FAQ

<!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <meta property="og:title" content="FAQ" /> <meta property="og:url" content="https://www.ddbj.nig.ac.jp/faq/en/index-e.html" /> <meta property="og:description" content=" Tags ..." /> <meta property6="og:image" content="/images/thumbnail/logo_ddbj_fb.png" /> <meta name="viewport" content="width=device-width, initial-scale=1.0" /> <title>FAQ</title> <script async src="https://www.google-analytics.com/analytics.js"></script> <script src="https://code.jquery.com/jquery-3.5.0.js" integrity="sha256-r/AaFHrszJtwpe+tHyNi/XCfMxYpbsRg2Uqn0x3s2zc=" crossorigin="anonymous"></script> <script src="https://cdnjs.cloudflare.com/ajax/libs/jquery.hoverintent/1.10.1/jquery.hoverIntent.min.js" integrity="sha512-gx3WTM6qxahpOC/hBNUvkdZARQ2ObXSp/m+jmsEN8ZNJPymj8/Jamf8+/3kJQY1RZA2DR+KQfT+b3JEB0r9YRg==" crossorigin="anonymous"></script> <script src="https://cdnjs.cloudflare.com/ajax/libs/spin.js/4.1.0/spin.min.js" integrity="sha512-CbohqWjAgarTqRHcX1MbwkF2pujwbsCee1PABpnBWC+VqSldvlNEEI5+4OSsR/HbFQOFFpwY2YvZZNjBMxNnXg==" crossorigin="anonymous"></script> <script type="text/javascript" src="https://cdnjs.cloudflare.com/ajax/libs/jquery.colorbox/1.6.4/jquery.colorbox-min.js"></script> <script type="text/javascript" src="https://cdnjs.cloudflare.com/ajax/libs/jquery-deparam/0.5.3/jquery-deparam.min.js"></script> <script type="text/javascript" src="https://www.ddbj.nig.ac.jp/assets/js/jquery.trace.js"></script> <script type="text/javascript" src="https://www.ddbj.nig.ac.jp/assets/js/jquery.json_search.js"></script> <link rel="icon" href="https://www.ddbj.nig.ac.jp/assets/images/favicon_ddbj.ico"> <link rel="stylesheet" href="https://www.ddbj.nig.ac.jp/assets/css/colorbox.css" /> <link rel="stylesheet" href="https://www.ddbj.nig.ac.jp/assets/css/main.css" /> <link rel="alternate" type="application/rss+xml" title="My Site RSS" href="/feed.xml" /> <script src="https://www.ddbj.nig.ac.jp/assets/js/main.js"></script> </head> <body data-category=""> <script src="https://www.ddbj.nig.ac.jp/assets/js/ddbj_common_framework.js" id="DDBJ_common_framework" style="display: block; height: 40px;" data-bottom-menu="true" data-ddbj-home-page="true" data-search="true" ></script> <section class="top-news-view"> <div class="inner"> <ul> <li class="item"> <a href="https://www.ddbj.nig.ac.jp/news/en/2025-02-06-e">(14th February - mid-March) Suspension of the services due to the NIG Supercomputer replacement</a> </li> </ul> </div> </section> <div id="primary"> <header id="PageHeader"> <div class="inner"> <div class="page-title"> <h1 class="title">FAQ</h1> <form action="https://www.google.com/cse" class="search-box"> <input type="hidden" name="cx" value="003756275038197888315:z8dzjduk3p8"> <input type="hidden" name="ie" value="UTF-8"> <input type="text" name="q" class="search-text" placeholder="FAQ Custom Search"> <button></button> <input name="siteurl" type="hidden" value="https://www.ddbj.nig.ac.jp/faq/en/"> <input name="ref" type="hidden" value=""> <input name="ss" type="hidden" value=""> </form> <nav class="breadcrumb-view"> <ul> <li> <a href="https://www.ddbj.nig.ac.jp/index-e.html">Home</a> </li> <li><a>FAQ</a></li> </ul> </nav> </div> </div> </header> <div id="NavigationAndMainView"> <div class="inner"> <nav class="subview"> <nav class="facet-search"> <h2 class="title">Tags</h2> <ul class="tags" data-tab="tag"></ul> </nav> </nav> <main class="mainview"> <ul class="tagging-list-view"> <li class="tagging-item-view taggingitem" data-tags="Metadata,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-create-many-metadata-e.html">Is there an appropriate way to submit submissions containing many metadata objects?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-01-23 20:10:39 +0900">2014/01/23</time></li> <li class="tag-view" data-tag="Metadata">Metadata</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>When there are many Experiment and Run objects, create metadata XMLs by using the excel for the DRA metadata and the XML generator. The metadata can be registered by uploading the Submission/Experiment/Run XMLs in D-way. Please see <a href="/dra/submission-e.html#metadata-excel">Submit metadata by the excel</a> for details.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Metadata,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/metadata-of-multiplexed-samples-e.html">How should I describe a pooled sample distinguished by barcode sequences in metadata?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-01-23 20:14:16 +0900">2014/01/23</time></li> <li class="tag-view" data-tag="Metadata">Metadata</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Barcoded data files should be demultiplexed prior to submission and a unique BioSample should be created for each barcoded sample; in other words, each BioSample must be linked to one or more unique data files. <br /> If necessary, describe relationship between barcode sequences and samples in the <a href="/dra/metadata-e.html#Library_Construction_Protocol">Library Construction Protocol</a> of Experiment as free-text.