CINXE.COM

Japanese Team Successfully Skip Abnormal Gene In Vitro With Antisense Oligonucleotide for BPAN

<!doctype html><html lang="en"><head> <meta charset="utf-8"> <title>Japanese Team Successfully Skip Abnormal Gene In Vitro With Antisense Oligonucleotide for BPAN</title> <link rel="shortcut icon" href="https://oxfordglobal.com/hubfs/OXFORD_GLOBAL-LOGO_SYMBOL.jpg"> <meta name="description" content="Rare disease BPAN currently has no treatment options, this new research investigates whether antisense oligonucleotide therapies could be the answer to address this unmet need."> <meta name="viewport" content="width=device-width, initial-scale=1"> <meta property="og:description" content="Rare disease BPAN currently has no treatment options, this new research investigates whether antisense oligonucleotide therapies could be the answer to address this unmet need."> <meta property="og:title" content="Japanese Team Successfully Skip Abnormal Gene In Vitro With Antisense Oligonucleotide for BPAN"> <meta name="twitter:description" content="Rare disease BPAN currently has no treatment options, this new research investigates whether antisense oligonucleotide therapies could be the answer to address this unmet need."> <meta name="twitter:title" content="Japanese Team Successfully Skip Abnormal Gene In Vitro With Antisense Oligonucleotide for BPAN"> <style> a.cta_button{-moz-box-sizing:content-box !important;-webkit-box-sizing:content-box !important;box-sizing:content-box !important;vertical-align:middle}.hs-breadcrumb-menu{list-style-type:none;margin:0px 0px 0px 0px;padding:0px 0px 0px 0px}.hs-breadcrumb-menu-item{float:left;padding:10px 0px 10px 10px}.hs-breadcrumb-menu-divider:before{content:'›';padding-left:10px}.hs-featured-image-link{border:0}.hs-featured-image{float:right;margin:0 0 20px 20px;max-width:50%}@media (max-width: 568px){.hs-featured-image{float:none;margin:0;width:100%;max-width:100%}}.hs-screen-reader-text{clip:rect(1px, 1px, 1px, 1px);height:1px;overflow:hidden;position:absolute !important;width:1px} </style> <link rel="stylesheet" href="https://oxfordglobal.com/hs-fs/hub/8696823/hub_generated/template_assets/135726131582/1732113079147/git/og-stage/css/main.min.css"> <link rel="stylesheet" href="https://cdn.oxfordglobal.com/fontawesome/6.5.1/css/fontawesome.min.css"> <link rel="stylesheet" href="https://cdn.oxfordglobal.com/fontawesome/6.5.1/css/brands.min.css"> <link rel="stylesheet" href="https://cdn.oxfordglobal.com/fontawesome/6.5.1/css/solid.min.css"> <!-- Editor Styles --> <style id="hs_editor_style" type="text/css"> #hs_cos_wrapper_module_17019620504109 { display: block !important; margin-bottom: 0px !important } </style> <!-- Added by GoogleAnalytics4 integration --> <script> var _hsp = window._hsp = window._hsp || []; window.dataLayer = window.dataLayer || []; function gtag(){dataLayer.push(arguments);} var useGoogleConsentModeV2 = true; var waitForUpdateMillis = 1000; if (!window._hsGoogleConsentRunOnce) { window._hsGoogleConsentRunOnce = true; gtag('consent', 'default', { 'ad_storage': 'denied', 'analytics_storage': 'denied', 'ad_user_data': 'denied', 'ad_personalization': 'denied', 'wait_for_update': waitForUpdateMillis }); if (useGoogleConsentModeV2) { _hsp.push(['useGoogleConsentModeV2']) } else { _hsp.push(['addPrivacyConsentListener', function(consent){ var hasAnalyticsConsent = consent && (consent.allowed || (consent.categories && consent.categories.analytics)); var hasAdsConsent = consent && (consent.allowed || (consent.categories && consent.categories.advertisement)); gtag('consent', 'update', { 'ad_storage': hasAdsConsent ? 'granted' : 'denied', 'analytics_storage': hasAnalyticsConsent ? 'granted' : 'denied', 'ad_user_data': hasAdsConsent ? 'granted' : 'denied', 'ad_personalization': hasAdsConsent ? 