CINXE.COM

Search results for: activity level

<!DOCTYPE html> <html lang="en" dir="ltr"> <head> <!-- Google tag (gtag.js) --> <script async src="https://www.googletagmanager.com/gtag/js?id=G-P63WKM1TM1"></script> <script> window.dataLayer = window.dataLayer || []; function gtag(){dataLayer.push(arguments);} gtag('js', new Date()); gtag('config', 'G-P63WKM1TM1'); </script> <!-- Yandex.Metrika counter --> <script type="text/javascript" > (function(m,e,t,r,i,k,a){m[i]=m[i]||function(){(m[i].a=m[i].a||[]).push(arguments)}; m[i].l=1*new Date(); for (var j = 0; j < document.scripts.length; j++) {if (document.scripts[j].src === r) { return; }} k=e.createElement(t),a=e.getElementsByTagName(t)[0],k.async=1,k.src=r,a.parentNode.insertBefore(k,a)}) (window, document, "script", "https://mc.yandex.ru/metrika/tag.js", "ym"); ym(55165297, "init", { clickmap:false, trackLinks:true, accurateTrackBounce:true, webvisor:false }); </script> <noscript><div><img src="https://mc.yandex.ru/watch/55165297" style="position:absolute; left:-9999px;" alt="" /></div></noscript> <!-- /Yandex.Metrika counter --> <!-- Matomo --> <script> var _paq = window._paq = window._paq || []; /* tracker methods like "setCustomDimension" should be called before "trackPageView" */ _paq.push(['trackPageView']); _paq.push(['enableLinkTracking']); (function() { var u="//matomo.waset.org/"; _paq.push(['setTrackerUrl', u+'matomo.php']); _paq.push(['setSiteId', '2']); var d=document, g=d.createElement('script'), s=d.getElementsByTagName('script')[0]; g.async=true; g.src=u+'matomo.js'; s.parentNode.insertBefore(g,s); })(); </script> <!-- End Matomo Code --> <title>Search results for: activity level</title> <meta name="description" content="Search results for: activity level"> <meta name="keywords" content="activity level"> <meta name="viewport" content="width=device-width, initial-scale=1, minimum-scale=1, maximum-scale=1, user-scalable=no"> <meta charset="utf-8"> <link href="https://cdn.waset.org/favicon.ico" type="image/x-icon" rel="shortcut icon"> <link href="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/css/bootstrap.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/plugins/fontawesome/css/all.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/css/site.css?v=150220211555" rel="stylesheet"> </head> <body> <header> <div class="container"> <nav class="navbar navbar-expand-lg navbar-light"> <a class="navbar-brand" href="https://waset.org"> <img src="https://cdn.waset.org/static/images/wasetc.png" alt="Open Science Research Excellence" title="Open Science Research Excellence" /> </a> <button class="d-block d-lg-none navbar-toggler ml-auto" type="button" data-toggle="collapse" data-target="#navbarMenu" aria-controls="navbarMenu" aria-expanded="false" aria-label="Toggle navigation"> <span class="navbar-toggler-icon"></span> </button> <div class="w-100"> <div class="d-none d-lg-flex flex-row-reverse"> <form method="get" action="https://waset.org/search" class="form-inline my-2 my-lg-0"> <input class="form-control mr-sm-2" type="search" placeholder="Search Conferences" value="activity level" name="q" aria-label="Search"> <button class="btn btn-light my-2 my-sm-0" type="submit"><i class="fas fa-search"></i></button> </form> </div> <div class="collapse navbar-collapse mt-1" id="navbarMenu"> <ul class="navbar-nav ml-auto align-items-center" id="mainNavMenu"> <li class="nav-item"> <a class="nav-link" href="https://waset.org/conferences" title="Conferences in 2025/2026/2027">Conferences</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/disciplines" title="Disciplines">Disciplines</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/committees" rel="nofollow">Committees</a> </li> <li class="nav-item dropdown"> <a class="nav-link dropdown-toggle" href="#" id="navbarDropdownPublications" role="button" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"> Publications </a> <div class="dropdown-menu" aria-labelledby="navbarDropdownPublications"> <a class="dropdown-item" href="https://publications.waset.org/abstracts">Abstracts</a> <a class="dropdown-item" href="https://publications.waset.org">Periodicals</a> <a class="dropdown-item" href="https://publications.waset.org/archive">Archive</a> </div> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/page/support" title="Support">Support</a> </li> </ul> </div> </div> </nav> </div> </header> <main> <div class="container mt-4"> <div class="row"> <div class="col-md-9 mx-auto"> <form method="get" action="https://publications.waset.org/abstracts/search"> <div id="custom-search-input"> <div class="input-group"> <i class="fas fa-search"></i> <input type="text" class="search-query" name="q" placeholder="Author, Title, Abstract, Keywords" value="activity level"> <input type="submit" class="btn_search" value="Search"> </div> </div> </form> </div> </div> <div class="row mt-3"> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Commenced</strong> in January 2007</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Frequency:</strong> Monthly</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Edition:</strong> International</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Paper Count:</strong> 18054</div> </div> </div> </div> <h1 class="mt-3 mb-3 text-center" style="font-size:1.6rem;">Search results for: activity level</h1> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18054</span> Level of Physical Activity and Physical Fitness, and Attitudes towards Physical Activity among Senior Medical Students of Sultan Qaboos University, Sultanate of Oman</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Hajar%20Al%20Rajaibi">Hajar Al Rajaibi</a>, <a href="https://publications.waset.org/abstracts/search?q=Kawla%20Al%20Toubi"> Kawla Al Toubi</a>, <a href="https://publications.waset.org/abstracts/search?q=Saeed%20Al%20Jaadi"> Saeed Al Jaadi</a>, <a href="https://publications.waset.org/abstracts/search?q=Deepali%20Jaju"> Deepali Jaju</a>, <a href="https://publications.waset.org/abstracts/search?q=Sanjay%20Jaju"> Sanjay Jaju</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Background: The available evidence in Oman on lack of physical activity call for immediate intervention. Physical activity counseling by doctors to their patients is influenced by their attitudes and personal physical fitness. To our best knowledge, the physical activity status of Omani medical students has not been addressed before. These future doctors will have a critical role in improving physical activity in patients and thus their overall health. Objective: The aim of the study is to assess the physical activity level, physical fitness level, and attitudes towards physical activity among Sultan Qaboos University senior medical students. Methods: In this cross-sectional study (N=110; males 55), physical activity level was assessed using International Physical Activity Questionnaire (IPAQ ) short form and attitudes towards physical activity using a fifty-four-items Kenyon questionnaire. The physical fitness level was assessed by estimating maximal oxygen uptake (VO₂max) using Chester step test. Results: Female students reported more sitting time more than 7hr/day (85.5%) compared to male students (40%; p < 0.05). The IPAQ revealed moderate level of physical activity in 58% of students. Students showed a high positive attitude towards physical activity for health and fitness and low attitude for physical activity as tension and risk. Both female and male students had a similar level and attitude towards physical activity. Physical fitness level was excellent (VO₂max > 55ml O₂/kg/min) in 11% of students, good (VO₂max>44-54ml O₂/kg/min) in 49% and average to below-average in 40%. Objectively measured physical fitness level, subjectively reported physical activity level or attitudes towards physical activity were not correlated. Conclusion: Omani medical students have a positive attitude towards physical activity but moderate physical activity level. Longer sitting time in females need further evaluation. Efforts are required to understand reasons for present physical activity level and to promote good physical activity among medical students by creating more awareness and facilities. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Chester%20step%20test" title="Chester step test">Chester step test</a>, <a href="https://publications.waset.org/abstracts/search?q=Kenyon%20scale" title=" Kenyon scale"> Kenyon scale</a>, <a href="https://publications.waset.org/abstracts/search?q=medical%20students" title=" medical students"> medical students</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20fitness" title=" physical fitness"> physical fitness</a> </p> <a href="https://publications.waset.org/abstracts/110676/level-of-physical-activity-and-physical-fitness-and-attitudes-towards-physical-activity-among-senior-medical-students-of-sultan-qaboos-university-sultanate-of-oman" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/110676.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">159</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18053</span> The Factor Affecting the Students’ Participation and Satisfaction in Activities of Student Affairs in Faculty of Management Science</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Natthiya%20Nuchanang">Natthiya Nuchanang</a>, <a href="https://publications.waset.org/abstracts/search?q=Pannarunsri%20Inpayung"> Pannarunsri Inpayung</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The study of participation in student affair activity, Faculty of Management Science of Suan Sunandha Rajabhat University, these objective were 1) to study of need and attention activity of SUT student 2) to study of participation and sufficient of student affair activity and advantage of student participation. The populations were 400 undergrad students year 1st-4th. The data were analyzed by descriptive statistics. The result found that; 1. The need of participate activity of students was medium level. Environment Conservation club and Badminton club were high level of experience for student. 2. The need and attention of activity were sufficient for student. Almost problems were not having enough time. 3. The advantages of activity were high level.4. The satisfaction of students for student affair unit was high level. Major problem that students do not attend, the tired from studying, Where the activity is not permitting, activities are not interesting and activity implementation overhead. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=faculty%20of%20management%20science" title="faculty of management science">faculty of management science</a>, <a href="https://publications.waset.org/abstracts/search?q=Suan%20Sunandha%20Rajabhat%20university" title=" Suan Sunandha Rajabhat university"> Suan Sunandha Rajabhat university</a>, <a href="https://publications.waset.org/abstracts/search?q=satisfaction%20in%20activities%20of%20student%20affairs" title=" satisfaction in activities of student affairs"> satisfaction in activities of student affairs</a>, <a href="https://publications.waset.org/abstracts/search?q=students%E2%80%99%20participation" title=" students’ participation"> students’ participation</a> </p> <a href="https://publications.waset.org/abstracts/44803/the-factor-affecting-the-students-participation-and-satisfaction-in-activities-of-student-affairs-in-faculty-of-management-science" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/44803.