</p> <p>Regarding 10x Genomics data in which samples tend to be large number, please see the GEA <a href="/gea/single-cell-e.html">Single-cell submission guide</a>.</p> <p>For details, see <a href="/dra/datafile-e.html">Data Files</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequencing data,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/data-validation-error-e.html">How to deal with validation errors in the DRA submission?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-01-23 20:16:53 +0900">2014/01/23</time></li> <li class="tag-view" data-tag="Sequencing data">Sequencing data</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <h3 id="make_sra_error">Make Sra Error</h3> <p><strong>constraint violated while executing function within virtual database module</strong></p> <p>Read names are possibly not unique in Run.<br /> Please see the FAQ: <a href="/faq/en/data-files-sra-e.html">How are my data files processed?</a> and revise duplicated read names if there.</p> <p><strong>path not found while accessing directory within file system module - no message text available</strong></p> <p>Files are not recognized. This error occurs in the following cases:</p> <ul> <li>filename contains whitespace</li> <li>files are in sub-directories</li> <li>fastq files are tar archived</li> </ul> <h3 id="check_sum_error">CheckSum Error</h3> <p>The <a href="/checksum-e.html">MD5 values</a> in the Run metadata (Expected MD5) are different from those of the uploaded files (Uploaded MD5). Please check the followings.</p> <p>Check whether the MD5 values of the files in your local computer match those entered in the Run metadata or not.</p> <ul> <li>If the MD5 values in the Run metadata are not correct, revise the values in the metadata.</li> <li>If those values match, corresponding uploaded files may be corrupted during file transfer, so please re-upload the files.</li> </ul> <h3 id="file_name_error">File Name Error</h3> <p><strong>Undefined or File not found: @SQ SN:</strong></p> <p>Please upload the SN-reference mapping table files to the directory.<br /> See the <a href="/dra/datafile-e.html#bam_submit">Data Files</a> for details.</p> <h3 id="xml">Metadata XML registration</h3> <p>When registering metadata XML files whose SPOT_DESCRIPTOR elements have been added or modified, following errors may occur.</p> <h4 id="no_application">Reads having no application read</h4> <p>Read composition</p> <table> <tbody> <tr> <td>Read Index :</td> <td>0</td> <td>1</td> </tr> <tr> <td>Read :</td> <td>ATCCGG</td> <td>CATCAGTTGAT…………………………………………………</td> </tr> <tr> <td>Base Coordinate :</td> <td>1</td> <td><div class="float-left">7</div><div class="float-right">50</div></td> </tr> <tr> <td>Read Type :</td> <td>Primer</td> <td>Linker <span class="red">(should have at least one application)</span></td> </tr> </tbody> </table> <h4 id="inconsistent_base">Reads with inconsistent base coordinate</h4> <p>Read 1 composition</p> <table> <tbody> <tr> <td>Read Index :</td> <td>0</td> <td>1</td> </tr> <tr> <td>Read :</td> <td>ATCCGG……………</td> <td>CATCAG……………</td> </tr> <tr> <td>Base Coordinate :</td> <td>1</td> <td><span class="red">1 (should be > 1)</span></td> </tr> <tr> <td>Read Type :</td> <td>Forward</td> <td>Reverse</td> </tr> </tbody> </table> <p>Read 2 composition</p> <table> <tbody> <tr> <td>Read Index :</td> <td>0</td> <td>1</td> <td>2</td> </tr> <tr> <td>Read :</td> <td>TCAG</td> <td>ATAGAGTTG………</td> <td>TCGTATAACTTCGTATAATGTATGCTATACGAAGTT</td> </tr> <tr> <td>Base Coordinate :</td> <td>1</td> <td>5</td> <td><span class="red">4 (should be > 5)</span></td> </tr> <tr> <td>Read Type :</td> <td>Adapter</td> <td>Forward</td> <td>Reverse</td> </tr> </tbody> </table> <p>Read 3 composition</p> <table> <tbody> <tr> <td>Read Index :</td> <td>0</td> <td>1</td> </tr> <tr> <td>Read :</td> <td>ATCCGGGTGTGTCATCAG</td> <td>CATCAG……………</td> </tr> <tr> <td>Base Coordinate :</td> <td><span class="red">2 (should start at 1)</span></td> <td>19</td> </tr> <tr> <td>Read Type :</td> <td>Adapter</td> <td>Forward</td> </tr> </tbody> </table> <h3 id="cannot_specified">Reads with relative order which cannot be specified</h3> <p>Read composition</p> <table> <tbody> <tr> <td>Read Index :</td> <td>0</td> <td>1</td> <td>2</td> <td>3</td> </tr> <tr> <td>Read :</td> <td>TCAG</td> <td>ATAGA……………</td> <td>…………………</td> <td>CTCAT…………………………………………………………</td> </tr> <tr> <td>Base Coordinate :</td> <td>1</td> <td>5</td> <td> </td> <td> </td> </tr> <tr> <td>Read Type :</td> <td>Adapter</td> <td>Forward</td> <td>Linker</td> <td>Forward <span class="red"> (This forward cannot be specified)</span></td> </tr> </tbody> </table> <p>Spot (Read Spec) metadata</p> <table> <thead> <tr> <th>Read Index</th> <th>Read Class</th> <th>Read Type</th> <th>Ordering Method</th> </tr> </thead> <tbody> <tr> <td>0</td> <td>Technical Read</td> <td>Adapter</td> <td>BaseCoord = 1</td> </tr> <tr> <td>1</td> <td>Application Read</td> <td>Forward</td> <td>BaseCoord = 5</td> </tr> <tr> <td>2</td> <td>Technical Read</td> <td>Linker</td> <td>RelativeOrder</td> </tr> <tr> <td>3</td> <td>Application Read</td> <td>Forward</td> <td>RelativeOrder</td> </tr> </tbody> </table> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Downloading files,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/read-number-fastq-e.html">Why is reads number of fastq less than that of SRA file?