum-nodosum-in-tomato-in-the-tropical-caribbean-climate-effects-and-molecular-insights-into-mechanisms" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/141553.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">162</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">587</span> The Antioxidant Gel Mask Supplies Of Bitter Melon's Extract ( Momordica charantia Linn.)</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=N.%20S.%20Risqina">N. S. Risqina</a>, <a href="https://publications.waset.org/abstracts/search?q=G.%20Edijanti"> G. Edijanti</a>, <a href="https://publications.waset.org/abstracts/search?q=P.%20S.%20Nurita"> P. S. Nurita</a>, <a href="https://publications.waset.org/abstracts/search?q=L.%20Endang"> L. Endang</a>, <a href="https://publications.waset.org/abstracts/search?q=R.%20A.%20Siti"> R. A. Siti</a>, <a href="https://publications.waset.org/abstracts/search?q=R.%20Tri"> R. Tri </a> </p> <p class="card-text"><strong>Abstract:</strong></p> Skin is an important and vital organs and also as a mirror of health and life. Facial skin care is one of the main emphasis to get the beautiful, healthy, and fresh skin. Potentially antioxidant phenolic compounds shows, antimutagen, antitumor, anti-inflammatory, and anti-cancer. Flavonoids are a group of polyphenolic compounds that have the nature of free radicals, inhibiting the oxidative and hydrolytic enzymes as well as anti-inflammatory. Bitter melon (Momordica charantia Linn) is a plant that contains flavonoids, and phenolic antioxidant activity. Bitter melon has strong antioxidant activity that can counteract the free radicals.These compounds can prevent free radicals that cause premature aging. Gel masks including depth cleansing is the cosmetics which work in depth and could raise the dead skin cells. Measurement of antioxidant activity of the extract and gel mask is done by using the immersion method of DPPH. IC50 value of ethanol extract of bitter melon fruit of 287.932 ppm. The preparation of gel mask bitter melon fruit extract, necessary to test the effectiveness of antioxidants using DPPH method is done by measuring the inhibition of DPPH and using UV spectrophotometer at the wavelength of maximum DPPH solution. Tests conducted at the beginning and end of the evaluation (day 0 and day 28). The purpose of this study is to determine the antioxidant activity of the bitter melon's extract and to determine the antioxidant activity of ethanol extract gel mask pare in varying concentrations, ie 1xIC100 (0.295%), 2xIC100 (0.590%) and 4xIC100 (1.180%). Evaluation of physical properties of the preparation on (Day-0,7,14,21, and 28) and evaluation of antioxidant activity (day 0 and 28). Data were analyzed using One Way ANOVA to determine differences in the physical properties of each formula. The statistical results showed that differences in the formula and storage time affects the adhesion, dispersive power, dry time and pH it is shown on a significant value of p <0.05, but longer storage does not affect the pH because the significance value p> 0,05. The antioxidant test showed that there are differences in antioxidant activity in all formulas. Measurement of antioxidant activity of bitter melon fruit extract gel mask on day 0 with a concentration of 0.295%, 0.590%, and 1.180%, respectively, are 124,209.277 ppm, ppm 83819.223 and 47323.592 ppm, whereas day 28 consecutive 130 411, 495 ppm, and 53239.806 95561.645 ppm ppm. The Conclusions drawn that there are antioxidant activity in preparation gel mask of bitter melon fruit extract. The antioxidant activity of bitter melon fruit extract gel mask on the day 0 with a concentration of 0.295%, 0.590%, and 1.180%, respectively, are 124,209.277 ppm, ppm 83819.223 and 47323.592 ppm, whereas on day 28 of antioxidant activity gel mask bitter melon fruit extract with a concentration of 0.295%, 0.590%, and 1.180% in succession, namely: 130,411.495 ppm, ppm 95561.645 and 53239.806 ppm. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antioxdant" title="antioxdant">antioxdant</a>, <a href="https://publications.waset.org/abstracts/search?q=bitter%20melon" title=" bitter melon"> bitter melon</a>, <a href="https://publications.waset.org/abstracts/search?q=gel%20mask" title=" gel mask"> gel mask</a>, <a href="https://publications.waset.org/abstracts/search?q=IC50" title=" IC50"> IC50</a> </p> <a href="https://publications.waset.org/abstracts/32963/the-antioxidant-gel-mask-supplies-of-bitter-melons-extract-momordica-charantia-linn" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/32963.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">470</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">586</span> Effect of Auraptene on the Enzymatic Glutathione Redox-System in Nrf2 Knockout Mice</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ludmila%20A.%20Gavriliuc">Ludmila A. Gavriliuc</a>, <a href="https://publications.waset.org/abstracts/search?q=Jerry%20McLarty"> Jerry McLarty</a>, <a href="https://publications.waset.org/abstracts/search?q=Heather%20E.%20Kleiner"> Heather E. Kleiner</a>, <a href="https://publications.waset.org/abstracts/search?q=J.