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">362</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18052</span> The Relation between Sports Practice and the Academic Performance</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Albert%20Perez-Bellmunt">Albert Perez-Bellmunt</a>, <a href="https://publications.waset.org/abstracts/search?q=Eila%20Rivera"> Eila Rivera</a>, <a href="https://publications.waset.org/abstracts/search?q=Aida%20Valls"> Aida Valls</a>, <a href="https://publications.waset.org/abstracts/search?q=Berta%20Estragues"> Berta Estragues</a>, <a href="https://publications.waset.org/abstracts/search?q=Sara%20Ortiz"> Sara Ortiz</a>, <a href="https://publications.waset.org/abstracts/search?q=Roberto%20Seijas"> Roberto Seijas</a>, <a href="https://publications.waset.org/abstracts/search?q=Pedro%20Alvarez"> Pedro Alvarez</a> </p> <p class="card-text"><strong>Abstract:</strong></p> INTRODUCTION: Physical and sports activity on a regular basis present numerous health benefits such as the prevention of cardiovascular and metabolic diseases. Also, there is a relation between sport and the psychological or the cognitive process of children and young people. The objective of the present study is to know if the sports practice has any positive influence on the university academic performance. MATERIALS AND METHODS: The level of the physical activity of 220 students of different degrees in health science was evaluated and compared with the academic results (grades). To assess the level of physical and sports activity, the Global Physical Activity Questionnaire (to calculate the sporting level in a general way) and the International Physical Activity Questionnaire (to estimate the physical activity carried out during the days leading up to the academic exams) were used. RESULTS: The students that realized an average level of sports activity the days before the exam obtained better grades than the rest of their classmate and the result was statistically significant. Controversially, if the sports level was analyzed in a general way, no relationship was observed between academic performance and the level of sport realized. CONCLUSION: A moderate physical activity, on the days leading up to an assessment, can be a positive factor for the university academic performance. Despite the fact that a regular sports activity improves many cognitive and physiological processes, the present study did not observe a direct relationship between sport/physical activity and academic performance. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=academic%20performance" title="academic performance">academic performance</a>, <a href="https://publications.waset.org/abstracts/search?q=academic%20results" title=" academic results"> academic results</a>, <a href="https://publications.waset.org/abstracts/search?q=global%20physical%20activity%20questionnaire" title=" global physical activity questionnaire"> global physical activity questionnaire</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity%20questionnaire" title=" physical activity questionnaire"> physical activity questionnaire</a>, <a href="https://publications.waset.org/abstracts/search?q=sport" title=" sport"> sport</a>, <a href="https://publications.waset.org/abstracts/search?q=sport%20practice" title=" sport practice"> sport practice</a> </p> <a href="https://publications.waset.org/abstracts/98072/the-relation-between-sports-practice-and-the-academic-performance" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/98072.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">195</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18051</span> A Systematic Review on Measuring the Physical Activity Level and Pattern in Persons with Chronic Fatigue Syndrome</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Kuni%20Vergauwen">Kuni Vergauwen</a>, <a href="https://publications.waset.org/abstracts/search?q=Ivan%20P.%20J.%20Huijnen"> Ivan P. J. Huijnen</a>, <a href="https://publications.waset.org/abstracts/search?q=Astrid%20Depuydt"> Astrid Depuydt</a>, <a href="https://publications.waset.org/abstracts/search?q=Jasmine%20Van%20Regenmortel"> Jasmine Van Regenmortel</a>, <a href="https://publications.waset.org/abstracts/search?q=Mira%20Meeus"> Mira Meeus</a> </p> <p class="card-text"><strong>Abstract:</strong></p> A lower activity level and imbalanced activity pattern are frequently observed in persons with chronic fatigue syndrome (CFS) / myalgic encephalomyelitis (ME) due to debilitating fatigue and post-exertional malaise (PEM). Identification of measurement instruments to evaluate the activity level and pattern is therefore important. The objective is to identify measurement instruments suited to evaluate the activity level and/or pattern in patients with CFS/ME and review their psychometric properties. A systematic literature search was performed in the electronic databases PubMed and Web of Science until 12 October 2016. Articles including relevant measurement instruments were identified and included for further analysis. The psychometric properties of relevant measurement instruments were extracted from the included articles and rated based on the COnsensus-based Standards for the selection of health Measurement INstruments (COSMIN) checklist. The review was performed and reported according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) statement. A total of 49 articles and 15 unique measurement instruments were found, but only three instruments were evaluated in patients with CFS/ME: the Chronic Fatigue Syndrome-Activity Questionnaire (CFS-AQ), Activity Pattern Interview (API) and International Physical Activity Questionnaire-Short Form (IPAQ-SF), three self-report instruments measuring the physical activity level. The IPAQ-SF, CFS-AQ and API are all equally capable of evaluating the physical activity level, but none of the three measurement instruments are optimal to use. No studies about the psychometric properties of activity monitors in patients with CFS/ME were found, although they are often used as the gold standard to measure the physical activity pattern. More research is needed to evaluate the psychometric properties of existing instruments, including the use of activity monitors. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=chronic%20fatigue%20syndrome" title="chronic fatigue syndrome">chronic fatigue syndrome</a>, <a href="https://publications.waset.org/abstracts/search?q=data%20collection" title=" data collection"> data collection</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=psychometrics" title=" psychometrics"> psychometrics</a> </p> <a href="https://publications.waset.org/abstracts/57390/a-systematic-review-on-measuring-the-physical-activity-level-and-pattern-in-persons-with-chronic-fatigue-syndrome" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/57390.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">231</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18050</span> Student and Group Activity Level Assessment in the ELARS Recommender System</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Martina%20Holenko%20Dlab">Martina Holenko Dlab</a>, <a href="https://publications.waset.org/abstracts/search?q=Natasa%20Hoic-Bozic"> Natasa Hoic-Bozic</a> </p> <p class="card-text"><strong>Abstract:</strong></p> This paper presents an original approach to student and group activity level assessment that relies on certainty factors theory. Activity level is used to represent quantity and continuity of student&rsquo;s contributions in individual and collaborative e‑learning activities (e‑tivities) and is calculated to assist teachers in assessing quantitative aspects of student&#39;s achievements. Calculated activity levels are also used to raise awareness and provide recommendations during the learning process. The proposed approach was implemented within the educational recommender system ELARS and validated using data obtained from e‑tivity realized during a blended learning course. The results showed that the proposed approach can be used to estimate activity level in the context of e-tivities realized using Web 2.0 tools as well as to facilitate the assessment of quantitative aspect of students&rsquo; participation in e‑tivities. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=assessment" title="assessment">assessment</a>, <a href="https://publications.waset.org/abstracts/search?q=ELARS" title=" ELARS"> ELARS</a>, <a href="https://publications.waset.org/abstracts/search?q=e-learning" title=" e-learning"> e-learning</a>, <a href="https://publications.waset.org/abstracts/search?q=recommender%20systems" title=" recommender systems"> recommender systems</a>, <a href="https://publications.waset.org/abstracts/search?q=student%20model" title=" student model"> student model</a> </p> <a href="https://publications.waset.org/abstracts/64885/student-and-group-activity-level-assessment-in-the-elars-recommender-system" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/64885.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">273</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18049</span> The Investigation of Correlation between Body Composition and Physical Activity in University Students</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ferruh%20Taspinar">Ferruh Taspinar</a>, <a href="https://publications.waset.org/abstracts/search?q=Gulce%20K.%20Seyyar"> Gulce K. Seyyar</a>, <a href="https://publications.waset.org/abstracts/search?q=Gamze%20Kurt"> Gamze Kurt</a>, <a href="https://publications.waset.org/abstracts/search?q=Eda%20O.%20Okur"> Eda O. Okur</a>, <a href="https://publications.waset.org/abstracts/search?q=Emrah%20Afsar"> Emrah Afsar</a>, <a href="https://publications.waset.org/abstracts/search?q=Ismail%20Saracoglu"> Ismail Saracoglu</a>, <a href="https://publications.waset.org/abstracts/search?q=Betul%20Taspinar"> Betul Taspinar</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Alterations of physical activity can effect body composition (especially body fat ratio); however body mass index may not sufficient to indicate these minimal differences. The aim of this study was to evaluate the relationship between body composition and physical activity in university students. In this study, 132 university students (mean age; 21.21±1.51) were included. Tanita BC-418 and International Physical Activity Questionnaire (IPAQ) were used to evaluate participants. The correlation between the parameters was analysed via Spearman correlation analysis. Significance level in statistical analyses was accepted is 0.05. The results showed that there was no correlation between body mass index and physical activity (p>0.05). There was a positive correlation between body muscle ratio and physical activity, whereas a negative correlation between body fat ratio and physical activity (p<0.05). This study showed that body fat and muscle ratio affects the level of physical activity in healthy university students. Therefore, we thought that physical activity might reduce effects of the diseases caused by disturbed body composition. Further studies are required to support this idea. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=body%20composition" title="body composition">body composition</a>, <a href="https://publications.waset.org/abstracts/search?q=body%20mass%20index" title=" body mass index"> body mass index</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=university%20student" title=" university student"> university student</a> </p> <a href="https://publications.waset.org/abstracts/60659/the-investigation-of-correlation-between-body-composition-and-physical-activity-in-university-students" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/60659.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">363</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18048</span> To Assess Variables Related to Self-Efficacy for Increasing Physical Activity in Advanced-Stage Cancer Patients</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=S.%20Nikpour">S. Nikpour</a>, <a href="https://publications.waset.org/abstracts/search?q=S.%20Vahidi"> S. Vahidi</a>, <a href="https://publications.waset.org/abstracts/search?q=H.