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-01-23 20:18:42 +0900">2014/01/23</time></li> <li class="tag-view" data-tag="Downloading files">Downloading files</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The DRA generates fastq files from the raw data SRA files by using the <a href="http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc&f=fastq-dump">fastq-dump</a> in the <a href="http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc">NCBI SRA Toolkit</a> with following options.</p> <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>fastq-dump -M 25 -E --skip-technical --split-3 -W <SRA file> </code></pre></div></div> <ul> <li>-M 25: Minimum read length to output is 25 (default is 25)</li></li> <li>-E: No sequences starting or ending with >= 10N</li></li> <li>–skip-technical: Dump only biological reads</li></li> <li>–split-3: Legacy 3-file splitting for mate-pairs: first and second biological reads satisfying dumping conditions are placed in files *_1.fastq and *_2.fastq, respectively. If only one biological read is present, it is placed in *.fastq.</li></li> <li>-W: Apply left and right clips</li></li> </ul> <p>Reads are filtered and trimmed according to above dumping conditions, reads number of fastq is generally less than that of SRA file.Users can generate unfiltered and untrimmed fastq files by using following fastq-dump options.</p> <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>fastq-dump -M 1 --split-3 <SRA file> </code></pre></div></div> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Downloading files,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-download-data-e.html">How do I access public DRA data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-01-23 20:21:04 +0900">2014/01/23</time></li> <li class="tag-view" data-tag="Downloading files">Downloading files</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>You can access the public DRA data through https/ftp and in the NIG supercomputer.<br /> You can retrieve the filepath by searching accession numbers in the <a href="https://ddbj.nig.ac.jp/search">DDBJ Search</a>.</p> <ul> <li>https: https://ddbj.nig.ac.jp/public/ddbj_database/dra</li> <li>ftp: ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra</li> <li>ascp: anonftp@ascp.ddbj.nig.ac.jp:/ddbj_database/dra</li> <li>Supercomputer: /usr/local/resources/dra</li> </ul> <h3 id="https">https</h3> <p>Access through your web browser.</p> <p>Examples: <br /> DRR000001 fastq</p> <ul> <li>https://ddbj.nig.ac.jp/public/ddbj_database/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001.fastq.bz2</li> <li>https://ddbj.nig.ac.jp/public/ddbj_database/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001_1.fastq.bz2</li> <li>https://ddbj.nig.ac.jp/public/ddbj_database/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001_2.fastq.bz2</li> </ul> <p>DRR000001 sra</p> <ul> <li>https://ddbj.nig.ac.jp/public/ddbj_database/dra/sra/ByExp/sra/DRX/DRX000/DRX000001/DRR000001/DRR000001.sra</li> </ul> <h3 id="ftp">ftp</h3> <p>Download files by wget etc.</p> <p>Examples:<br /> DRR000001 fastq</p> <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>wget ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001.fastq.bz2 wget ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001_1.fastq.bz2 wget ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001_2.fastq.bz2 </code></pre></div></div> <p>DRR000001 sra</p> <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>wget ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra/sra/ByExp/sra/DRX/DRX000/DRX000001/DRR000001/DRR000001.sra </code></pre></div></div> <h3 id="ascp">ascp</h3> <p><a href="https://sc.ddbj.nig.ac.jp/en/software/aspera/install_Aspera/">Installing Aspera</a> and install the aspera.<br /> To download data, please see <a href="https://sc.ddbj.nig.ac.jp/en/software/aspera/">How to use Aspera</a>.</p> <h3 id="sc">Supercomputer</h3> <p>You can direcly access the public data at /usr/local/resources/ in the <a href="https://sc.ddbj.nig.ac.jp/en/general_analysis_division/ga_introduction">General Analysis Section of the NIG supercomputer</a>.</p> <p>Examples: Copy DRR000001 fastq files to your home directory.