'granted' : 'denied' }); }]); } } gtag('js', new Date()); gtag('set', 'developer_id.dZTQ1Zm', true); gtag('config', 'G-43QK8SYTST'); </script> <script async src="https://www.googletagmanager.com/gtag/js?id=G-43QK8SYTST"></script> <!-- /Added by GoogleAnalytics4 integration --> <link rel="canonical" href="https://oxfordglobal.com/nextgen-biomed/resources/japanese-team-successfully-skip-abnormal-gene-in-vitro-with-antisense-oligonucleotide-for-bpan"> <meta property="og:image" content="https://oxfordglobal.com/hubfs/Website/Images/Resources/Biologics/Japanese%20Team%20Successfully%20Skip%20Abnormal%20Gene%20In%20Vitro%20With%20Antisense%20Oligonucleotide%20for%20BPAN.png"> <meta property="og:image:width" content="1200"> <meta property="og:image:height" content="800"> <meta name="twitter:image" content="https://oxfordglobal.com/hubfs/Website/Images/Resources/Biologics/Japanese%20Team%20Successfully%20Skip%20Abnormal%20Gene%20In%20Vitro%20With%20Antisense%20Oligonucleotide%20for%20BPAN.png"> <meta property="og:url" content="https://oxfordglobal.com/nextgen-biomed/resources/japanese-team-successfully-skip-abnormal-gene-in-vitro-with-antisense-oligonucleotide-for-bpan"> <meta name="twitter:card" content="summary"> <meta http-equiv="content-language" content="en"> <meta name="generator" content="HubSpot"></head> <body class="nextgen-biomed"> <div class="body-wrapper hs-content-id-177607186815 hs-site-page page "> <div data-global-resource-path="git/og-stage/templates/partials/header.html"> <header class="website-header "> <div class="navbar"> <div class="navbar-brands"> <a href="/nextgen-biomed" class="logo-link current-brand"> <img src="https://oxfordglobal.com/hubfs/Website/Logos/Brand%20Logos/NextGen%20Biomed.svg" class="logo-image"> <i class="dropdown fa-solid fa-chevron-down"></i> </a> <div class="brands"> <div class="intro"> <h2> Explore our brands </h2> <div class="desc"> Our brands bring together the industry's most influential leaders and scientific experts, inspiring thought-provoking and insightful content that offers a unique perspective on R&amp;D trends and challenges. </div> </div> <div class="items"> <div class="item primary-brand"> <a href="/" class="logo-link"><img src="https://oxfordglobal.com/hubfs/logo.jpg" class="logo-image"></a> </div> <div class="item"> <a href="/precision-medicine" class="logo-link"><img src="https://oxfordglobal.com/hubfs/Website/Logos/Brand%20Logos/Precision%20Medicine.svg" class="logo-image"></a> </div> <div class="item"> <a href="/discovery-development" class="logo-link"><img src="https://oxfordglobal.com/hubfs/Website/Logos/Brand%20Logos/Discovery%20%26%20Development.svg" class="logo-image"></a> </div> <div class="item active-item"> <a href="/nextgen-biomed" class="logo-link"><img src="https://oxfordglobal.com/hubfs/Website/Logos/Brand%20Logos/NextGen%20Biomed.svg" class="logo-image"></a> </div> </div> </div> </div> <div class="flex flex-align-center navbar-nav"> <a href="#" class="navbar-nav-toggle"> <div class="toggle-icons"> <i class="fa-solid fa-bars toggle-open"></i> <i class="fa-solid fa-xmark toggle-close"></i> </div> </a> <ul class="navbar-nav-items"> <li class="navbar-nav-item"> <a href="#" class="navbar-nav-item-link">Events <i class="fa-solid fa-chevron-down"></i></a> <div class="navbar-subnav"> <div class="subnav-graphics"> <img src="https://oxfordglobal.com/hubfs/Website/Images/Header%20Events.jpg" class="subnav-image"> </div> <div class="subnav-items"> <div class="subnav-item flex-3 divider g-20"> <div class="subnav-item-content bottom-mp-fix"> <h3> In-Person &amp; Online Events </h3> <p>Pivotal moments where high-level industry experts and thought leaders come together for focused knowledge sharing and unparalleled networking opportunities.