%20Michael%20Mathis"> J. Michael Mathis</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Abstract -- Background: The citrus coumarine Auraptene (Aur) is an effective chemopreventive agent, as manifested in many models of diseases and cancer. Nuclear factor erythroid 2-related factor (Nrf2) is an important regulator of genes induced by oxidative stress, such as glutathione S-transferases, heme oxygenase-1, and peroxiredoxin 1, by activating the antioxidant response element (ARE). Genetic and biochemical evidence has demonstrated that glutathione (GSH) and glutathione-dependent enzymes, glutathione reductase (GR), glutathione peroxidases (GPs), glutathione S-transferases (GSTs) are responsible for the control of intracellular reduction-oxidation status and participate in cellular adaptation to oxidative stress. The effect of Aur on the activity of GR, GPs (Se-GP and Se-iGP), and content of GSH in the liver, kidney, and spleen is insufficiently explored. Aim: Our goal was the examination of the Aur influence on the redox-system of GSH in Nrf2 wild type and Nrf2 knockout mice via activation of Nrf2 and ARE. Methods: Twenty female mice, 10 Nrf2 wild-type (WT) and 10 Nrf2 (-/-) knockout (KO), were bred and genotyped for our study. The activity of GR, Se-GP, Se-iGP, GST, G6PD, CytP450 reductase, catalase (Cat), and content of GSH were analyzed in the liver, kidney, and spleen using Spectrophotometry methods. The results of the specific activity of enzymes and the amount of GSH were analyzed with ANOVA and Spearman statistical methods. Results: Aur (200 mg/kg) treatment induced hepatic GST, GR, Se-GP activity and inhibited their activity in the spleen of mice, most likely via activation of the ARE through Nrf2. Activation in kidney Se-GP and G6PD by Aur is also controlled, apparently through Nrf2. Results of the non-parametric Spearman correlation analysis indicated the strong positive correlation between GR and G6PD only in the liver in WT control mice (r=+0.972; p < 0.005) and in the kidney KO control mice (r=+0.958; p < 0.005). The observed low content of GSH in the liver of KO mice indicated an increase in its participation in the neutralization of toxic substances with the absence of induction of GSH-dependent enzymes, such as GST, GR, Se-GP, and Se-iGP. Activation of CytP450 in kidney and spleen and Cat in the liver in KO mice probably revealed another regulatory mechanism for these enzymes. Conclusion: Thereby, obtained results testify that Aur can modulate the activity of genes and antioxidant enzymatic redox-system of GSH, responsible for the control of intracellular reduction-oxidation status. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=auraptene" title="auraptene">auraptene</a>, <a href="https://publications.waset.org/abstracts/search?q=glutathione" title=" glutathione"> glutathione</a>, <a href="https://publications.waset.org/abstracts/search?q=GST" title=" GST"> GST</a>, <a href="https://publications.waset.org/abstracts/search?q=Nrf2" title=" Nrf2"> Nrf2</a> </p> <a href="https://publications.waset.org/abstracts/133552/effect-of-auraptene-on-the-enzymatic-glutathione-redox-system-in-nrf2-knockout-mice" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/133552.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">149</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">585</span> Optimization of Enzymatic Hydrolysis of Cooked Porcine Blood to Obtain Hydrolysates with Potential Biological Activities</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Miguel%20Pereira">Miguel Pereira</a>, <a href="https://publications.waset.org/abstracts/search?q=L%C3%ADgia%20Pimentel"> Lígia Pimentel</a>, <a href="https://publications.waset.org/abstracts/search?q=Manuela%20Pintado"> Manuela Pintado</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Animal blood is a major by-product of slaughterhouses and still represents a cost and environmental problem in some countries. To be eliminated, blood should be stabilised by cooking and afterwards the slaughterhouses must have to pay for its incineration. In order to reduce the elimination costs and valorise the high protein content the aim of this study was the optimization of hydrolysis conditions, in terms of enzyme ratio and time, in order to obtain hydrolysates with biological activity. Two enzymes were tested in this assay: pepsin and proteases from Cynara cardunculus (cardosins). The latter has the advantage to be largely used in the Portuguese Dairy Industry and has a low price. The screening assays were carried out in a range of time between 0 and 10 h and using a ratio of enzyme/reaction volume between 0 and 5%. The assays were performed at the optimal conditions of pH and temperature for each enzyme: 55 °C at pH 5.2 for cardosins and 37 °C at pH 2.0 for pepsin. After reaction, the hydrolysates were evaluated by FPLC (Fast Protein Liquid Chromatography) and tested for their antioxidant activity by ABTS method. FPLC chromatograms showed different profiles when comparing the enzymatic reactions with the control (no enzyme added). The chromatogram exhibited new peaks with lower MW that were not present in control samples, demonstrating the hydrolysis by both enzymes. Regarding to the antioxidant activity, the best results for both enzymes were obtained using a ratio enzyme/reactional volume of 5% during 5 h of hydrolysis. However, the extension of reaction did not affect significantly the antioxidant activity. This has an industrial relevant aspect in what concerns to the process cost. In conclusion, the enzymatic blood hydrolysis can be a better alternative to the current elimination process allowing to the industry the reuse of an ingredient with biological properties and economic value. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antioxidant%20activity" title="antioxidant activity">antioxidant activity</a>, <a href="https://publications.waset.org/abstracts/search?q=blood" title=" blood"> blood</a>, <a href="https://publications.waset.org/abstracts/search?q=by-products" title=" by-products"> by-products</a>, <a href="https://publications.waset.org/abstracts/search?q=enzymatic%20hydrolysis" title=" enzymatic hydrolysis"> enzymatic hydrolysis</a> </p> <a href="https://publications.waset.org/abstracts/31118/optimization-of-enzymatic-hydrolysis-of-cooked-porcine-blood-to-obtain-hydrolysates-with-potential-biological-activities" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/31118.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">509</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">584</span> Quantitative Structure-Activity Relationship Modeling of Detoxication Properties of Some 1,2-Dithiole-3-Thione Derivatives</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Nadjib%20Melkemi">Nadjib Melkemi</a>, <a href="https://publications.waset.org/abstracts/search?q=Salah%20Belaidi"> Salah Belaidi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Quantitative Structure-Activity Relationship (QSAR) studies have been performed on nineteen molecules of 1,2-dithiole-3-thione analogues. The compounds used are the potent inducers of enzymes involved in the maintenance of reduced glutathione pools as well as phase-2 enzymes important to electrophile detoxication. A multiple linear regression (MLR) procedure was used to design the relationships between molecular descriptor and detoxication properties of the 1,2-dithiole-3-thione derivatives. The predictivity of the model was estimated by cross-validation with the leave-one-out method. Our results suggest a QSAR model based of the following descriptors: qS2, qC3, qC5, qS6, DM, Pol, log P, MV, SAG, HE and EHOMO for the specific activity of quinone reductase; qS1, qS2, qC3, qC4, qC5, qS6, DM, Pol, logP, MV, SAG, HE and EHOMO for the production of growth hormone. To confirm the predictive power of the models, an external set of molecules was used. High correlation between experimental and predicted activity values was observed, indicating the validation and the good quality of the derived QSAR models. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=QSAR" title="QSAR">QSAR</a>, <a href="https://publications.waset.org/abstracts/search?q=quinone%20reductase%20activity" title=" quinone reductase activity"> quinone reductase activity</a>, <a href="https://publications.waset.org/abstracts/search?q=production%20of%20growth%20hormone" title=" production of growth hormone"> production of growth hormone</a>, <a href="https://publications.waset.org/abstracts/search?q=MLR" title=" MLR"> MLR</a> </p> <a href="https://publications.waset.org/abstracts/7137/quantitative-structure-activity-relationship-modeling-of-detoxication-properties-of-some-12-dithiole-3-thione-derivatives" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/7137.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">350</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">583</span> Biochemical Changes in the Liver of Mice after Exposure to Different Doses of Diclofenac Sodium</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Deepak%20Mohan">Deepak Mohan</a>, <a href="https://publications.waset.org/abstracts/search?q=Sushma%20Sharma"> Sushma Sharma</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Non-Steroidal Anti-Inflammatory Drugs (NSAIDs) are a group of widely used drugs for the treatment of rheumatoid diseases and to relieve pain and inflammation due to their analgesic anti-pyretic and anti-inflammatory properties. The therapeutic and many of the toxic effects of NSAIDs result from reversible inhibition of enzymes in the cyclooxygenase (COX) group. In the present investigation the effect of the drug on the concentration of lipids, and on the activity of the enzymes i.e. acid and alkaline phosphatase, GOT, GPT and lipid peroxidase were studied. There was a significant enhancement in the activities of both acid and alkaline phosphatase after 21 days of treatment. Proportionate increase in the MDA contents was observed after different days of diclofenac treatment. Cellular damage in the liver resulted in decrease in the activity of both GOT (Glutamate oxaloacetate transaminase) and GPT (Glutamate pyruvate transaminase) in both low and high dose groups. Significant decrease in the liver contents was also observed in both dose groups. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=anti-inflammatory" title="anti-inflammatory">anti-inflammatory</a>, <a href="https://publications.waset.org/abstracts/search?q=cyclooxygenase" title=" cyclooxygenase"> cyclooxygenase</a>, <a href="https://publications.waset.org/abstracts/search?q=glutamate%20oxaloacetate%20transaminase" title=" glutamate oxaloacetate transaminase"> glutamate oxaloacetate transaminase</a>, <a href="https://publications.waset.org/abstracts/search?q=malondialdehyde" title=" malondialdehyde"> malondialdehyde</a> </p> <a href="https://publications.waset.org/abstracts/62653/biochemical-changes-in-the-liver-of-mice-after-exposure-to-different-doses-of-diclofenac-sodium" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/62653.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">301</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">582</span> A Proteomic Approach for Discovery of Microbial Cellulolytic Enzymes</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=M.%20S.%20Matlala">M. S. Matlala</a>, <a href="https://publications.waset.org/abstracts/search?q=I.