</p> <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>cp /usr/local/resources/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001.fastq.bz2 ~/ cp /usr/local/resources/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001_1.fastq.bz2 ~/ cp /usr/local/resources/dra/fastq/DRA000/DRA000001/DRX000001/DRR000001_2.fastq.bz2 ~/ </code></pre></div></div> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,bioproject,biosample,ddbj,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/add-publication-e.html">How do I add reference information?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-01-23 20:22:22 +0900">2014/01/23</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="bioproject" title="BioProject">BioProject</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please provide the PubMed ID (recommended) or DOI as the paper information in the form below.</p> <table class="table_faq"> <thead> <tr> <th>Database</th> <th>Example of Accession</th> <th>Reference information section</th> <th>How to update</th> </tr> </thead> <tbody> <tr> <td>DDBJ</td> <td>AB12345678<br />ABCDEF010123456　</td> <td><a href="/ddbj/flat-file-e.ml#Reference2">Flat file</a></td> <td><a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Application Form for Data Update Requests form</a></td> </tr> <tr> <td>DRA</td> <td>DRR000001</td> <td>BioProject referenced by DRA</td> <td><a href="https://forms.gle/d9cZxyzQzxPMSqW59">BioProject/BioSample/DRA update request</a></td> </tr> <tr> <td>GEA</td> <td>E-GEAD-1</td> <td>GEA Metadata <a href="/gea/metadata.html#PubMed_ID">IDF</a><br />BioProject referenced by GEA</td> <td><a href="https://forms.gle/TtzttjjxShnJ1LxdA">GEA update request </a></td> </tr> <tr> <td>MetaboBank</td> <td>MTBKS1</td> <td>MetaboBank Metadata <a href="/metabobank/metadata.html#idf">IDF</a></td> <td><a href="https://forms.gle/5TAMFHAWmhjZTrny7">MeatboBank Update request</a></td> </tr> <tr> <td>BioProject</td> <td>PRJDB1</td> <td>BioProject</td> <td><a href="https://forms.gle/d9cZxyzQzxPMSqW59">BioProject/BioSample/DRA update request</a></td> </tr> <tr> <td>BioSample</td> <td>SAMD00000001</td> <td>Depend on the database where experimental <br />data obtained from samples is registered.</td> <td><a href="https://forms.gle/d9cZxyzQzxPMSqW59">BioProject/BioSample/DRA update request</a></td> </tr> </tbody> </table> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/citation-format-e.html">How should I cite DRA accession numbers in publications?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-04-12 03:01:17 +0900">2014/04/12</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please cite accession numbers according to instructions of submitting publications.</p> <p><strong>Example citation</strong><br /> Nucleotide sequence data reported are available in the DDBJ Sequenced Read Archive under the accession numbers DRXxxxxxx and DRXxxxxxx.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/paper-published-e.html">When our paper was published, what should I do?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-05-31 03:02:55 +0900">2014/05/31</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Contact us from <a href="/ddbj/update-form-e.html">this form</a> with “Our paper was published” in [Subject].</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Metadata,biosample,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/biosample-bioproject-sra-e.html">What is the relationship between BioSamples, SRA Experiments, Runs and my data files?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-05 02:01:19 +0900">2014/06/05</time></li> <li class="tag-view" data-tag="Metadata">Metadata</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>BioSample is descriptive information about the biological source materials, or samples, used to generate experimental data in any of primary data archives.<br /> Please see <a href="/biosample/overview-e.html#granularity">Sample granularity</a>.</p> <p>Each SRA <a href="/dra/metadata-e.html#Experiment">Experiment</a> is a unique sequencing library and sequencing method for a specific sample. Importantly, much of the descriptive information that is displayed in the public record of your data is captured at the level of the DRA Experiment.</p> <p>SRA <a href="/dra/metadata-e.html#Run">Runs</a> are simply a manifest of data file(s) that should be linked to a given sequencing library – no information present in the Run is displayed on the public record of your project.<br /> Note that all data files listed in a Run will be merged into a single SRA archive file (and fastq file for distribution).</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequencing data,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/what-is-md5-checksum-e.html">What is an MD5 checksum and how do I compute it?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-05 02:15:07 +0900">2014/06/05</time></li> <li class="tag-view" data-tag="Sequencing data">Sequencing data</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>MD5 checksums are used by DRA to verify integrity of transmitted data. <br /> MD5 checksum is a 32-character alphanumeric string (example: bf4ac50dcd58bd2860dfac48c7fca348).