</p> </div> <div class="subnav-item"> <div class="event-pills"> <a href="/nextgen-biomed/events/nextgen-biomed-2025" class="pill center"> <div class="b">NextGen Biomed 2025</div> <div class="heading-smallcaps"> 12 - 14 Mar 2025 | London, UK </div> </a> <a href="/nextgen-biomed/events/cell-2025" class="pill center"> <div class="b">Cell 2025</div> <div class="heading-smallcaps"> 11-12 Nov 2025 | London, UK </div> </a> </div> </div> </div> <div class="subnav-item flex-2"> <div class="subnav-item-content bottom-mp-fix"> <h3> Online Activities </h3> <p>Our Monthly Science Exchanges and Webinars keep you connected to the conversation.</p> </div> <div class="online-activities-list flex flex-column g-10"> <!-- Individual Online Activity --> <div class="online-activity"> <a href="/nextgen-biomed/online#Process%20Challenges%20in%20ATMP%20Development:%20Overcoming%20Hurdles%20for%20Successful%20Manufacturing" class="cta" target="_blank"> <h3 class="other-resources">01/11/24 - Process Challenges in ATMP Development: Overcoming Hurdles for Successful Manufacturing</h3> </a> </div> </div> <div class="subnav-item-content-more"> <a href="/nextgen-biomed/online" class="subnav-item-content-more-link"><i class="fa-solid fa-circle-chevron-right"></i> All Online Activities</a> </div> </div> </div> </div> </li> <li class="navbar-nav-item"> <a href="#" class="navbar-nav-item-link">Community <i class="fa-solid fa-chevron-down"></i></a> <div class="navbar-subnav"> <div class="subnav-graphics"> <img src="https://oxfordglobal.com/hubfs/Website/Images/Header%20Community.jpg" class="subnav-image"> </div> <div class="subnav-items"> <div class="subnav-item flex flex-1 divider"> <div class="subnav-item-content bottom-mp-fix"> <h3> About </h3> <p>NextGen Biomed is the platform to advance the fields of biologics, vaccines &amp; novel therapeutics approaches, helping to deliver life-saving medicines to patients faster.</p> </div> <div class="subnav-item-content-more"> <a href="/nextgen-biomed/about" class="subnav-item-content-more-link"><i class="fa-solid fa-circle-chevron-right"></i> More Info</a> </div> </div> <div class="subnav-item flex flex-1 divider"> <div class="subnav-item-content bottom-mp-fix"> <h3> Community </h3> <p>NextGen Biomed is committed to supporting R&amp;D scientists, as well as drug development and manufacturing experts, working with biologics, peptides, and oligonucleotides to overcome complexities at every stage of the drug product lifecycle.</p> </div> <div class="subnav-item-content-more"> <a href="/nextgen-biomed/community" class="subnav-item-content-more-link"><i class="fa-solid fa-circle-chevron-right"></i> More Info</a> </div> </div> <div class="subnav-item flex flex-1 "> <div class="subnav-item-content bottom-mp-fix"> <h3> Media Partners </h3> <p>We work with leading journal publications on reciprocal marketing arrangements.</p> </div> <div class="subnav-item-content-more"> <a href="/nextgen-biomed/media-partners" class="subnav-item-content-more-link"><i class="fa-solid fa-circle-chevron-right"></i> More Info</a> </div> </div> </div> </div> </li> <li class="navbar-nav-item"> <a href="#" class="navbar-nav-item-link">Services <i class="fa-solid fa-chevron-down"></i></a> <div class="navbar-subnav"> <div class="subnav-graphics"> <img src="https://oxfordglobal.com/hubfs/Website/Images/Header%20Services.jpg" class="subnav-image"> </div> <div class="subnav-items"> <div class="subnav-item flex flex-1 divider"> <div class="subnav-item-content bottom-mp-fix"> <h3> In-Person Services </h3> <p>At Oxford Global, our events are designed to connect key life science figures and innovative solution providers, accelerating scientific advancement. Our goal is to create valuable connections and an impactful experience through innovative and collaborative formats.</p> </div> <div class="subnav-item-content-more"> <a href="/nextgen-biomed/in-person-services" class="subnav-item-content-more-link"><i class="fa-solid fa-circle-chevron-right"></i> More Info</a> </div> </div> <div class="subnav-item flex flex-1"> <div class="subnav-item-content bottom-mp-fix"> <h3> Digital Marketing Services </h3> <p>Oxford Global’s products offer a powerful channel to associate your brand with the latest advancements within the industry whilst educating and influencing the industry throughout their buying process.