%20Haghani"> H. Haghani</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Introduction: Exercise has mental and physical health benefits for patients with advanced stage cancer who actively receive chemotherapy, yet little is known about patients’ levels of interest in becoming more active or their confidence in increasing their activity level. Methods and materials: A convenience sample of 200 patients with advanced-stage cancer who were receiving chemotherapy completed self-report measures assessing physical activity level, mood, and quality-of-life variables. Qualitative data on patient-perceived benefits of, and barriers to, physical activity also were collected, coded by independent raters, and organized by predominant themes. Results: Current physical activity level, physical activity outcome expectations, and positive mood were significantly associated with self-efficacy. Fatigue was the most frequently listed barrier to physical activity; improved physical strength and health were the most commonly listed benefits. Participants identified benefits related to both general health and cancer-symptom management that were related to exercise. 59.5% of participants reported that they were seriously planning to increase or maintain their physical activity level, and over 40% reported having interest in receiving an intervention to become more active. Conclusion: These results suggested that many advanced-stage cancer patients who receive chemotherapy are interested in maintaining or increasing their physical activity level and in receiving professional support for exercise. In addition, these individuals identified general health and cancer-specific benefits of, and barriers to, physical activity. Future research will investigate how these findings may be incorporated into physical activity interventions for advanced-stage oncology patients receiving medical treatment. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title="physical activity">physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=cancer" title=" cancer"> cancer</a>, <a href="https://publications.waset.org/abstracts/search?q=self-efficacy" title=" self-efficacy"> self-efficacy</a> </p> <a href="https://publications.waset.org/abstracts/6916/to-assess-variables-related-to-self-efficacy-for-increasing-physical-activity-in-advanced-stage-cancer-patients" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/6916.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">538</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18047</span> Analyzing the Association between Physical Activity and Sleep Quality in College Students: Cross-Sectional Study</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Fildzah%20Badzlina">Fildzah Badzlina</a>, <a href="https://publications.waset.org/abstracts/search?q=Mega%20Puspa%20Sari"> Mega Puspa Sari</a> </p> <p class="card-text"><strong>Abstract:</strong></p> To rest the body after a full day of activities, the body needs sleep. During sleep, the body's response to external stimuli will be reduced and relatively inactive so that it is used to optimize the body's biological functions that cannot be done when awake. College students often experience poor sleep quality because of the dense activities carried out during the day. In addition, the level of physical activity of college students is also relatively low. Based on previous research, college students who have low physical activity have poor sleep quality. Therefore, the purpose of this study was to determine the relationship between physical activity and sleep quality in college students of the University of Muhammadiyah Prof. Dr. Hamka. This study used a cross-sectional research design with 107 respondents as research subjects. Samples were taken using the purposive sampling technique. The data was taken using a google form which was distributed to all college students in September 2021. The statistical test used was Chi-square. The results of this study showed that 85 (79.4%) college students experienced poor sleep quality during the Covid-19 Pandemic Period. Most respondents were 96 women (89.7%) and 32.7% (35 people) aged 20 years. In the pocket money category, most college students (71%) got pocket money less than 500.000 rupiahs per month. A total of 52 respondents (48.6%) had a moderate level of physical activity category. Poor sleep quality was more common in male students (90.9%) compared to female students (78.1%) (p>0.05). In the group with poor sleep quality, 88.9% of students were categorized in Rp. 500.001 to Rp. 1.000.000 for pocket money, 80.3% of students included in the category Rp. 500.000 or less, and 61.5% of students are included in the category of Rp. 1.000.000 or more. Poor sleep quality was more common among students in the age category 20 years (84.1%), compared to students in the age category > 20 years (71.1%). For the level of physical activity in the poor sleep quality group, 87% were included in the category of heavy physical activity, 82.7% included in the moderate level of physical activity, and 68.8% included in the category of low-level physical activity. There was no significant relationship between gender, pocket money, age, and physical activity with sleep quality (p>0.05). <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=college%20students" title="college students">college students</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=sleep%20quality" title=" sleep quality"> sleep quality</a>, <a href="https://publications.waset.org/abstracts/search?q=university%20students" title=" university students"> university students</a> </p> <a href="https://publications.waset.org/abstracts/144468/analyzing-the-association-between-physical-activity-and-sleep-quality-in-college-students-cross-sectional-study" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/144468.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">145</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18046</span> The Formation of Motivational Sphere for Learning Activity under Conditions of Change of One of Its Leading Components</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=M.%20Rodionov">M. Rodionov</a>, <a href="https://publications.waset.org/abstracts/search?q=Z.%20Dedovets"> Z. Dedovets </a> </p> <p class="card-text"><strong>Abstract:</strong></p> This article discusses ways to implement a differentiated approach to developing academic motivation for mathematical studies which relies on defining the primary structural characteristics of motivation. The following characteristics are considered: features of realization of cognitive activity, meaning-making characteristics, level of generalization and consistency of knowledge acquired by personal experience. The assessment of the present level of individual student understanding of each component of academic motivation is the basis for defining the relevant educational strategy for its further development. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=learning%20activity" title="learning activity">learning activity</a>, <a href="https://publications.waset.org/abstracts/search?q=mathematics" title=" mathematics"> mathematics</a>, <a href="https://publications.waset.org/abstracts/search?q=motivation" title=" motivation"> motivation</a>, <a href="https://publications.waset.org/abstracts/search?q=student" title=" student"> student</a> </p> <a href="https://publications.waset.org/abstracts/24907/the-formation-of-motivational-sphere-for-learning-activity-under-conditions-of-change-of-one-of-its-leading-components" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/24907.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">422</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18045</span> A Study on the Influence of Aswan High Dam Reservoir Loading on Earthquake Activity </h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Sayed%20Abdallah%20Mohamed%20Dahy">Sayed Abdallah Mohamed Dahy</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Aswan High Dam Reservoir extends for 500 km along the Nile River; it is a vast reservoir in southern Egypt and northern Sudan. It was created as a result of the construction of the Aswan High Dam between 1958 and 1970; about 95% of the main water resources for Egypt are from it. The purpose of this study is to discuss and understand the effect of the fluctuation of the water level in the reservoir on natural and human-induced environmental like earthquakes in the Aswan area, Egypt. In summary, the correlation between the temporal variations of earthquake activity and water level changes in the Aswan reservoir from 1982 to 2014 are investigated and analyzed. This analysis confirms a weak relation between the fluctuation of the water level and earthquake activity in the area around Aswan reservoir. The result suggests that the seismicity in the area becomes active during a period when the water level is decreasing from the maximum to the minimum. Behavior of the water level in this reservoir characterized by a special manner that is the unloading season extends to July or August, and the loading season starts to reach its maximum in October or November every year. Finally, daily rate of change in the water level did not show any direct relation with the size of the earthquakes, hence, it is not possible to be used as a single tool for prediction. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Aswan%20high%20dam%20reservoir" title="Aswan high dam reservoir">Aswan high dam reservoir</a>, <a href="https://publications.waset.org/abstracts/search?q=earthquake%20activity" title=" earthquake activity"> earthquake activity</a>, <a href="https://publications.waset.org/abstracts/search?q=environmental" title=" environmental"> environmental</a>, <a href="https://publications.waset.org/abstracts/search?q=Egypt" title=" Egypt"> Egypt</a> </p> <a href="https://publications.waset.org/abstracts/35385/a-study-on-the-influence-of-aswan-high-dam-reservoir-loading-on-earthquake-activity" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/35385.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">385</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18044</span> A Longitudinal Study on the Relationship between Physical Activity and Gestational Weight Gain</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Chia-Ching%20Sun">Chia-Ching Sun</a>, <a href="https://publications.waset.org/abstracts/search?q=Li-Yin%20Chien"> Li-Yin Chien</a>, <a href="https://publications.waset.org/abstracts/search?q=Chun-Ting%20Hsiao"> Chun-Ting Hsiao</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Background: Appropriate gestation weight gain benefits pregnant women and their children; however, excessive weight gain could raise the risk of adverse health outcomes and chronicle diseases. Nevertheless, there is currently limited evidence on the effect of physical activities on pregnant women’s gestational weight gain. Purpose: This study aimed to explore the correlation between the level of physical activity and gestation weight gain during the second and third trimester of pregnancy. Methods: This longitudinal study enrolled 800 healthy pregnant women aged over 20 from six hospitals in northern Taiwan. Structured questionnaires were used to collect data twice for each participant during 14-27 and 28-40 weeks of gestation. Variables included demographic data, maternal health history, and lifestyle. The International Physical Activity Questionnaire-short form was used to measure the level of physical activity from walking and of moderate-intensity and vigorous-intensity before and during pregnancy. Weight recorded at prenatal checkups were used to calculate average weight gain in each trimester of pregnancy. T-tests, ANOVA, chi-squared tests, and multivariable logistic regression models were applied to determine the predicting factors for weight gain during the second and third trimester. Result: Participants who had achieved recommended physical activity level (150 minutes of moderate physical activity or 75 minutes of vigorous physical activity a week) before pregnancy (aOR=1.85, 95% CI=1.27-2.67) or who achieved recommended walking level (150 minutes a week) during the second trimester of pregnancy (aOR=1.43, 95% CI= 1.00-2.04) gained significantly more weight during the second trimester. Compared with those who did not reach recommended level of moderate-intensity physical activity (150 minutes a week), women who had reached that during the second trimester were more likely to be in the less than recommended weight gain group than in the recommended weight gain group (aOR=2.06, CI=1.06-4.00). However, there was no significant correlation between physical activity level and weight gain in the third trimester. Other predicting factors of excessive weight gain included education level which showed a negative correlation (aOR=0.38, CI=0.17-0.88), whereas overweight and obesity before pregnancy showed a positive correlation (OR=3.97, CI=1.23-12.78). Conclusions/implications for practice: Participants who had achieved recommended physical activity level before pregnancy significantly reduced exercise during pregnancy and gained excessive weight during the second trimester. However, women who engaged in the practice of physical activity as recommended could effectively control weight gain in the third trimester. Healthcare professionals could suggest that pregnant women who exercise maintain their pre-pregnancy level of physical activity, given activities requiring physical contact or causing falls are avoided. For those who do not exercise, health professionals should encourage them to gradually increase the level of physical activity. Health promotion strategies related to weight control and physical activity level achievement should be given to women before pregnancy. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=pregnant%20woman" title="pregnant woman">pregnant woman</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=gestation%20weight%20gain" title=" gestation weight gain"> gestation weight gain</a>, <a href="https://publications.waset.org/abstracts/search?q=obesity" title=" obesity"> obesity</a>, <a href="https://publications.waset.org/abstracts/search?q=overweight" title=" overweight"> overweight</a> </p> <a href="https://publications.waset.org/abstracts/86201/a-longitudinal-study-on-the-relationship-between-physical-activity-and-gestational-weight-gain" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/86201.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">160</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18043</span> Software Evolution Based Activity Diagrams</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Zine-Eddine%20Bouras">Zine-Eddine Bouras</a>, <a href="https://publications.waset.org/abstracts/search?q=Abdelouaheb%20Talai"> Abdelouaheb Talai</a> </p> <p class="card-text"><strong>Abstract:</strong></p> During the last two decades, the software evolution community has intensively tackled the software merging issue whose main objective is to merge in a consistent way different versions of software in order to obtain a new version. Well-established approaches, mainly based on the dependence analysis techniques, have been used to bring suitable solutions. These approaches concern the source code or software architectures. However, these solutions are more expensive due to the complexity and size. In this paper, we overcome this problem by operating at a high level of abstraction. The objective of this paper is to investigate the software merging at the level of UML activity diagrams, which is a new interesting issue. Its purpose is to merge activity diagrams instead of source code. The proposed approach, based on dependence analysis techniques, is illustrated through an appropriate case study. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=activity%20diagram" title="activity diagram">activity diagram</a>, <a href="https://publications.waset.org/abstracts/search?q=activity%20diagram%20slicing" title=" activity diagram slicing"> activity diagram slicing</a>, <a href="https://publications.waset.org/abstracts/search?q=dependency%20analysis" title=" dependency analysis"> dependency analysis</a>, <a href="https://publications.waset.org/abstracts/search?q=software%20merging" title=" software merging"> software merging</a> </p> <a href="https://publications.waset.org/abstracts/42420/software-evolution-based-activity-diagrams" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/42420.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">334</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18042</span> The Influence of Physical Activity and Health Literacy on Depression Level of First and Second Turkish Generation Living in Germany</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ceren%20Aky%C3%BCz">Ceren Akyüz</a>, <a href="https://publications.waset.org/abstracts/search?q=Ingo%20Froboese"> Ingo Froboese</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Health literacy has gained importance with the further spread of the coronavirus disease (COVID-19) worldwide and has been associated with health status in various chronic diseases. Many studies indicate that mental health can be improved by low- or moderate-intensity activity, and several studies have been proposed to explain the relationship between physical activity and mental health. The aim of the present study is to investigate the levels of physical activity, health literacy, and depression in first- and- second generation Turkish people in Germany. The research consists of 434 participants (255 females, 179 males; age 38.09 ± 13.73). 40.8 % of participants are married, and 59.2 % of participants are single. Education levels are mostly at university level (54.8 %), and graduate level is 18.9 %. While 24.9 % of the participants are second generation, 75.1 % of participants are first generation. All analyses were stratified on gender, marital status, education, generation and income status, and five age categories: 18–30, 31–40, 41–50, 51–60, and 61–79, which were defined to account for age-specific trends while maintaining sufficient cell size for statistical analysis. A correlation of depression with physical activity and health literacy levels between first- and- second generation Turks in Germany was evaluated in order to find out whether there are significant differences between the two populations and demographic variables (gender, marital status, education, generation, income status) with carrying out questionnaires which are European Health Literacy Survey Questionnaire (HLS-EU-Q47), International Physical Activity Questionnaire ( IPAQ) and the Patient Health Questionnaire-9 (PHQ-9). <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=health%20literacy" title="health literacy">health literacy</a>, <a href="https://publications.waset.org/abstracts/search?q=turks%20in%20germany" title=" turks in germany"> turks in germany</a>, <a href="https://publications.waset.org/abstracts/search?q=migrants" title=" migrants"> migrants</a>, <a href="https://publications.waset.org/abstracts/search?q=depression" title=" depression"> depression</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a> </p> <a href="https://publications.waset.org/abstracts/162858/the-influence-of-physical-activity-and-health-literacy-on-depression-level-of-first-and-second-turkish-generation-living-in-germany" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/162858.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">87</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18041</span> Environmental Radiation Level in Soil from Some Selected Mining Sites in Minna Environs, Niger State, Nigeria</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Abdullahi%20Muhammad">Abdullahi Muhammad</a> </p> <p class="card-text"><strong>Abstract:</strong></p> In this research work, the activity concentrations of the well-known naturally occurring radionuclide materials 40K, 226Ra and 232Th were determine in soil samples obtained from three mining regions of Niger State, Nigeria. A total of 24 soil samples were analysed using NaI(TI) detector to determine the activity concentrations of sample. The range of activity concentration found in this study for the soil samples ranges from 256 to 447 Bq kg-1, 12.2 to 27.56 Bq kg-1 and 3.50 to 11.90 Bq kg-1 for 40K, 226Ra and 232Th, respectively. The perspective of safety and considering the low level of radiation hazard index compared to the world averages and recommended safety limits, these samples can be considered safe for use in building and construction without causing radiological risk to the people residing in these areas. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=activity%20concentrations" title="activity concentrations">activity concentrations</a>, <a href="https://publications.waset.org/abstracts/search?q=40K" title=" 40K"> 40K</a>, <a href="https://publications.waset.org/abstracts/search?q=226Ra%20and%20232Th" title=" 226Ra and 232Th"> 226Ra and 232Th</a>, <a href="https://publications.waset.org/abstracts/search?q=radiation%20hazard" title=" radiation hazard"> radiation hazard</a> </p> <a href="https://publications.waset.org/abstracts/196236/environmental-radiation-level-in-soil-from-some-selected-mining-sites-in-minna-environs-niger-state-nigeria" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/196236.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">16</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18040</span> Physical Activity Self-Efficacy among Pregnant Women with High Risk for Gestational Diabetes Mellitus: A Cross-Sectional Study</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Xiao%20Yang">Xiao Yang</a>, <a href="https://publications.waset.org/abstracts/search?q=Ji%20Zhang"> Ji Zhang</a>, <a href="https://publications.waset.org/abstracts/search?q=Yingli%20Song"> Yingli Song</a>, <a href="https://publications.waset.org/abstracts/search?q=Hui%20Huang"> Hui Huang</a>, <a href="https://publications.waset.org/abstracts/search?q=Jing%20Zhang"> Jing Zhang</a>, <a href="https://publications.waset.org/abstracts/search?q=Yan%20Wang"> Yan Wang</a>, <a href="https://publications.waset.org/abstracts/search?q=Rongrong%20Han"> Rongrong Han</a>, <a href="https://publications.waset.org/abstracts/search?q=Zhixuan%20Xiang"> Zhixuan Xiang</a>, <a href="https://publications.waset.org/abstracts/search?q=Lu%20Chen"> Lu Chen</a>, <a href="https://publications.waset.org/abstracts/search?q=Lingling%20Gao"> Lingling Gao</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Aim and Objectives: To examine physical activity self-efficacy, identify its predictors, and further explore the mechanism of action among the predictors in mainland Chinese pregnant women with high risk for gestational diabetes mellitus (GDM). Background: Physical activity could protect pregnant women from developing GDM. Physical activity self-efficacy was the key predictor of physical activity. Design: A cross-sectional study was conducted from October 2021 to May 2022 in Zhengzhou, China. Methods: 252 eligible pregnant women completed the Pregnancy Physical Activity Self-efficacy Scale, the Social Support for Physical Activity Scale, the Knowledge on Physical Activity Questionnaire, the 7-item Generalized Anxiety Disorder scale, the Edinburgh Postnatal Depression Scale, and a socio-demographic data sheet. Multiple linear regression was applied to explore the predictors of physical activity self-efficacy. Structural equation modeling was used to explore the mechanism of action among the predictors. Results: Chinese pregnant women with a high risk for GDM reported a moderate level of physical activity self-efficacy. The best-fit regression analysis revealed four variables explained 17.5% of the variance in physical activity self-efficacy. Social support for physical activity was the strongest predictor, followed by knowledge of the physical activity, intention to do physical activity, and anxiety symptoms. The model analysis indicated that knowledge of physical activity could release anxiety and depressive symptoms and then increase physical activity self-efficacy. Conclusion: The present study revealed a moderate level of physical activity self-efficacy. Interventions targeting pregnant women with high risk for GDM need to include the predictors of physical activity self-efficacy. Relevance to clinical practice: To facilitate pregnant women with high risk for GDM to engage in physical activity, healthcare professionals may find assess physical activity self-efficacy and intervene as soon as possible on their first antenatal visit. Physical activity intervention programs focused on self-efficacy may be conducted in further research. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title="physical activity">physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=gestational%20diabetes" title=" gestational diabetes"> gestational diabetes</a>, <a href="https://publications.waset.org/abstracts/search?q=self-efficacy" title=" self-efficacy"> self-efficacy</a>, <a href="https://publications.waset.org/abstracts/search?q=predictors" title=" predictors"> predictors</a> </p> <a href="https://publications.waset.org/abstracts/163023/physical-activity-self-efficacy-among-pregnant-women-with-high-risk-for-gestational-diabetes-mellitus-a-cross-sectional-study" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/163023.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">112</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18039</span> The Mission Slimpossible Program: Dietary and Physical Activity Intervention to Combat Obesity among University Students in UITM Puncak Alam</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Kartini%20Ilias">Kartini Ilias</a>, <a href="https://publications.waset.org/abstracts/search?q=Nabilah%20Md%20Ahir"> Nabilah Md Ahir</a>, <a href="https://publications.waset.org/abstracts/search?q=Nor%20Zafirah%20Ab%20Rahman"> Nor Zafirah Ab Rahman</a>, <a href="https://publications.waset.org/abstracts/search?q=Safiah%20Md%20Yusof"> Safiah Md Yusof</a>, <a href="https://publications.waset.org/abstracts/search?q=Nuri%20Naqieyah%20Radzuan"> Nuri Naqieyah Radzuan</a>, <a href="https://publications.waset.org/abstracts/search?q=Siti%20Sabariah%20Buhari"> Siti Sabariah Buhari</a> </p> <p class="card-text"><strong>Abstract:</strong></p> This study aim to develop and assess the effectiveness of an intervention in improving eating habits and physical activity level of university students of UiTM Puncak Alam. The intervention consists of weekly dietary counselling by registered dietitian and high-intensity interval training (HIIT) for three times per week for the duration of 8 weeks. A total of 25 students from the intervention group and 25 students from control group who had BMI equal to or greater than 25kg/m² participated in the study. The results showed a significant reduction in body weight (3.0 kg), body fat percentage (7.9 %), waist circumference (7.3 cm) and BMI (2.9 kg/m²) between pre and post intervention. Besides, there was a significant increase in the level of physical activity among subjects in intervention group. In conclusion, the intervention made an impact on eating habit, physical activity level and improves weight status of the students. It is expected that the intervention could be adopted and implemented by the government and private sector as well as policy-makers in formulating obesity intervention. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=obesity" title="obesity">obesity</a>, <a href="https://publications.waset.org/abstracts/search?q=diet" title=" diet"> diet</a>, <a href="https://publications.waset.org/abstracts/search?q=obesity%20intervention" title=" obesity intervention"> obesity intervention</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a> </p> <a href="https://publications.waset.org/abstracts/71732/the-mission-slimpossible-program-dietary-and-physical-activity-intervention-to-combat-obesity-among-university-students-in-uitm-puncak-alam" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/71732.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">384</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18038</span> Effects of Occupational Therapy on Children with Unilateral Cerebral Palsy</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Sedef%20%C5%9Eahin">Sedef Şahin</a>, <a href="https://publications.waset.org/abstracts/search?q=Meral%20Huri"> Meral Huri</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Cerebral Palsy (CP) represents the most frequent cause of physical disability in children with a rate of 2,9 per 1000 live births. The activity-focused intervention is known to improve function and reduce activity limitations and barriers to participation of children with disabilities. The aim of the study was to assess the effects of occupational therapy on level of fatigue, activity performance and satisfaction in children with Unilateral Cerebral Palsy. Twenty-two children with hemiparetic cerebral palsy (mean age: 9,3 ± 2.1years; Gross Motor Function Classification System ( GMFCS) level from I to V (I = 54%, II = 23%, III = 14%, IV= 9%, V= 0%), Manual Ability Classification System (MACS) level from I to V (I = 40%, II = 32%, III = 14%, IV= 10%, V= 4%), were assigned to occupational therapy program for 6 weeks.Visual Analogue Scale (VAS) was used for intensity of the fatigue they experienced at the time on a 10 point Likert scale (1-10).Activity performance and satisfaction were measured with Canadian Occupational Performance Measure (COPM).A client-centered occupational therapy intervention was designed according to results of COPM. The results were compared with nonparametric Wilcoxon test before and after the intervention. Thirteen of the children were right-handed, whereas nine of the children were left handed.Six weeks of intervention showed statistically significant differences in level of fatigue, compared to first assessment(p<0,05). The mean score of first and the second activity performance scores were 4.51 ± 1.70 and 7.35 ± 2.51 respectively. Statistically significant difference between performance scores were found (p<0.01). The mean scores of first and second activity satisfaction scores were of 2.30± 1.05 and 5.51 ± 2.26 respectively. Statistically significant difference between satisfaction assessments were found (p<0.01). Occupational therapy is an evidence-based approach and occupational therapy interventions implemented by therapists were clinically effective on severity of fatigue, activity performance and satisfaction if implemented individually during 6 weeks. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=activity%20performance" title="activity performance">activity performance</a>, <a href="https://publications.waset.org/abstracts/search?q=cerebral%20palsy" title=" cerebral palsy"> cerebral palsy</a>, <a href="https://publications.waset.org/abstracts/search?q=fatigue" title=" fatigue"> fatigue</a>, <a href="https://publications.waset.org/abstracts/search?q=occupational%20therapy" title=" occupational therapy"> occupational therapy</a> </p> <a href="https://publications.waset.org/abstracts/77014/effects-of-occupational-therapy-on-children-with-unilateral-cerebral-palsy" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/77014.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">241</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18037</span> Innovative Activity and Firm Performance: The Case of Eurozone Periphery</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ilias%20A.%20Makris">Ilias A. Makris</a> </p> <p class="card-text"><strong>Abstract:</strong></p> In this work, we attempt to analyse the contribution of innovative activities to firm performance and growth. We examine economic data from some of the economies that were heavily affected by current economic crisis: the countries of southern Europe (Portugal, Italy, Greece, and Spain) and Ireland. Following literature, an appropriate econometric model is developed and several indicators are tested in order to disclose possible relation with innovative activity. Findings confirm the crucial effect of innovative process in economic activity, in firm and country level. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Eurozone%20periphery" title="Eurozone periphery">Eurozone periphery</a>, <a href="https://publications.waset.org/abstracts/search?q=firm%20performance" title=" firm performance"> firm performance</a>, <a href="https://publications.waset.org/abstracts/search?q=innovative%20activity" title=" innovative activity"> innovative activity</a>, <a href="https://publications.waset.org/abstracts/search?q=R%26D" title=" R&amp;D"> R&amp;D</a> </p> <a href="https://publications.waset.org/abstracts/17640/innovative-activity-and-firm-performance-the-case-of-eurozone-periphery" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/17640.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">506</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18036</span> Prevalence of Physical Activity Levels and Perceived Benefits of and Barriers to Physical Activity among Jordanian Patients with Coronary Heart Disease: A Cross-Sectional Study</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Eman%20Ahmed%20Alsaleh">Eman Ahmed Alsaleh</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Background: Many studies published in other countries identified certain perceived benefits and barriers to physical activity among patients with coronary heart disease. Nevertheless, there is no data about the issue relating to Jordanian patients with coronary heart disease. Objective: This study aimed to describe the prevalence of level of physical activity, benefits of and barriers to physical activity as perceived by Jordanian patients with coronary heart disease, and the relationship between physical activity and perceived benefits of and barriers to physical activity. In addition, it focused on examining the influence of selected sociodemographic and health characteristics on physical activity and the perceived benefits of and barriers to physical activity. Methods: A cross-sectional design was performed on a sample of 400 patients with coronary heart disease. They were given a list of perceived benefits and barriers to physical activity and asked to what extent they disagreed or agreed with each. Results: Jordanian patients with coronary heart disease perceived various benefits and barriers to physical activity. Most of these benefits were physiologically related (average mean = 5.7, SD = .7). The most substantial barriers to physical activity as perceived by the patients were: feeling anxiety, not having enough time, lack of interest, bad weather, and feeling of being uncomfortable. Sociodemographic and health characteristics that significantly influenced perceived barriers to physical activity were age, gender, health perception, chest pain frequency, education, job, caring responsibilities, ability to travel alone, smoking, and previous and current physical activity behaviour. Conclusion: This research demonstrates that patients with coronary heart disease have perceived physiological benefits of physical activity, and they have perceived motivational, physical health, and environmental barriers to physical activity, which is significant in developing intervention strategies that aim to maximize patients' participation in physical activity and overcome barriers to physical activity. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=prevalence" title="prevalence">prevalence</a>, <a href="https://publications.waset.org/abstracts/search?q=coronary%20heart%20disease" title=" coronary heart disease"> coronary heart disease</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=perceived%20barriers" title=" perceived barriers"> perceived barriers</a> </p> <a href="https://publications.waset.org/abstracts/158570/prevalence-of-physical-activity-levels-and-perceived-benefits-of-and-barriers-to-physical-activity-among-jordanian-patients-with-coronary-heart-disease-a-cross-sectional-study" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/158570.