<br /> Please refer to the <a href="/checksum-e.html">this page</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cannot-find-appropriate-feature-e.html">Can not find appropriate feature key</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-09 20:30:42 +0900">2014/06/09</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/ddbj/features-e.html">Definition of Feature Key</a> and <a href="/ddbj/feature-table-e.html">Feature Table Definition</a>.<br /> When you can not find any accommodated feature, use <a href="/ddbj/features-e.html#misc_feature">misc_feature</a> and enter information in value of /<a href="/ddbj/qualifiers-e.html#note">note</a> qualifier.</p> <p>For instance, since DDBJ is a database for nucleotide sequences, we do not prepare any specific item for amino acid sequence motifs.<br /> However, you can describe such kind of information by using misc_feature with /note qualifier.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/update-request-from-not-submitter-e.html">Though I am not the submitter of the sequence data, can I correct the data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-09 20:57:29 +0900">2014/06/09</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>DDBJ only accepts update requests from <a href="/ddbj/submission.html#submitter">submitters</a> of the data except publication reference update. <br /> If you are not the submitter you will need permission from the submitter before requesting update. <br /> See <a href="/ddbj/submission-e.html#right">Rights and Duties of Submitter</a></p> <p>DDBJ can forward your comments to the submitter.</p> <p>Please <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact us</a> by selecting “Inquiry to the sequence submitters” . <br /> Please note that we can not guarantee any response from the submitter.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/data-confirm-before-hold-date-e.html">Before the hold date, how can we confirm contents of the DDBJ sequence data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 00:11:40 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>We only accept the request from <a href="/ddbj/submission-e.html#terms">the original submitter</a> of the entry.<br /> Please contact us from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a> by selecting the item, “Updating Submitted Data” with accession numbers.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/update-submitted-data-using-nsss-e.html">Can I update submitted data by using the DDBJ Nucleotide Sequence Submission System?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 00:21:05 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Because the <a href="/ddbj/web-submission-e.html">DDBJ Nucleotide Sequence Submission System</a> is for new submissions, you can not update submitted data. <br /> For update, see <a href="/ddbj/update-e.html">Data Updates/Corrections</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/lost-correspondence-e.html">I would like to know the correspondence of accession numbers and private sequences</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 01:23:52 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please contact us from <a href="/contact-ddbj-e.html">contact form</a> by selecting the item “Updating Submitted Data” with following items.</p> <ul> <li>E-mail address of contact person</li> <li>Accession numbers or EntryIDs</li> </ul> <p>We will answer about your data.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/paper-accepted-e.html">When our paper was accepted, what should I do?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 01:36:58 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Contact us from <a href="/ddbj/update-form-e.html">this form</a> with “Our paper was accepted” in [Subject].</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/postpone-hold-date-e.html">How to postpone the hold date?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 01:48:31 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Contact us from <a href="/ddbj/update-form-e.html">this form</a> by selecting “Change the hold-date” in [Subject].</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/change-contact-person-information-e.html">How to change the contact person, belonging, institution, etc..</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 01:56:06 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Contact us from <a href="/ddbj/update-form-e.html">this form</a> with “Change description about the contact person” in [Subject].</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/update-sequence-e.html">How to update our sequence?