</p> </div> <div class="subnav-item-content-more"> <a href="/nextgen-biomed/digital-marketing-services" class="subnav-item-content-more-link"><i class="fa-solid fa-circle-chevron-right"></i> More Info</a> </div> </div> </div> </div> </li> <li class="navbar-nav-item"> <a href="#" class="navbar-nav-item-link">Resources <i class="fa-solid fa-chevron-down"></i></a> <div class="navbar-subnav"> <div class="subnav-graphics"> <img src="https://oxfordglobal.com/hubfs/Website/Images/Header%20Resources.jpg" class="subnav-image"> </div> <div class="subnav-items"> <div class="subnav-item flex-2 divider"> <div class="subnav-item-content bottom-mp-fix"> <h3> Browse All Resources </h3> <p>The latest in from nextgen biomed research &amp; development</p> </div> <div class="subnav-item-content-more"> <a href="/nextgen-biomed/resources" class="subnav-item-content-more-link"><i class="fa-solid fa-circle-chevron-right"></i> All NextGen Biomed Resources</a> </div> </div> <div class="subnav-item flex-4 divider"> <div class="subnav-item-content bottom-mp-fix"> <h3> Latest Resources </h3> <div class="resources"> <div class="resource"> <div class="resource-cover"> <a href="/nextgen-biomed/resources/university-college-london-hospitals-begins-clinical-trial-for-one-off-car-t-treatment-for-lupus" class="resource-cover-link"> <img src="https://oxfordglobal.com/hubfs/Website/Images/Resources/NextGen%20Biomed/University%20College%20London%20Hospitals%20Begins%20Clinical%20Trial%20for%20One-Off%20CAR%20T%20Treatment%20for%20Lupus%201.jpg" class="resource-cover-image"> </a> </div> <div class="resource-content"> <h3 class="resource-heading"> <a href="/nextgen-biomed/resources/university-college-london-hospitals-begins-clinical-trial-for-one-off-car-t-treatment-for-lupus">University College London Hospitals Begins Clinical Trial for One-Off CAR T Treatment for Lupus</a> </h3> <div class="resource-abstract"> <span class="resource-date">08/11/24 - </span> The possibility of a one-off treatment for lupus could offer hope to 69,000 patients in the UK. </div> </div> </div> <div class="top-divider"></div> <div class="resource"> <div class="other-resources"><a href="/nextgen-biomed/resources/clesrovimab-shows-positive-results-as-preventative-treatment-for-rsv-in-pre-term-and-full-term-infants">07/11/24 - Clesrovimab Shows Positive Results as Preventative Treatment for RSV in Pre-Term and Full-Term Infants</a></div> </div> <div class="top-divider"></div> <div class="resource"> <div class="other-resources"><a href="/nextgen-biomed/resources/the-nist-awards-1-5-million-to-improve-standardisation-in-regenerative-medicine">31/10/24 - The NIST Awards $1.5 Million to Improve Standardisation in Regenerative Medicine</a></div> </div> </div> </div> </div> <div class="subnav-item flex-3"> <div class="subnav-item-content bottom-mp-fix"> <h3> Featured Resource </h3> <div class="resources flex flex-column g-5"> <a href="https://oxfordglobal.com/nextgen-biomed/resources/sponsored/webinar/wuxibiologics/sp-webinar-optimizing-bispecific-antibody-production-from-identifying-optimal-pairings-to-scale-up-processes"> <div class="sponsor-resource flex-column"> <div class="resource-cover img-fluid"> <div class="sponsor-resource-cover-link"> <img src="https://oxfordglobal.com/hubfs/Digital%20Marketing/Webinars/Email%20and%20Social%20Collateral/NGB%20-%20Wuxi%20Biologics/WuXi%20Biologics.png" class="sponsor-resource-cover-image"> </div> </div> <div class="resource-content p-15"> <h3 class="resource-heading"> Optimizing Bispecific Antibody Production: From Identifying Optimal Pairings to Scale-up Processes </h3> <div class="resource-abstract"> On-demand webinar presented by Dr Jiansheng Wu, Head of