%20Ignatious"> I. Ignatious</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Environmental sustainability has taken the center stage in human life all over the world. Energy is the most essential component of our life. The conventional sources of energy are non-renewable and have a detrimental environmental impact. Therefore, there is a need to move from conventional to non-conventional renewable energy sources to satisfy the world’s energy demands. The study aimed at screening for microbial cellulolytic enzymes using a proteomic approach. The objectives were to screen for microbial cellulases with high specific activity and separate the cellulolytic enzymes using a combination of zymography and two-dimensional (2-D) gel electrophoresis followed by tryptic digestion, Matrix-assisted Laser Desorption Ionisation-Time of Flight (MALDI-TOF) and bioinformatics analysis. Fungal and bacterial isolates were cultured in M9 minimal and Mandel media for a period of 168 hours at 60°C and 30°C with cellobiose and Avicel as carbon sources. Microbial cells were separated from supernatants through centrifugation, and the crude enzyme from the cultures was used for the determination of cellulase activity, zymography, SDS-PAGE, and two-dimensional gel electrophoresis. Five isolates, with lytic action on carbon sources studied, were a bacterial strain (BARK) and fungal strains (VCFF1, VCFF14, VCFF17, and VCFF18). Peak cellulase production by the selected isolates was found to be 3.8U/ml, 2.09U/ml, 3.38U/ml, 3.18U/ml, and 1.95U/ml, respectively. Two-dimensional gel protein maps resulted in the separation and quantitative expression of different proteins by the microbial isolates. MALDI-TOF analysis and database search showed that the expressed proteins in this study closely relate to different glycoside hydrolases produced by other microbial species with an acceptable confidence level of 100%. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cellulases" title="cellulases">cellulases</a>, <a href="https://publications.waset.org/abstracts/search?q=energy" title=" energy"> energy</a>, <a href="https://publications.waset.org/abstracts/search?q=two-dimensional%20gel%20electrophoresis" title=" two-dimensional gel electrophoresis"> two-dimensional gel electrophoresis</a>, <a href="https://publications.waset.org/abstracts/search?q=matrix-assisted%20laser%20desorption%20ionisation-time%20of%20flight" title=" matrix-assisted laser desorption ionisation-time of flight"> matrix-assisted laser desorption ionisation-time of flight</a>, <a href="https://publications.waset.org/abstracts/search?q=MALDI-TOF%20MS" title=" MALDI-TOF MS"> MALDI-TOF MS</a> </p> <a href="https://publications.waset.org/abstracts/111097/a-proteomic-approach-for-discovery-of-microbial-cellulolytic-enzymes" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/111097.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">134</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">581</span> Susceptibility of Spodoptera littoralis, Field Populations in Egypt to Chlorantraniliprole and the Role of Detoxification Enzymes</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Mohamed%20H.%20Khalifa">Mohamed H. Khalifa</a>, <a href="https://publications.waset.org/abstracts/search?q=Fikry%20I.%20El-Shahawi"> Fikry I. El-Shahawi</a>, <a href="https://publications.waset.org/abstracts/search?q=Nabil%20A.%20Mansour"> Nabil A. Mansour</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The cotton leafworm, <em>Spodoptera</em> <em>littoralis</em> (Boisduval) is a major insect pest of vegetables and cotton crops in Egypt, and exhibits different levels of tolerance to certain insecticides. Chlorantraniliprole has been registered recently in Egypt for control this insect. The susceptibilities of three <em>S. littoralis</em> populations collected from El Behaira governorate, north Egypt to chlorantraniliprole were determined by leaf-dipping technique on 4<sup>th</sup> instar larvae. Obvious variation of toxicity was observed among the laboratory susceptible, and three field populations with LC<sub>50</sub> values ranged between 1.53 µg/ml and 6.22 µg/ml. However, all the three field populations were less susceptible to chlorantraniliprole than a laboratory susceptible population. The most tolerant populations were sampled from El Delengat (ED) Province where <em>S. littoralis</em> had been frequently challenged by insecticides. Certain enzyme activity assays were carried out to be correlated with the mechanism of the observed field population tolerance. All field populations showed significantly enhanced activities of detoxification enzymes compared with the susceptible strain. The regression analysis between chlorantraniliprole toxicities and enzyme activities revealed that the highest correlation is between α-esterase or β-esterase (α-β-EST) activity and collected field strains susceptibility, otherwise this correlation is not significant (P > 0.05). Synergism assays showed the ED and susceptible strains could be synergized by known detoxification inhibitors such as piperonyl butoxide (PBO), triphenyl phosphate (TPP) and diethyl-maleate (DEM) at different levels (1.01-8.76-fold and 1.09-2.94 fold, respectively), TPP showed the maximum synergism in both strains. The results show that there is a correlation between the enzyme activity and tolerance, and carboxylic-esterase (Car-EST) is likely the main detoxification mechanism responsible for tolerance of <em>S. littoralis</em> to chlorantraniliprole. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=chlorantraniliprole" title="chlorantraniliprole">chlorantraniliprole</a>, <a href="https://publications.waset.org/abstracts/search?q=detoxification%20enzymes" title=" detoxification enzymes"> detoxification enzymes</a>, <a href="https://publications.waset.org/abstracts/search?q=Egypt" title=" Egypt"> Egypt</a>, <a href="https://publications.waset.org/abstracts/search?q=Spodoptera%20littoralis" title=" Spodoptera littoralis"> Spodoptera littoralis</a> </p> <a href="https://publications.waset.org/abstracts/62316/susceptibility-of-spodoptera-littoralis-field-populations-in-egypt-to-chlorantraniliprole-and-the-role-of-detoxification-enzymes" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/62316.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">274</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">580</span> Metabolic Profiling of Populus trichocarpa Family 1 UDP-Glycosyltransferases</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Patricia%20M.%20B.%20Saint-Vincent">Patricia M. B. Saint-Vincent</a>, <a href="https://publications.waset.org/abstracts/search?q=Anna%20Furches"> Anna Furches</a>, <a href="https://publications.waset.org/abstracts/search?q=Stephanie%20Galanie"> Stephanie Galanie</a>, <a href="https://publications.waset.org/abstracts/search?q=Erica%20Teixeira%20Prates"> Erica Teixeira Prates</a>, <a href="https://publications.waset.org/abstracts/search?q=Piet%20Jones"> Piet Jones</a>, <a href="https://publications.waset.org/abstracts/search?q=Nancy%20Engle"> Nancy Engle</a>, <a href="https://publications.waset.org/abstracts/search?q=David%20Kainer"> David Kainer</a>, <a href="https://publications.waset.org/abstracts/search?q=Wellington%20Muchero"> Wellington Muchero</a>, <a href="https://publications.waset.org/abstracts/search?q=Daniel%20Jacobson"> Daniel Jacobson</a>, <a href="https://publications.waset.org/abstracts/search?q=Timothy%20J.%20Tschaplinski"> Timothy J. Tschaplinski</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Uridine diphosphate-glycosyltransferases (UGTs) are enzymes that catalyze sugar transfer to a variety of plant metabolites. UGT substrates, which include plant secondary metabolites involved in lignification, demonstrate new activities and incorporation when glycosylated. Knowledge of UGT function, substrate specificity, and enzyme products is important for plant engineering efforts, especially related to increasing plant biomass through lignification. UGTs in Populus trichocarpa, a biofuel feedstock, and model woody plant, were selected from a pool of gene candidates using rapid prioritization strategies. A functional genomics workflow, consisting of a metabolite genome-wide association study (mGWAS), expression of synthetic codon-optimized genes, and high-throughput biochemical assays with mass spectrometry-based analysis, was developed for determining the substrates and products of previously-uncharacterized enzymes. A total of 40 UGTs from P. trichocarpa were profiled, and the biochemical assay results were compared to predicted mGWAS connections. Assay results confirmed seven of 11 leaf mGWAS associations and demonstrated varying levels of substrate specificity among candidate UGTs. P. trichocarpa UGT substrate processing confirms the role of these newly-characterized enzymes in lignan, flavonoid, and phytohormone metabolism, with potential implications for cell wall biosynthesis, nitrogen uptake, and biotic and abiotic stress responses. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Populus" title="Populus">Populus</a>, <a href="https://publications.waset.org/abstracts/search?q=metabolite-gene%20associations" title=" metabolite-gene associations"> metabolite-gene associations</a>, <a href="https://publications.waset.org/abstracts/search?q=GWAS" title=" GWAS"> GWAS</a>, <a href="https://publications.waset.org/abstracts/search?q=bio%20feedstocks" title=" bio feedstocks"> bio feedstocks</a>, <a href="https://publications.waset.org/abstracts/search?q=glycosyltransferase" title=" glycosyltransferase"> glycosyltransferase</a> </p> <a href="https://publications.waset.org/abstracts/155204/metabolic-profiling-of-populus-trichocarpa-family-1-udp-glycosyltransferases" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/155204.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">114</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">579</span> High Acid-Stable α-Amylase Production by Milk in Liquid Culture</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Shohei%20Matsuo">Shohei Matsuo</a>, <a href="https://publications.waset.org/abstracts/search?q=Saki%20Mikai"> Saki Mikai</a>, <a href="https://publications.waset.org/abstracts/search?q=Hiroshi%20Morita"> Hiroshi Morita</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Objectives: Shochu is a popular Japanese distilled spirits. In the production of shochu, the filamentous fungus Aspergillus kawachii has traditionally been used. A. kawachii produces two types of starch hydrolytic enzymes, α-amylase (enzymatic liquefaction) and glucoamylase (enzymatic saccharification). Liquid culture system is a relatively easy microorganism to ferment with relatively low cost of production compared for solid culture. In liquid culture system, acid-unstable α-amylase (α-A) was produced abundantly, but, acid-stable α-amylase (Aα-A) was not produced. Since there is high enzyme productivity, most in shochu brewing have been adopted by a solid culture method. In this study, therefore, we investigated production of Aα-A in liquid culture system. Materials and methods: Microorganism Aspergillus kawachii NBRC 4308 was used. The mold was cultured at 30 °C for 7~14 