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 19:09:43 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please send your request to DDBJ with the following contents in clear English. <br /> To : <img src="/assets/images/news/ad_updt.gif" alt="ddbjupdt#64;ddbj.nig.ac.jp" title="ad_updt" width="180" height="19" class="alignnone size-full wp-image-1298" /></p> <ul> <li>Accession numbers:</li> <li>The modified part:</li> <li>Total base count:</li> <li>Other modified feature:</li> <li>Updated sequence in full length: Please use the following format. <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>>AB******1 aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc // >AB******2 aaaaaaaaaattttttttttggggggggggccccccccccaaaaaaaaaatttttttttt ggggggggggccccccccccaaaaaaaaaattttttttttggggggggggcccccccccc aaaaaaaaaat // </code></pre></div> </div> <ul> <li>Header line; starts with “>”, followed by the accession number at the head of each sequence.</li> <li>Sequence; each line must be 60 letters or less.</li> <li>End line; end flag, “//”, must be at the end of each sequence.</li> </ul> </li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Search,getentry"> <div class="upper"> <h2 class="title"> <a href="/faq/en/confirm-previous-version-data-e.html">Can I see history of the sequence record?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 19:18:00 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Search">Search</li> <li class="tag-view" data-tag="getentry" title="getentry">getentry</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>You can see revision history of the sequence record by using <a href="/services/getentry-e.html#gethistory">gethistory</a>. Please see <a href="/services/getentry-e.html">getentry HELP</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-update-many-entries-e.html">How to update many entries with a number of corrections?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 19:20:34 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If you are making update request for large number of entries, or many changes of features/locations/qualifiers due to sequence modification, see followings.</p> <dl> <dt>(1) Update information is in common of all entries.</dt> <dd>Example: change reference or submitters information, postpone the hold-date, etc..</dd> </dl> <p>In principle, send your request via <a href="/ddbj/update-form-e.html">Application Form for Data Update Requests</a></p> <dl> <dt>(2) Contents of corrections are different among entries.</dt> <dd>Example: change each clone or gene name of all entries, etc..</dd> <dt>(3) Extensive correction of data</dt> <dd>Example: change more than 30 features due to the sequence update, etc..</dd> </dl> <p>In case of (2) or (3), we would like to know the number of entries, the correction item, etc. to specify the file format for your request. <br /> Contact us in advance from <a href="/contact-ddbj-e.html#to-ddbj">contact form</a>. <br /> In general, we handle update requests within several days but for a large number of entries, it might take us time in updating the data. <br /> Be sure to contact us beforehand when you request the release of data which accompanies correction.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/paper-show-referee-e.html">On the process of submission of a paper to a journal, we have to show the referee our nucleotide sequence submitted as "Hold-Until-Published" status...</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-10 19:51:31 +0900">2014/06/10</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>DDBJ does not provide any procedure for a limited disclosure by the password authentication or else. <br /> When you have to show your sequence data submitted with “Hold-Until-Published” status for only particular individuals, you can send as a text file including your sequences to them. <br /> If the referee wish to confirm the condition and/or the descriptions of your sequence submission, you can choose either of the following two procedures;</p> <dl> <dt>a) Publish your sequences through DDBJ.</dt> <dd>If you do not mind to open your sequences to the public, please send us your request to publicize your submitted sequences with all of accession numbers.</dd> <dt>b) Send DDBJ flat files of your submission to the referee, directly</dt> <dd>When the submitter requests to us, we send the text file including DDBJ flat files to the submitter. So, please send us your request with all of accession numbers to get DDBJ flat file(s) of your submission. Then, you can forward the text file to the referee.</dd> </dl> <p>Contact us from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a>, if necessary.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Search,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/why-retracted-data-available-e.html">Why is the retracted data still available?