Protein Sciences and Vice President at WuXi Biologics </div> </div> </div> </a> </div> </div> </div> </div> </div> </li> <li class="navbar-nav-item show-sm hide-md hide-lg hide-xl"> <a href="javascript:postMessage({type:'HS_DISPLAY_CALL_TO_ACTION',id:130207947529});" class="navbar-nav-item-link">Contact</a> </li> <li class="navbar-nav-item show-sm hide-md hide-lg hide-xl"> <a href="#" class="navbar-nav-item-link">Our Brands <i class="fa-solid fa-chevron-down"></i></a> <div class="navbar-subnav"> <div class="subnav-items"> <h2> Explore our brands </h2> <div class="desc"> Our brands bring together the industry's most influential leaders and scientific experts, inspiring thought-provoking and insightful content that offers a unique perspective on R&amp;D trends and challenges. </div> <div class="subnav-item"> <div class="subnav-item-content"> <a href="/">Oxford Global</a> </div> </div> <div class="subnav-item"> <div class="subnav-item-content"> <a href="/precision-medicine">Precision Medicine</a> </div> </div> <div class="subnav-item"> <div class="subnav-item-content"> <a href="/discovery-development">Discovery &amp; Development</a> </div> </div> <div class="subnav-item"> <div class="subnav-item-content"> <a href="/nextgen-biomed">NextGen Biomed</a> </div> </div> </div> </div> </li> </ul> </div> <div class="flex flex-align-center hide-sm show-md show-lg show-xl"> <a href="javascript:postMessage({type:'HS_DISPLAY_CALL_TO_ACTION',id:130207947529});" class="navbar-button">Contact</a> </div> </div> </header></div> <main id="main-content"> <div class="resource-single"> <div class="header bg-primary-light"> <div class="container-wrapper"> <div class="wide-container header-container"> <div class="header-content flex-1"> <div class="heading-smallcaps"> Oligo Chemistry | Industry Spotlights &amp; Insight Articles </div> <h1 class="heading"> Japanese Team Successfully Skip Abnormal Gene In Vitro With Antisense Oligonucleotide for BPAN </h1> <div class="byline"> Edited by Tom Cohen | 22 March 2024 </div> <div class="abstract"> Rare disease BPAN currently has no treatment options, this new research investigates whether antisense oligonucleotide therapies could be the answer to address this unmet need. </div> </div> <div class="header-graphic flex-1"> <img src="https://oxfordglobal.com/hubfs/Website/Images/Resources/Biologics/Japanese%20Team%20Successfully%20Skip%20Abnormal%20Gene%20In%20Vitro%20With%20Antisense%20Oligonucleotide%20for%20BPAN.png" class="header-graphic-image"> </div> </div> </div> </div> <div class="container-wrapper"> <div class="wide-container"> <div class="content"> <div class="content-body text-gap"> <p>A genetic disorder called <a href="https://www.mcri.edu.au/impact/a-z-child-adolescent-health/b/bpan" rel="noopener" target="_blank">beta-propeller protein-associated neurodegeneration (BPAN)</a> causes progressive neurodevelopmental issues and is characterized by a build-up of iron in the brain (substantia nigra and in the globus pallidus).</p> <p>It is a very rare disease, effecting approximately 500 people worldwide and is caused by genetic mutation on the WDR45 gene on chromosome Xp11. There are currently no therapies for BPAN, although there are medications that can help manage the symptoms of the disease.</p> <p><strong>RELATED:</strong></p> <ul> <li><a href="https://oxfordglobal.com/biologics/resources/innovation-at-the-crossroads-oligonucleotide-therapeutics-and-the-evolution-of-drug-design" rel="noopener" target="_blank">Innovation at the Crossroads: Oligonucleotide Therapeutics and the Evolution of Drug Design</a></li> <li><a href="https://oxfordglobal.com/biologics/resources/how-do-regulatory-considerations-impact-the-clinical-development-of-oligonucleotide-therapies" rel="noopener" target="_blank">How Do Regulatory Considerations Impact the Clinical Development of Oligonucleotide Therapies?