d to allow formation of conidiospores on slant agar medium. Liquid Culture System: A. kawachii was cultured in a 100 ml of following altered SLS medium: 1.0 g of rice flour, 0.1 g of K2HPO4, 0.1 g of KCl, 0.6 g of tryptone, 0.05 g of MgSO4・7H2O, 0.001 g of FeSO4・7H2O, 0.0003 g of ZnSO4・7H2O, 0.021 g of CaCl2, 0.33 of citric acid (pH 3.0). The pH of the medium was adjusted to the designated value with 10 % HCl solution. The cultivation was shaking at 30 °C and 200 rpm for 72 h. It was filtered to obtain a crude enzyme solution. Aα-A assay: The crude enzyme solution was analyzed. An acid-stable α-amylase activity was carried out using an α-amylase assay kit (Kikkoman Corporation, Noda, Japan). It was conducted after adding 9 ml of 100 mM acetate buffer (pH 3.0) to 1 ml of the culture product supernatant and acid treatment at 37°C for 1 h. One unit of a-amylase activity was defined as the amount of enzyme that yielded 1 mmol of 2-chloro-4-nitrophenyl 6-azide-6-deoxy-b-maltopentaoside (CNP) per minute. Results and Conclusion: We experimented with co-culture of A. kawachii and lactobacillus in order to get control of pH in altered SLS medium. However, high production of acid-stable α-amylase was not obtained. We experimented with yoghurt or milk made an addition to liquid culture. The result indicated that high production of acid-stable α-amylase (964 U/g-substrate) was obtained when milk made an addition to liquid culture. Phosphate concentration in the liquid medium was a major cause of increased acid-stable α-amylase activity. In liquid culture, acid-stable α-amylase activity was enhanced by milk, but Fats and oils in the milk were oxidized. In addition, Tryptone is not approved as a food additive in Japan. Thus, alter SLS medium added to skim milk excepting for the fats and oils in the milk instead of tryptone. The result indicated that high production of acid-stable α-amylase was obtained with the same effect as milk. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=acid-stable%20%CE%B1-amylase" title="acid-stable α-amylase">acid-stable α-amylase</a>, <a href="https://publications.waset.org/abstracts/search?q=liquid%20culture" title=" liquid culture"> liquid culture</a>, <a href="https://publications.waset.org/abstracts/search?q=milk" title=" milk"> milk</a>, <a href="https://publications.waset.org/abstracts/search?q=shochu" title=" shochu"> shochu</a> </p> <a href="https://publications.waset.org/abstracts/49381/high-acid-stable-a-amylase-production-by-milk-in-liquid-culture" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/49381.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">284</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">578</span> Phytochemical Screening and Assessment of Hepatoprotective Activity of Geigeria alata Leaves Ethanolic Extract on Wistar Rats</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Girgis%20Younan">Girgis Younan</a>, <a href="https://publications.waset.org/abstracts/search?q=Ikram%20Eltayeb"> Ikram Eltayeb</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Geigeria alata belongs to the family Asteraceae, is an effective plant traditionally used in Sudan as a therapy for hepatic disease and as an antiepileptic, antispasmodic and to treat cough and intestinal complaints.The liver is responsible for many critical functions within the body and any liver disease or injury will result in the loss of those functions leading to significant damage in the body. Liver diseases cause increase in liver enzymes (AST, ALP ALT) and total bilirubin and a decrease in total blood protein level. The objective of this study is to investigate the hepato-protective activity of Geigeria alata leaves ethanolic extract. The plant leaves were extracted using 96% ethanol using Soxhlet apparatus. The hepatoprotective effect was determined using 25 wistar rats, the rats was divided to 5 groups, each group contain 5 rats: [Normal control group] receiving purified water, liver damage was induced in wistar rats by administering a 1:1 (v/v) mixture of CCl4 (1.25 ml/kg) and olive oil once at day four of the experiment [negative control group]. Two doses of extract [400mg/kg and 200mg/kg] was applied daily for 7 days, and standard drug Silymarin (200 mg/kg) were administered daily for 7 days to CCl4-treated rats. The degree of hepato-protective activity was evaluated by determining the hepatic marker enzymes AST, ALP, ALT, total Bilirubin and total proteins (TP). Results have shown that, the extract of G.alata leaves reduced the level of liver enzymes ALT, AST, ALP, total bilirubin and increased the level of total proteins. Since the levels of liver enzymes; bilirubin and total protein are considered as markers of liver function, the extract has proven to reduce the detrimental effects of liver toxicity induced using CCl4. The hepato-protective effect of extract on liver was found to be dose dependent, where the 400mg/kg dose of the extract exhibited higher activity than 200mg/kg dose. In addition, the effect of the higher dose (400mg/kg) of the extract was found to be higher than Silymarin standard drug. The result concludes that, G.alata leaves extract was found to exhibit profound hepato-protective activity, which justifies the traditional use of the plant for the treatment of hepatic diseases. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=alata" title="alata">alata</a>, <a href="https://publications.waset.org/abstracts/search?q=extract" title=" extract"> extract</a>, <a href="https://publications.waset.org/abstracts/search?q=geigeria" title=" geigeria"> geigeria</a>, <a href="https://publications.waset.org/abstracts/search?q=hepatoprotective" title=" hepatoprotective"> hepatoprotective</a> </p> <a href="https://publications.waset.org/abstracts/78269/phytochemical-screening-and-assessment-of-hepatoprotective-activity-of-geigeria-alata-leaves-ethanolic-extract-on-wistar-rats" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/78269.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">233</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">577</span> Nanoparticle Induced Neurotoxicity Mediated by Mitochondria</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Nandini%20Nalika">Nandini Nalika</a>, <a href="https://publications.waset.org/abstracts/search?q=Suhel%20Parvez"> Suhel Parvez</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Nanotechnology has emerged to play a vital role in developing all through the industrial world with an immense production of nanomaterials including nanoparticles (NPs). Many toxicological studies have confirmed that due to unique small size and physico-chemical properties of NPs (1-100nm), they can be potentially hazardous. Metallic NPs of small size have been shown to induce higher levels of cellular oxidative stress and can easily pass through the Blood Brain Barrier (BBB) and significantly accumulate in brain. With the wide applications of titanium dioxide nanoparticles (TNPs) in day-to-day life in form of cosmetics, paints, sterilisation and so on, there is growing concern regarding the deleterious effects of TNPs on central nervous system and mitochondria appear to be important cellular organelles targeted to the pro-oxidative effects of NPs and an important source that contribute significantly for the production of reactive oxygen species after some toxicity or an injury. The aim of our study was to elucidate the effect of TNPs in anatase form with different concentrations (5-50 µg/ml) following with various oxidative stress markers in isolated brain mitochondria as an in vitro model. Oxidative stress was determined by measuring the different oxidative stress markers like lipid peroxidation as well as the protein carbonyl content which was found to be significantly increased. Reduced glutathione content and major glutathione metabolizing enzymes were also modulated signifying the role of glutathione redox cycle in the pathophysiology of TNPs. The study also includes the mitochondrial enzymes (Complex 1, Complex II, complex IV, Complex V ) and the enzymes showed toxicity in a relatively short time due to the effect of TNPs. The study provide a range of concentration that were toxic to the neuronal cells and data pointing to a general toxicity in brain mitochondria by TNPs, therefore, it is in need to consider the proper utilization of NPs in the environment. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=mitochondria" title="mitochondria">mitochondria</a>, <a href="https://publications.waset.org/abstracts/search?q=nanoparticles" title=" nanoparticles"> nanoparticles</a>, <a href="https://publications.waset.org/abstracts/search?q=brain" title=" brain"> brain</a>, <a href="https://publications.waset.org/abstracts/search?q=in%20vitro" title=" in vitro "> in vitro </a> </p> <a href="https://publications.waset.org/abstracts/22740/nanoparticle-induced-neurotoxicity-mediated-by-mitochondria" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/22740.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">398</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">576</span> Variation in Carboxylesterase Activity in Spodoptera litura Fabricious (Noctuidae: Lepidoptera) Populations from India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=V.%20Karuppaiah">V. Karuppaiah</a>, <a href="https://publications.waset.org/abstracts/search?q=J.%20C.%20Padaria"> J. C. Padaria</a>, <a href="https://publications.waset.org/abstracts/search?q=C.%20Srivastava"> C. Srivastava</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura Fab (Lepidoptera: Noctuidae) is a polyphagous pest various field and horticulture crops in India. Pest had virtually developed resistance to all commonly used insecticides. Enhanced detoxification is the prime mechanism that is dictated by detoxification different enzymes and carboxylesterase is one of the major enzyme responsible development of resistance. In India, insecticide resistance studies on S. litura are mainly deployed on detoxification enzymes activity and investigation at gene level alteration i.e. at nucleotide level is very merger. In the present study, we collected the S. litura larvae from three different cauliflower growing belt viz., IARI, New Delhi (Delhi), Palari, Sonepat (Haryana) and Varanasi (Uttar Pradesh) to study the role of carboxylesterase activity and its gene level variation The CarE activity was measured using UV-VIS spectrophotometer with 3rd instar larvae of S. litura. The elevated activity of CarE was observed in Sonepat strain (28.09 ± 0.09 µmol/min/mg of protein) followed by Delhi (26.72 ± 0.04 µmol/min/mg of protein) and Varanasi strain (10.00 ± 0.44 µmol/min/mg of protein) of S. litura. The genomic DNA was isolated from 3rd instar larvae and CarE gene was amplified using a primer sequence, F:5’tccagagttccttgtcaggcac3’; R:5’ctgcatcaagcatgtctc3. CarE gene, about 500bp was partially amplified, sequenced and submitted to NCBI (Accession No. KF835886, KF835887 and KF835888). The sequence data revealed polymorphism at nucleotide level in all the three strains and gene found to have 88 to 97% similarity with previous available nucleotide sequences of S. litura, S. littoralis and S. exiqua. The polymorphism at the nucleotide level could be a reason for differential activity of carboxylesterase enzymes among the strains. However, investigation at gene expression level would be useful to analyze the overproduction of carboxylesterase enzyme. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=carboxylesterase" title="carboxylesterase">carboxylesterase</a>, <a href="https://publications.waset.org/abstracts/search?q=CarE%20gene" title=" CarE gene"> CarE gene</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide%20polymorphism" title=" nucleotide polymorphism"> nucleotide polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a> </p> <a href="https://publications.waset.org/abstracts/13619/variation-in-carboxylesterase-activity-in-spodoptera-litura-fabricious-noctuidae-lepidoptera-populations-from-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/13619.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">922</span> </span> </div> </div> <ul class="pagination"> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=3" rel="prev">&lsaquo;</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=1">1</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=2">2</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=3">3</a></li> <li class="page-item active"><span class="page-link">4</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=5">5</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=6">6</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=7">7</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=8">8</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=9">9</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=10">10</a></li> <li class="page-item disabled"><span class="page-link">...</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=23">23</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=24">24</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=hydrolytic%20enzymes&page=5" rel="next">&rsaquo;</a></li> </ul> </div> </main> <footer> <div id="infolinks" class="pt-3 pb-2"> <div class="container"> <div style="background-color:#f5f5f5;" class="p-3"> <div class="row"> <div class="col-md-2"> <ul class="list-unstyled"> About <li><a href="https://waset.org/page/support">About Us</a></li> <li><a href="https://waset.org/page/support#legal-information">Legal</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/WASET-16th-foundational-anniversary.pdf">WASET celebrates its 16th foundational anniversary</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Account <li><a href="https://waset.org/profile">My Account</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Explore <li><a href="https://waset.org/disciplines">Disciplines</a></li> <li><a href="https://waset.org/conferences">Conferences</a></li> <li><a href="https://waset.org/conference-programs">Conference Program</a></li> <li><a href="https://waset.org/committees">Committees</a></li> <li><a href="https://publications.waset.org">Publications</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Research <li><a href="https://publications.waset.org/abstracts">Abstracts</a></li> <li><a href="https://publications.waset.org">Periodicals</a></li> <li><a href="https://publications.waset.org/archive">Archive</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Open Science <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Philosophy.pdf">Open Science Philosophy</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Award.pdf">Open Science Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Society-Open-Science-and-Open-Innovation.pdf">Open Innovation</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Postdoctoral-Fellowship-Award.pdf">Postdoctoral Fellowship Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Scholarly-Research-Review.pdf">Scholarly Research Review</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Support <li><a href="https://waset.org/page/support">Support</a></li> <li><a href="https://waset.org/profile/messages/create">Contact Us</a></li> <li><a href="https://waset.org/profile/messages/create">Report Abuse</a></li> </ul> </div> </div> </div> </div> </div> <div class="container text-center"> <hr style="margin-top:0;margin-bottom:.3rem;"> <a href="https://creativecommons.org/licenses/by/4.0/" target="_blank" class="text-muted small">Creative Commons Attribution 4.0 International License</a> <div id="copy" class="mt-2">© 2024 World Academy of Science, Engineering and Technology</div> </div> </footer> <a href="javascript:" id="return-to-top"><i class="fas fa-arrow-up"></i></a> <div class="modal" id="modal-template"> <div class="modal-dialog"> <div class="modal-content"> <div class="row m-0 mt-1"> <div class="col-md-12"> <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">×</span></button> </div> </div> <div class="modal-body"></div> </div> </div> </div> <script src="https://cdn.waset.org/static/plugins/jquery-3.3.1.min.js"></script> <script src="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/js/bootstrap.bundle.min.js"></script> <script src="https://cdn.waset.org/static/js/site.js?v=150220211556"></script> <script> jQuery(document).ready(function() { /*jQuery.get("https://publications.waset.org/xhr/user-menu", function (response) { jQuery('#mainNavMenu').append(response); });*/ jQuery.get({ url: "https://publications.waset.org/xhr/user-menu", cache: false }).then(function(response){ jQuery('#mainNavMenu').append(response); }); }); </script> </body> </html>