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">121</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18035</span> An Exploration of the Association Between the Physical Activity and Academic Performance in Internship Medical Students</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ali%20Ashraf">Ali Ashraf</a>, <a href="https://publications.waset.org/abstracts/search?q=Ghazaleh%20Aghaee"> Ghazaleh Aghaee</a>, <a href="https://publications.waset.org/abstracts/search?q=Sedigheh%20Samimian"> Sedigheh Samimian</a>, <a href="https://publications.waset.org/abstracts/search?q=Mohaya%20Farzin"> Mohaya Farzin</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Objectives: Previous studies have indicated the positive effect of physical activity and sports on different aspects of health, such as muscle endurance and sleep cycle. However, in university students, particularly medical students, who have limited time and a stressful lifestyle, there have been limited studies exploring this matter with proven statistical results. In this regard, this study aims to find out how regular physical activity can influence the academic performance of medical students during their internship period. Methods: This was a descriptive-analytical study. Overall, 160 medical students (including 80 women and 88 men) voluntarily participated in the study. The Baecke Physical Activity Questionnaire was applied to determine the student’s physical activity levels. The student's academic performance was determined based on their total average academic scores. The data were analyzed in SPSS version 16 software using the independent t-test, Pearson correlation, and linear regression. Results: The average age of the students was 26.0±1.5 years. Eighty-eight students (52.4%) were male, and 142 (84.5%) were single. The student's mean total average academic score was 16.2±1.2, and their average physical activity score was 8.3±1.1. The student's average academic score was not associated with their gender (P=0.427), marital status (P=0.645), and age (P=0.320). However, married students had a significantly lower physical activity level compared to single students (P=0.020). The results indicated a significant positive correlation between student's physical activity levels and average academic scores (r=+0.410 and P<0.001). This correlation was independent of the student’s age, gender, and marital status based on the regression analysis. Conclusion: The results of the current study suggested that the physical activity level in medical students was low to moderate in most cases, and there was a significant direct relationship between student’s physical activity level and academic performance, independent of age, gender, and marital status. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=exercise" title="exercise">exercise</a>, <a href="https://publications.waset.org/abstracts/search?q=education" title=" education"> education</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=academic%20performance" title=" academic performance"> academic performance</a> </p> <a href="https://publications.waset.org/abstracts/185959/an-exploration-of-the-association-between-the-physical-activity-and-academic-performance-in-internship-medical-students" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/185959.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">54</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18034</span> Variation in Carboxylesterase Activity in Spodoptera litura Fabricious (Noctuidae: Lepidoptera) Populations from India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=V.%20Karuppaiah">V. Karuppaiah</a>, <a href="https://publications.waset.org/abstracts/search?q=J.%20C.%20Padaria"> J. C. Padaria</a>, <a href="https://publications.waset.org/abstracts/search?q=C.%20Srivastava"> C. Srivastava</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura Fab (Lepidoptera: Noctuidae) is a polyphagous pest various field and horticulture crops in India. Pest had virtually developed resistance to all commonly used insecticides. Enhanced detoxification is the prime mechanism that is dictated by detoxification different enzymes and carboxylesterase is one of the major enzyme responsible development of resistance. In India, insecticide resistance studies on S. litura are mainly deployed on detoxification enzymes activity and investigation at gene level alteration i.e. at nucleotide level is very merger. In the present study, we collected the S. litura larvae from three different cauliflower growing belt viz., IARI, New Delhi (Delhi), Palari, Sonepat (Haryana) and Varanasi (Uttar Pradesh) to study the role of carboxylesterase activity and its gene level variation The CarE activity was measured using UV-VIS spectrophotometer with 3rd instar larvae of S. litura. The elevated activity of CarE was observed in Sonepat strain (28.09 ± 0.09 µmol/min/mg of protein) followed by Delhi (26.72 ± 0.04 µmol/min/mg of protein) and Varanasi strain (10.00 ± 0.44 µmol/min/mg of protein) of S. litura. The genomic DNA was isolated from 3rd instar larvae and CarE gene was amplified using a primer sequence, F:5’tccagagttccttgtcaggcac3’; R:5’ctgcatcaagcatgtctc3. CarE gene, about 500bp was partially amplified, sequenced and submitted to NCBI (Accession No. KF835886, KF835887 and KF835888). The sequence data revealed polymorphism at nucleotide level in all the three strains and gene found to have 88 to 97% similarity with previous available nucleotide sequences of S. litura, S. littoralis and S. exiqua. The polymorphism at the nucleotide level could be a reason for differential activity of carboxylesterase enzymes among the strains. However, investigation at gene expression level would be useful to analyze the overproduction of carboxylesterase enzyme. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=carboxylesterase" title="carboxylesterase">carboxylesterase</a>, <a href="https://publications.waset.org/abstracts/search?q=CarE%20gene" title=" CarE gene"> CarE gene</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide%20polymorphism" title=" nucleotide polymorphism"> nucleotide polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a> </p> <a href="https://publications.waset.org/abstracts/13619/variation-in-carboxylesterase-activity-in-spodoptera-litura-fabricious-noctuidae-lepidoptera-populations-from-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/13619.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">931</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18033</span> Comparison between Mental Toughness and Level of Physical Activity between Staff and Students in University of Tabriz</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Mahta%20Eskandarnejad">Mahta Eskandarnejad</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The aim of this paper was to compare physical activity and mental toughness in the staff and students of the University of Tabriz. 615 people participated in this study and filled demographic questionnaire, mental thoughness48 (MTQ48) questionnaire and habitual physical activity questionnaire (Baecke physical activity questionnaire). The research sample included 355 students and 260 staff (615 questionnaires). For analyzing hypotheses MANOVA, correlation and independent t-test were used. Based on the result; some subscales of mental toughness and physical activity were significantly related. The result showed the significant correlation between mental toughness and physical activity in student and no significant correlation in staff. Students were significantly physically more active than staff, and mental toughness was higher in staff. There was no difference in mental toughness variable between active participants (active staff and student). The results of this study showed that mental toughness could influence the way a person cope with living conditions. It is expected that mental toughness changes can lead to changing in levels of physical activity. It should be noted that the other variables should not be ignored. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Baecke%20physical%20activity%20questionnaire" title="Baecke physical activity questionnaire">Baecke physical activity questionnaire</a>, <a href="https://publications.waset.org/abstracts/search?q=mental%20toughness" title=" mental toughness"> mental toughness</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=university%20staff" title=" university staff"> university staff</a>, <a href="https://publications.waset.org/abstracts/search?q=university%20student" title=" university student"> university student</a> </p> <a href="https://publications.waset.org/abstracts/88198/comparison-between-mental-toughness-and-level-of-physical-activity-between-staff-and-students-in-university-of-tabriz" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/88198.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">396</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18032</span> Energy Related Carbon Dioxide Emissions in Pakistan: A Decomposition Analysis Using LMDI </h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Arsalan%20Khan">Arsalan Khan</a>, <a href="https://publications.waset.org/abstracts/search?q=Faisal%20Jamil"> Faisal Jamil</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The unprecedented increase in anthropogenic gases in recent decades has led to climatic changes worldwide. CO2 emissions are the most important factors responsible for greenhouse gases concentrations. This study decomposes the changes in overall CO2 emissions in Pakistan for the period 1990-2012 using Log Mean Divisia Index (LMDI). LMDI enables to decompose the changes in CO2 emissions into five factors namely; activity effect, structural effect, intensity effect, fuel-mix effect, and emissions factor effect. This paper confirms an upward trend of overall emissions level of the country during the period. The study finds that activity effect, structural effect and intensity effect are the three major factors responsible for the changes in overall CO2 emissions in Pakistan with activity effect as the largest contributor to overall changes in the emissions level. The structural effect is also adding to CO2 emissions, which indicates that the economic activity is shifting towards more energy-intensive sectors. However, intensity effect has negative sign representing energy efficiency gains, which indicate a good relationship between the economy and environment. The findings suggest that policy makers should encourage the diversification of the output level towards more energy efficient sub-sectors of the economy. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=energy%20consumption" title="energy consumption">energy consumption</a>, <a href="https://publications.waset.org/abstracts/search?q=CO2%20emissions" title=" CO2 emissions"> CO2 emissions</a>, <a href="https://publications.waset.org/abstracts/search?q=decomposition%20analysis" title=" decomposition analysis"> decomposition analysis</a>, <a href="https://publications.waset.org/abstracts/search?q=LMDI" title=" LMDI"> LMDI</a>, <a href="https://publications.waset.org/abstracts/search?q=intensity%20effect" title=" intensity effect "> intensity effect </a> </p> <a href="https://publications.waset.org/abstracts/40962/energy-related-carbon-dioxide-emissions-in-pakistan-a-decomposition-analysis-using-lmdi" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/40962.