</a></li> <li><a href="https://oxfordglobal.com/biologics/resources/new-approach-to-oligo-peptide-synthesis-from-novo-and-aarhus-university" rel="noopener" target="_blank">New Approach to Oligo-Peptide Synthesis from Novo and Aarhus University</a></li> </ul> <p>BPAN can be caused by a variety of pathogenic variants of the WDR45 gene. Researchers from three Japanese universities: Keio University School of Medicine, Tokyo, Kobe Gakuin University, Kobe, and Kyoto University, Kyoto, have u<a href="https://oxfordglobal.com/biologics/events/mrna-vaccines-oligonucleotide-therapies-2024" rel="noopener" target="_blank">sed an antisense oligonucleotide (ASO) to skip the faulty gene in an in vitro model.</a></p> <p>The specific genetic variation in question is that of a 17 year old Japanese female patient who expressed impaired motor function, and developmental delay since birth. At 15, MRI revealed iron deposits in her brain (substantia nigra and globus pallidus), consistent with a diagnosis of BPAN.</p> <p>Whole genome sequencing and RNA sequencing identified the specific genetic variation that the patient had: WDR45 (OMIM #300526) chrX(GRCh37):g.48935143G &gt; C, NM_007075.4 (NM_001029896.4/ENST00000376372.9):c.235 + 159C &gt; G.</p> <p>Further investigation showed that the cause of BPAN was a result of pseudoexon insertion remote from the exon–intron junction. The paper, published in <em><a href="https://www.nature.com/articles/s41598-024-56704-z">Scientific Reports</a></em> says:</p> <p>"The fact that pseudoexon insertion is the cause of BPAN indicates that inducing pseudoexon skipping during splicing would normalize the patient's gene product, and that an antisense oligonucleotide (ASO) that induces pseudoexon skipping could be a treatment for this BPAN case."</p> <p>The team then went looking for an antisense oligonucleotide that would cause the faulty part of the genetic sequence to be skipped, and thereby provide a therapeutic option for BPAN.</p> <p>To do this, the group used a reporter system that they had recently developed using two different fluorescent proteins: "mCherry, a transfection marker designed to facilitate evaluation of exon skipping and split eGFP, a splicing reaction marker."</p> <p>mCherry helped them see when cells take up the genetic material they're testing. And split eGFP, helped them track the process of splicing, where introns are removed, and exons are joined together in RNA.</p> <p>The group's initial screening synthesised 15 ASOs and evaluated them based on their ability to skip pseudoexons, and thereby restore normal gene function.</p> <p>After further screening, they identified a 24-base ASO, WDR45In5#6-5-24: caaccuucucaagcuauaagaucc, which had the best efficacy of skipping the abnormal pseudoexon. The sequence was then selected as a candidate for further development.</p> <p>The team hopes that the data presented in their paper will provide the necessary evidence to continue investigating their candidate in preclinical <em>in vivo</em> studies. Looking further into the potential of ASO therapies for the treatment of rare diseases shines a light on the unmet needs that patients and clinicians are desperate to address.</p> <div class="content-body-footer"> </div> </div> <div class="content-sidebar"> <div class="related-event"> <h3 class="center">Related Events</h3> For more on this topic, you may be interested in our upcoming <a href="/nextgen-biomed/events/nextgen-biomed-2025">Oligonucleotides</a> </div> <div class="related-articles"> <h3 class="center">Related Resources</h3> <div class="article"> <a href="/nextgen-biomed/resources/oligo-sequencing-methods-and-techniques"> <div class="cover-graphic"> <img src="https://oxfordglobal.com/hubfs/Website/Images/Resources/Biologics/Oligo%20Sequencing%20Technologies.jpg" class="cover-graphic-image"> </div> </a><div class="content"><a href="/nextgen-biomed/resources/oligo-sequencing-methods-and-techniques"> <h4> Oligo