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-13 23:33:41 +0900">2014/06/13</time></li> <li class="tag-view" data-tag="Search">Search</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>For once published entries, we can restrict to use the data, if the conditions are <a href="/faq/en/restore-released-data-private-e.html">right</a>. <br /> In case of the restriction, DDBJ will not include the data in its periodical release and remove from all services under DDBJ. <br /> However, the data is permanently available on <a href="http://getentry.ddbj.nig.ac.jp/top-e.html">getentry</a> queried with its accession number. <br /> ※ The rule is not applied, when the data is published by any mistake of INSD. <br /> This policy is written in the document prepared by <a href="/about/insdc-e.html#iac">International Advisory Committee</a> of INSD on <a href="/about/insdc-e.html#policy">Overview of International Nucleotide Sequence Databases Policies</a> as follows;</p> <hr /> <p>All database records submitted to the INSD will remain an entry accessible as part of the scientific record. Corrections of errors and update of the records by authors are welcome and erroneous records may be removed from the next database release, but all will remain permanently accessible by accession number.</p> <hr /> <p>In addition, there are a number of databases constructed by occasionally using data from INSD. <br /> DDBJ can not support to delete data from such databases. If you are to delete the cited data on other databases, you have to contact managing staff of each database, directly.</p> <dl> <dt>Reference</dt> <dd><a href="/about/insdc-status-e">INSDC Status Document</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/hold-updated-version-e.html">When updating published sequence data, can I hold updated version in the mean time?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-14 01:44:23 +0900">2014/06/14</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>DDBJ does not accept any reservation for updating sequence data.<br /> Therefore, in case of updating published data, the data will be immediately re-distributed after update.</p> <p>Please select either of following ways.</p> <ul> <li>In this time, canceling the request for update, when you can publish updated data, contact us again.</li> <li>Submit the updated data as a new data with <a href="/ddbj/submission.html#holddate">hold date</a>. When the new data is published, the accession number of the old data will become a secondary accession number for the new data.<br /> # Please inform us during submitting the new data to link it to the old data.</li> </ul>  <dl> <dt>Reference</dt> <dd><a href="/ddbj/flat-file-e.html">Explanation of DDBJ flat file format</a>: <a href="/ddbj/flat-file-e.html#AccessionB">ACCESSION</a></dd> <dd><a href="https://www.insdc.org/submitting-standards/insdc-status-document/">INSDC Status Document</a>: Replaced</dd> <dd><a href="/faq/en/secondary-accession-number-e.html">What is secondary accession number?</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/restore-released-data-private-e.html">How to restore the released data to private?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-14 02:20:30 +0900">2014/06/14</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <h2 id="ddbj">DDBJ</h2> <p>In principle, DDBJ can not restore any published data. <br /> See also following item about access restriction.</p> <p>In principle, you cannot remove your sequence data from DDBJ retrieval system: <a href="http://getentry.ddbj.nig.ac.jp/top-e.html">getentry</a>, if it has already been open to the public (If DDBJ wrongly published your data because of any mistakes, the data should be removed as soon as possible.).</p> <p>However, if there is some specific reason for removing your sequence data (i.e. some error is found, etc.), we can restrict access to your sequence data.</p> <p>Please send your request from <a href="/contact-ddbj-e.html#to-ddbj">contact form</a> with the following contents.</p> <ul> <li>Accession numbers:</li> <li>Reason in brief:</li> <li>New hold-date: (e.g. 2019/06/25)</li> </ul> <p>If we restrict access to your sequence data and remove it from the public view, then it will no longer be included in homology search services at DDBJ or distributed as a part of the next DDBJ periodical release. However, it may remain in other third party databases, and will still be retrievable in <a href="http://getentry.ddbj.nig.ac.jp/top-e.html">getentry</a> by accession number based queries.</p> <p>Moreover, our unified database may be copied and redistributed without permission at any other organizations. In case you need to withdraw your entry from such database, we ask you to make request directly to the organization which manages the database.</p> <dl> <dt>References</dt> <dd><a href="/faq/en/why-retracted-data-available-e.html">Why is the retracted data still available?</a></dd> <dd><a href="/about/insdc-status-e">INSDC Status Document</a></dd> </dl> <h2 id="dra">DRA</h2> <p>The DRA data are also removed as DDBJ. <br /> <a href="https://forms.gle/d9cZxyzQzxPMSqW59">Contact the DRA team</a> to delete public DRA data.