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">405</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18031</span> Gender Differences in Objectively Assessed Physical Activity among Urban 15-Year-Olds</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Marjeta%20Misigoj%20Durakovic">Marjeta Misigoj Durakovic</a>, <a href="https://publications.waset.org/abstracts/search?q=Maroje%20Soric"> Maroje Soric</a>, <a href="https://publications.waset.org/abstracts/search?q=Lovro%20Stefan"> Lovro Stefan </a> </p> <p class="card-text"><strong>Abstract:</strong></p> Background and aim: Physical inactivity has been linked with increased morbidity and premature mortality and adolescence has been recognised as the critical period for a decline in physical activity (PA) level. In order to properly direct interventions aimed at increasing PA, high-risk groups of individuals should be identified. Therefore, the aim of this study is to describe gender differences in: a) PA level; b) weekly PA patterns. Methods: This investigation is a part of the CRO-PALS study which is an on-going longitudinal study conducted in a representative sample of urban youth in Zagreb (Croatia). CRO-PALS involves 903 adolescents and for the purpose of this study data from a subgroup of 190 participants with information on objective PA level were analysed (116 girls; mean age [SD]=15.6[0.3] years). Duration of moderate and vigorous PA was measured during 5 consecutive by a multiple-sensor physical activity monitor (SenseWear Armband, BodyMedia inc., Pittsburgh, USA). Gender differences in PA level were evaluated using independent samples t-test. Differences in school week and weekend levels of activity were assessed using mixed ANOVA with gender as between-subjects factor. The amount of vigorous PA had to be log-transformed to achieve normality in the distribution. Results: Boys were more active than girls. Duration of moderate-to-vigorous PA averaged 111±44 min/day in boys and 80±38 min/day in girls (mean difference=31 min/day, 95%CI=20-43 min/day). Vigorous PA was 2.5 times higher in boys compared to girls (95%CI=1.9-3.5). Participants were more active during school days than on weekends. The magnitude of the difference in moderate-to-vigorous PA was similar in both gender (p value for time*gender interaction = 0.79) and averaged 19 min/day (95%CI=11-27 min/day). Similarly, vigorous PA was 36% lower on weekends compared with school days (95%CI=22-46%) with no gender difference (p value for time*gender interaction = 0.52). Conclusion: PA level was higher in boys than in girls throughout the week. Still, in both boys and girls, the amount of PA reduced markedly on weekends compared with school days. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=adolescence" title="adolescence">adolescence</a>, <a href="https://publications.waset.org/abstracts/search?q=multiple-sensor%20physical%20activity%20monitor" title=" multiple-sensor physical activity monitor"> multiple-sensor physical activity monitor</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity%20level" title=" physical activity level"> physical activity level</a>, <a href="https://publications.waset.org/abstracts/search?q=weekly%20physical%20activity%20pattern" title=" weekly physical activity pattern"> weekly physical activity pattern</a> </p> <a href="https://publications.waset.org/abstracts/47404/gender-differences-in-objectively-assessed-physical-activity-among-urban-15-year-olds" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/47404.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">258</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18030</span> Antioxidant Activity of the Algerian Traditional Kefir Supernatant</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=H.%20Amellal-Chibane">H. Amellal-Chibane</a>, <a href="https://publications.waset.org/abstracts/search?q=N.%20Dehdouh"> N. Dehdouh</a>, <a href="https://publications.waset.org/abstracts/search?q=S.%20Ait-Kaki"> S. Ait-Kaki</a>, <a href="https://publications.waset.org/abstracts/search?q=F.%20%20Halladj"> F. Halladj</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Kefir is fermented milk that is produced by adding Kefir grains, consisting of bacteria and yeasts, to milk. The aim of this study was to investigate the antioxidant activity of the kefir supernatant and the raw milk. The Antioxidant activity assays of kefir supernatant and raw milk were evaluated by assessing the DPPH radical-scavenging activity. Kefir supernatant demonstrated high antioxidant activity (87.75%) compared to the raw milk (70.59 %). These results suggest that the Algerian kefir has interesting antioxidant activity. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antioxidant%20activity" title="antioxidant activity">antioxidant activity</a>, <a href="https://publications.waset.org/abstracts/search?q=kefir" title=" kefir"> kefir</a>, <a href="https://publications.waset.org/abstracts/search?q=kefir%20supernatant" title=" kefir supernatant"> kefir supernatant</a>, <a href="https://publications.waset.org/abstracts/search?q=raw%20milk" title=" raw milk "> raw milk </a> </p> <a href="https://publications.waset.org/abstracts/24330/antioxidant-activity-of-the-algerian-traditional-kefir-supernatant" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/24330.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">513</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18029</span> Assessment of Diagnostic Enzymes as Indices of Heavy Metal Pollution in Tilapia Fish</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Justina%20I.%20R.%20Udotong">Justina I. R. Udotong</a>, <a href="https://publications.waset.org/abstracts/search?q=Essien%20U.%20Essien"> Essien U. Essien</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Diagnostic enzymes like aspartate aminotransferase (AST), alanine aminotransferase (ALT) and alkaline phosphatase (ALP) were determined as indices of heavy metal pollution in Tilapia guinensis. Three different sets of fishes treated with lead (Pb), iron (Fe) and copper (Cu) were used for the study while a fourth group with no heavy metal served as a control. Fishes in each of the groups were exposed to 2.65 mg/l of Pb, 0.85 mg/l of Fe and 0.35 mg/l of Cu in aerated aquaria for 96 hours. Tissue fractionation of the liver tissues was carried out and the three diagnostic enzymes (AST, ALT, and ALP) were estimated. Serum levels of the same diagnostic enzymes were also measured. The mean values of the serum enzyme activity for ALP in each experimental group were 19.5±1.62, 29.67±2.17 and 1.15±0.27 IU/L for Pb, Fe and Cu groups compared with 9.99±1.34 IU/L enzyme activity in the control. This result showed that Pb and Fe caused increased release of the enzyme into the blood circulation indicating increased tissue damage while Cu caused a reduction in the serum level as compared with the level in the control group. The mean values of enzyme activity obtained in the liver were 102.14±6.12, 140.17±2.06 and 168.23±3.52 IU/L for Pb, Fe and Cu groups, respectively compared to 91.20±9.42 IU/L enzyme activity for the control group. The serum and liver AST and ALT activities obtained in Pb, Fe, Cu and control groups are reported. It was generally noted that the presence of the heavy metal caused liver tissues damage and consequent increased level of the diagnostic enzymes in the serum. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=diagnostic%20enzymes" title="diagnostic enzymes">diagnostic enzymes</a>, <a href="https://publications.waset.org/abstracts/search?q=enzyme%20activity" title=" enzyme activity"> enzyme activity</a>, <a href="https://publications.waset.org/abstracts/search?q=heavy%20metals" title=" heavy metals"> heavy metals</a>, <a href="https://publications.waset.org/abstracts/search?q=tissues%20investigations" title=" tissues investigations"> tissues investigations</a> </p> <a href="https://publications.waset.org/abstracts/31272/assessment-of-diagnostic-enzymes-as-indices-of-heavy-metal-pollution-in-tilapia-fish" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/31272.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">296</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18028</span> Constructivism Learning Management in Mathematics Analysis Courses</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Komon%20Paisal">Komon Paisal</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The purposes of this research were (1) to create a learning activity for constructivism, (2) study the Mathematical Analysis courses learning achievement, and (3) study students’ attitude toward the learning activity for constructivism. The samples in this study were divided into 2 parts including 3 Mathematical Analysis courses instructors of Suan Sunandha Rajabhat University who provided basic information and attended the seminar and 17 Mathematical Analysis courses students who were studying in the academic and engaging in the learning activity for constructivism. The research instruments were lesson plans constructivism, subjective Mathematical Analysis courses achievement test with reliability index of 0.8119, and an attitude test concerning the students’ attitude toward the Mathematical Analysis courses learning activity for constructivism. The result of the research show that the efficiency of the Mathematical Analysis courses learning activity for constructivism is 73.05/72.16, which is more than expected criteria of 70/70. The research additionally find that the average score of learning achievement of students who engaged in the learning activities for constructivism are equal to 70% and the students’ attitude toward the learning activity for constructivism are at the medium level. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=constructivism" title="constructivism">constructivism</a>, <a href="https://publications.waset.org/abstracts/search?q=learning%20management" title=" learning management"> learning management</a>, <a href="https://publications.waset.org/abstracts/search?q=mathematics%20analysis%20courses" title=" mathematics analysis courses"> mathematics analysis courses</a>, <a href="https://publications.waset.org/abstracts/search?q=learning%20activity" title=" learning activity"> learning activity</a> </p> <a href="https://publications.waset.org/abstracts/9993/constructivism-learning-management-in-mathematics-analysis-courses" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/9993.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">537</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18027</span> Blind Speech Separation Using SRP-PHAT Localization and Optimal Beamformer in Two-Speaker Environments</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Hai%20Quang%20Hong%20Dam">Hai Quang Hong Dam</a>, <a href="https://publications.waset.org/abstracts/search?q=Hai%20Ho"> Hai Ho</a>, <a href="https://publications.waset.org/abstracts/search?q=Minh%20Hoang%20Le%20Ngo"> Minh Hoang Le Ngo</a> </p> <p class="card-text"><strong>Abstract:</strong></p> This paper investigates the problem of blind speech separation from the speech mixture of two speakers. A voice activity detector employing the Steered Response Power - Phase Transform (SRP-PHAT) is presented for detecting the activity information of speech sources and then the desired speech signals are extracted from the speech mixture by using an optimal beamformer. For evaluation, the algorithm effectiveness, a simulation using real speech recordings had been performed in a double-talk situation where two speakers are active all the time. Evaluations show that the proposed blind speech separation algorithm offers a good interference suppression level whilst maintaining a low distortion level of the desired signal. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=blind%20speech%20separation" title="blind speech separation">blind speech separation</a>, <a href="https://publications.waset.org/abstracts/search?q=voice%20activity%20detector" title=" voice activity detector"> voice activity detector</a>, <a href="https://publications.waset.org/abstracts/search?q=SRP-PHAT" title=" SRP-PHAT"> SRP-PHAT</a>, <a href="https://publications.waset.org/abstracts/search?q=optimal%20beamformer" title=" optimal beamformer"> optimal beamformer</a> </p> <a href="https://publications.waset.org/abstracts/53263/blind-speech-separation-using-srp-phat-localization-and-optimal-beamformer-in-two-speaker-environments" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/53263.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">288</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18026</span> Personal Egocentrism as an Indicator of the Management Activity Efficiency</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Lusine%20%20S.%20Stepanyan">Lusine S. Stepanyan</a>, <a href="https://publications.waset.org/abstracts/search?q=Elina%20V.%20Asriyan."> Elina V. Asriyan.</a> </p> <p class="card-text"><strong>Abstract:</strong></p> It is known, that the efficiency of management depend on individual characteristics of manager. In case, was shown the role of personal position in the efficiency of management. Current research is aimed at reveal psychological and psychophysiological basis efficiency of management and finding ways of increasing the productivity of management that is most essential and topical problems of modern society. To understand the investigated phenomenon it was applied a complex approach. The Eysenk questionnaire was used for determining the level of aggression, frustration, anxiety and rigidity. The test of egocentric associations was used for determining the level of egocentrism. The test of COS (communicativeness and organizational skills) was used for diagnosing the level of communicativeness. The integral index of job satisfaction was used for diagnosis the efficiency of management activity. Then, the relationship between the above mentioned mental state, communicativeness, self-esteem, job satisfaction, locus of control, and egocentrism was investigated. The obtained results have shown the positive correlation between the egocentrism and frustration, anxiety and also the negative correlation with job satisfaction and communicativeness. Intergroup analyses has revealed the significant differences by communicativeness and the internality’ level. The revealed results can be used for diagnosis of efficiency of management. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=egocentrism" title="egocentrism">egocentrism</a>, <a href="https://publications.waset.org/abstracts/search?q=locus%20control" title=" locus control"> locus control</a>, <a href="https://publications.waset.org/abstracts/search?q=mental%20state" title=" mental state"> mental state</a>, <a href="https://publications.waset.org/abstracts/search?q=job%20satisfaction" title=" job satisfaction"> job satisfaction</a>, <a href="https://publications.waset.org/abstracts/search?q=professional%20activity" title=" professional activity"> professional activity</a> </p> <a href="https://publications.waset.org/abstracts/19372/personal-egocentrism-as-an-indicator-of-the-management-activity-efficiency" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/19372.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">372</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18025</span> Influence of Psychosocial Factors on Physical Activity Level among Individuals with Asthma</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Awotidebe%20Taofeek">Awotidebe Taofeek</a>, <a href="https://publications.waset.org/abstracts/search?q=Oyinsuyi%20Oluwafunmbi"> Oyinsuyi Oluwafunmbi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Psychosocial factors play a significant role in physical activity participation in diseased conditions and the general population. However, little is known about the role of exercise self-efficacy (ESE), exercise perceived barriers (EPB), and social support (SOS) in patients with asthma. This study investigated the influence of psychosocial factors on physical activity participation in patients with asthma in ile-ife. This cross-sectional study involved 130 patients with asthma. They were recruited from the Chest Clinic of the Obafemi Awolowo University Teaching Hospitals Complex, Ile-ife using purposive sampling technique. Ethical approval was obtained from the Ethics and Research Committee of the Obafemi Awolowo University Teaching Hospitals Complex, Ile-ife, Nigeria. Socio-demographic characteristics of respondents were recorded. Information on ESE, EPB, and SOS were obtained using Exercise Self-Efficacy, Exercise Benefit, and Barrier and Medical Outcome Social Support Scales respectively. Physical activity level was assessed in the last 7 days using international physical activity questionnaire. Descriptive and inferential statistics were used to analyze the data. Alpha level was set at p<0.5. The mean age of the respondents was 25.15 ± 9.38, and a majority, 110 (84.60%), engaged in low physical activity, 69(53%) had low exercise self-efficacy. However, less than two-third 80 (62.20%) reported high social support, with the majority of 95 (73.10%) reported high exercise perceived barriers. The means of ESE for male and femalerespondents were 29.01 ± 20.62 and 24.35 ± 17.36, respectively. The means of SOS formale and female respondents were 49.52 ± 22.22 and 61.87 ± 22.66, respectively. Themeans of EPB for male and female respondents were 53.37 ± 10.23 and 57.43 ± 9.65, respectively. The respondents were comparable in exercise self-efficacy and physicalactivity level (p>0.05). However, there were significant differences in social support (t=-2.791; p=0.006) and exercise perceived barriers (t=-2.108, p=0.037).Theresultsshowthattherewasasignificantrelationshipbetweenexerciseperceivedbarriersandlowphysicalactivitylevel(r=-0.216;p=0.023).TherewasasignificantassociationbetweenExerciseself-efficacyandmarried individuals(OR=0.967;95%CI=0.936-0.998;p= 0.037). Similarly, However,thereweresignificantassociationsbetweensocialsupport Andagegroup35-54years(OR=1.036;95%CI=1.007-1.067;p=0.014),females(OR= 1.024;95%CI=1.006;p=0.009)andmarriedindividuals(OR=1.049;95%CI=1.020-1.079. p=0.001).Therewasasignificantassociationbetweenexerciseperceivedbarriersand females(OR=1.043;95%CI=1.002-1.085;p=0.040).However, thereweresignificant associationsbetweenexerciseperceivedbarriersandoccupationgroup;civilservants (OR=1.092;95%CI=1.009-1.182;p=0.028),retiree(OR=1.092;95%CI=1.040-1.469;p= 0.016)andstudents(OR=1.110;95%CI=1.040;p=0.002). Inconclusion,agreaterpercentageofpatientswithasthmahadlowphysicalactivityleveland it was associatedwithhighexerciseperceivedbarriers,whileexerciseself-efficacyandsocialsupportwerenot. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=asthma" title="asthma">asthma</a>, <a href="https://publications.waset.org/abstracts/search?q=psychosocial%20factors" title=" psychosocial factors"> psychosocial factors</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20activity" title=" physical activity"> physical activity</a>, <a href="https://publications.waset.org/abstracts/search?q=physical%20fitness" title=" physical fitness"> physical fitness</a> </p> <a href="https://publications.waset.org/abstracts/144688/influence-of-psychosocial-factors-on-physical-activity-level-among-individuals-with-asthma" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/144688.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">128</span> </span> </div> </div> <ul class="pagination"> <li class="page-item disabled"><span class="page-link">&lsaquo;</span></li> <li class="page-item active"><span class="page-link">1</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=2">2</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=3">3</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=4">4</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=5">5</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=6">6</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=7">7</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=8">8</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=9">9</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=10">10</a></li> <li class="page-item disabled"><span class="page-link">...</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=601">601</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=602">602</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=activity%20level&amp;page=2" rel="next">&rsaquo;</a></li> </ul> </div> </main> <footer> <div id="infolinks" class="pt-3 pb-2"> <div class="container"> <div style="background-color:#f5f5f5;" class="p-3"> <div class="row"> <div class="col-md-2"> <ul class="list-unstyled"> About <li><a href="https://waset.org/page/support">About Us</a></li> <li><a href="https://waset.org/page/support#legal-information">Legal</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/WASET-16th-foundational-anniversary.pdf">WASET celebrates its 16th foundational anniversary</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Account <li><a href="https://waset.org/profile">My Account</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Explore <li><a href="https://waset.org/disciplines">Disciplines</a></li> <li><a href="https://waset.org/conferences">Conferences</a></li> <li><a href="https://waset.org/conference-programs">Conference Program</a></li> <li><a href="https://waset.org/committees">Committees</a></li> <li><a href="https://publications.waset.org">Publications</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Research <li><a href="https://publications.waset.org/abstracts">Abstracts</a></li> <li><a href="https://publications.waset.org">Periodicals</a></li> <li><a href="https://publications.waset.org/archive">Archive</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Open Science <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Philosophy.pdf">Open Science Philosophy</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Award.pdf">Open Science Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Society-Open-Science-and-Open-Innovation.pdf">Open Innovation</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Postdoctoral-Fellowship-Award.pdf">Postdoctoral Fellowship Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Scholarly-Research-Review.pdf">Scholarly Research Review</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Support <li><a href="https://waset.org/page/support">Support</a></li> <li><a href="https://waset.org/profile/messages/create">Contact Us</a></li> <li><a href="https://waset.org/profile/messages/create">Report Abuse</a></li> </ul> </div> </div> </div> </div> </div> <div class="container text-center"> <hr style="margin-top:0;margin-bottom:.3rem;"> <a href="https://creativecommons.org/licenses/by/4.0/" target="_blank" class="text-muted small">Creative Commons Attribution 4.0 International License</a> <div id="copy" class="mt-2">&copy; 2025 World Academy of Science, Engineering and Technology</div> </div> </footer> <a href="javascript:" id="return-to-top"><i class="fas fa-arrow-up"></i></a> <div class="modal" id="modal-template"> <div class="modal-dialog"> <div class="modal-content"> <div class="row m-0 mt-1"> <div class="col-md-12"> <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">&times;</span></button> </div> </div> <div class="modal-body"></div> </div> </div> </div> <script src="https://cdn.waset.org/static/plugins/jquery-3.3.1.min.js"></script> <script src="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/js/bootstrap.bundle.min.js"></script> <script src="https://cdn.waset.org/static/js/site.js?v=150220211556"></script> <script> jQuery(document).ready(function() { /*jQuery.get("https://publications.waset.org/xhr/user-menu", function (response) { jQuery('#mainNavMenu').append(response); });*/ jQuery.get({ url: "https://publications.waset.org/xhr/user-menu", cache: false }).then(function(response){ jQuery('#mainNavMenu').append(response); }); }); </script> </body> </html>

Pages: 1 2 3 4 5 6 7 8 9 10