Sequencing Technologies - What Methods and Techniques Are Utilized in the Pharmaceutical Industry? </h4> <div class="abstract"> Oligo sequencing revolutionizes biologics research, ensuring accurate analysis of oligonucleotides. Biologics by Oxford Global explores methods, safety, sustainability, and future trends. Despite challenges, advancements promise exciting opportunities for scientific discovery. </div> <div class="read-more"> <a href="/nextgen-biomed/resources/oligo-sequencing-methods-and-techniques" class="read-more-link">Read More</a> </div></a> </div> </div> <div class="article"> <a href="/nextgen-biomed/resources/innovation-at-the-crossroads-oligonucleotide-therapeutics-and-the-evolution-of-drug-design"> <div class="cover-graphic"> <img src="https://oxfordglobal.com/hubfs/Website/Images/Resources/Biologics/Oligos.png" class="cover-graphic-image"> </div> </a><div class="content"><a href="/nextgen-biomed/resources/innovation-at-the-crossroads-oligonucleotide-therapeutics-and-the-evolution-of-drug-design"> <h4> Innovation at the Crossroads: Oligonucleotide Therapeutics and the Evolution of Drug Design </h4> <div class="abstract"> Can oligonucleotide therapeutics shape the future of healthcare? We journey through AI frontiers, sustainable synthesis, and regulatory challenges. </div> <div class="read-more"> <a href="/nextgen-biomed/resources/innovation-at-the-crossroads-oligonucleotide-therapeutics-and-the-evolution-of-drug-design" class="read-more-link">Read More</a> </div></a> </div> </div> </div> </div> </div> </div> </div> </div> <div class="newsletter-cta"> <h2 class="heading">Subscribe to our newsletter</h2> <div class="message"> Sign up for our monthly Newsletter to keep up with all things NextGen Biomed </div> <div class="button-wrapper"> <a href="#" class="button hs-cta-trigger-button hs-cta-trigger-button-177053686099">Newsletter Sign-Up</a> </div> </div> </main> <div data-global-resource-path="git/og-stage/templates/partials/footer.html"><footer class="website-footer flex flex-column g-20"> <div class="footer-columns"> <div class="footer-column"> <a href="https://oxfordglobal.com" class="site-logo-link"> <img src="https://oxfordglobal.com/wp-content/uploads/2023/03/Oxford-Global-Logo-Stacked-Websize.png" class="site-logo"> </a> </div> <div class="footer-column"> <h3>Brands</h3> <ul> <li> <a href="/precision-medicine/">Precision Medicine</a> </li> <li> <a href="/discovery-development/">Discovery &amp; Development</a> </li> <li> <a href="/nextgen-biomed/">NextGen Biomed</a> </li> </ul> </div> <div class="footer-column"> <h3>Services</h3> <ul> <li> <a href="https://oxfordglobal.com/in-person-services/"> In-Person Services </a> </li> <li> <a href="https://oxfordglobal.com/digital-marketing-services/"> Digital Marketing Services </a> </li> </ul> <h3>Upcoming Events</h3> <ul> <li> <a href="https://oxfordglobal.com/calendar/"> Event Calendar </a> </li> </ul> </div> <div class="footer-column"> <h3>Company</h3> <ul> <li class="elementor-icon-list-item"> <a href="https://oxfordglobal.com/about-us/"> About </a> </li> <li class="elementor-icon-list-item"> <a href="https://oxfordglobal.com/vacancies/"> Vacancies </a> </li> <li class="elementor-icon-list-item"> <a href="https://oxfordglobal.com/csr-policy/"> CSR Policy </a> </li> <li class="elementor-icon-list-item"> <a href="javascript:postMessage({type:'HS_DISPLAY_CALL_TO_ACTION',id:130207947529});"> Contact </a> </li> </ul> </div> <div class="footer-column"> <p> <a href="tel:+441865248455">+44 1865 248 455</a><br> <a href="mailto:help@oxfordglobal.com">help@oxfordglobal.com</a> </p> <p> <strong>Our UK Address:</strong><br> Godstow Court<br> Minns Business Park<br> Botley<br> Oxford, OX2 0JB </p> <p> <strong>Our US Address:</strong><br> 100 Cambridge Street<br> 14th Floor<br> Boston<br> MA 02114 </p> </div> </div> <div class="footer-bottom grid g-20"> <div class="span8 span12-sm span12-md flex flex-column g-10"> <div class="copyright"> © Oxford Global Marketing Ltd. All rights reserved. </div> <ul class="legal-links flex flex-row g-30 flex-column-sm g-sm-10"> <li><a href="https://oxfordglobal.com/legal/">Terms &amp; Conditions</a></li> <li><a href="https://oxfordglobal.com/legal/privacy-policy/">Privacy Policy</a></li> <li><a href="https://oxfordglobal.com/legal/website-terms/">Cookies</a></li> <li><a href="https://www.wishagency.co.uk/" target="_BLANK">Digital Agency Wish</a></li> </ul> </div> <div class="span4 span12-sm span12-md flex-align-end"> <ul class="social-links flex flex-row flex-justify-end flex-justify-center-sm flex-justify-center-md g-30"> <li><a href="https://www.facebook.com/OGConferences/" target="_BLANK"><i class="fa-brands fa-square-facebook"></i></a></li> <li><a href="https://www.linkedin.com/company/oxford-global/" target="_BLANK"><i class="fa-brands fa-linkedin"></i></a></li> <li><a href="https://twitter.com/OGConferences" target="_BLANK"><i class="fa-brands fa-square-x-twitter"></i></a></li> </ul> </div> </div> </footer></div> </div> <script src="/hs/hsstatic/jquery-libs/static-1.1/jquery/jquery-1.7.1.js"></script> <script>hsjQuery = window['jQuery'];</script> <!-- HubSpot performance collection script --> <script defer src="/hs/hsstatic/content-cwv-embed/static-1.1293/embed.js"></script> <script src="https://oxfordglobal.com/hs-fs/hub/8696823/hub_generated/template_assets/182600797781/1731148644227/git/og-stage/js/inlineSVG.min.js"></script> <script src="https://oxfordglobal.com/hs-fs/hub/8696823/hub_generated/template_assets/135724366742/1725380923802/git/og-stage/js/main.min.js"></script> <script> function getVideoId(url) { var regExp = /^.*(youtu.be\/|v\/|u\/\w\/|embed\/|watch\?v=|\&v=)([^#\&\?]*).*/; var match = url.match(regExp); if (match && match[2].length == 11) { return match[2]; } else { return false; } } function getVideoEmbed(id) { return '<iframe src="https://www.youtube.com/embed/' + id + '" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture; web-share" allowfullscreen style="aspect-ratio: 16 / 9; width: 100%;"></iframe>'; } jQuery("div.content-body .wp-block-embed__wrapper:contains('youtu')").each(function() { var yt_url = $(this).html().trim(); var yt_id = getVideoId(yt_url); var yt_embed = getVideoEmbed(yt_id); $(this).html(yt_embed); }); </script> <!-- Start of HubSpot Analytics Code --> <script type="text/javascript"> var _hsq = _hsq || []; _hsq.push(["setContentType", "standard-page"]); _hsq.push(["setCanonicalUrl", "https:\/\/oxfordglobal.com\/nextgen-biomed\/resources\/japanese-team-successfully-skip-abnormal-gene-in-vitro-with-antisense-oligonucleotide-for-bpan"]); _hsq.push(["setPageId", "hubdb-177607186815-30817717-181072999942"]); _hsq.push(["setContentMetadata", { "contentPageId": "hubdb-177607186815-30817717-181072999942", "legacyPageId": "hubdb-177607186815-30817717-181072999942", "contentFolderId": null, "contentGroupId": null, "abTestId": null, "languageVariantId": 177607186815, "languageCode": "en", }]); </script> <script type="text/javascript" id="hs-script-loader" async defer src="/hs/scriptloader/8696823.js"></script> <!-- End of HubSpot Analytics Code --> <script type="text/javascript"> var hsVars = { render_id: "cee6ce98-0a20-4800-9fe4-b6ca16d77a47", ticks: 1732345209651, page_id: 177607186815, dynamic_page_id: "hubdb-177607186815-30817717-181072999942", content_group_id: 0, portal_id: 8696823, app_hs_base_url: "https://app.hubspot.com", cp_hs_base_url: "https://cp.hubspot.com", language: "en", analytics_page_type: "standard-page", scp_content_type: "", analytics_page_id: "hubdb-177607186815-30817717-181072999942", category_id: 1, folder_id: 0, is_hubspot_user: false } </script> <script defer src="/hs/hsstatic/HubspotToolsMenu/static-1.354/js/index.js"></script> </body></html>

Pages: 1 2 3 4 5 6 7 8 9 10