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/delete-data-e.html">How to delete my data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-14 03:20:06 +0900">2014/06/14</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In principle, following two conditions are required to delete your sequence data;</p> <ol> <li>The sequence data has not yet been publicized</li> <li>The accession number of the data has not yet been <a href="/documents/data-release-policy-e.html">published</a>.</li> </ol> <p>Please send your request from <a href="/contact-ddbj-e.html">contact form</a> with the following contents in clear English.</p> <ul> <li>Accession numbers:</li> <li>Reason in brief:</li> </ul> <p>Just for information, we can restrict access to your sequence data that have been open to the public, <a href="/faq/en/restore-released-data-private-e.html">if the conditions are right</a>.<br /> See also the following item.</p> <dl> <dt>References</dt> <dd><a href="/faq/en/restore-released-data-private-e.html">How to restore the released data to private?</a></dd> <dd><a href="/faq/en/why-retracted-data-available-e.html">Why is the retracted data still available?</a></dd> <dd><a href="/about/insdc-status-e">INSDC Status Document</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cannot-find-accession-number-cited-paper-e.html">Can not find the sequence data, though the accession number cited on a paper.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-16 20:19:30 +0900">2014/06/16</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>DDBJ releases sequence data submitted with a <a href="/ddbj/submission-e.html#holddate">hold date</a> according to <a href="/documents/data-release-policy-e.html">Principle of “Hold-Until-Published” data release</a>.</p> <p>Please confirm if the ID on the paper is <a href="/documents/accessions-e.html">Accession Number Assigned by INSD</a> or not.</p> <p>If accession numbers on the paper, please contact us from <a href="/contact-ddbj-e.html">contact form</a> by selecting the item, “Updating Submitted Data” with following items.</p> <ul> <li>Accession numbers on the paper</li> <li>Title of the paper</li> <li>Authors</li> <li>Journal name</li> <li>Volume, pages, year</li> <li>DOI, PubMed ID, URL</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Search,getentry"> <div class="upper"> <h2 class="title"> <a href="/faq/en/what-is-search-service-latest-data-available-e.html">What is the search service that the latest data are available at the earliest period?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-16 20:34:25 +0900">2014/06/16</time></li> <li class="tag-view" data-tag="Search">Search</li> <li class="tag-view" data-tag="getentry" title="getentry">getentry</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>It is <a href="http://getentry.ddbj.nig.ac.jp/top-e.html">getentry</a>. <br /> “getentry” is a system for data retrieval by accession numbers, etc. <br /> In general, the sequence data will be available on getentry from the day after processed to release.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/ddbj-acceptable-data-e.html">What kinds of data are acceptable at DDBJ?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-16 23:57:52 +0900">2014/06/16</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/submission-e.html">Databases and Data Submission Systems</a> and <a href="/documents/data-categories-e.html">Categories for Sequence Data</a>.</p> <p>If you are not sure to which category your sequence data should be submitted, use <a href="/submission-navigation-e.html">Submission navigation</a>. <br /> See the following sites for detail and relationships of data types.</p> <ul> <li><a href="/ddbj/genome-e.html">Data Submission from Genome Project</a></li> <li><a href="/ddbj/transcriptome-e.html">Data Submission from Transcriptome Project</a></li> <li><a href="/ddbj/flat-file-e.html#DivisionB">Division</a></li> <li><a href="/documents/data-categories-e.html#detail">Categories of Annotated/Assembled Data</a></li> </ul> <p>If you still have any question, please contact us from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-submit-previously-reported-seq-e.html">How to submit only annotation for previously reported sequences?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-17 00:41:10 +0900">2014/06/17</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If your annotation meets the requirements of <a href="/ddbj/tpa-table-e.html">TPA Submission Guidelines</a>, DDBJ can accept it as <a href="/ddbj/tpa-e.html">TPA (Third Party Data)</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-submit-seq-with-annotation-e.html">How to submit sequence data with annotation to DDBJ?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-17 01:05:27 +0900">2014/06/17</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Select from following two ways.</p> <ul> <li><a href="/ddbj/web-submission-e.html">DDBJ Nucleotide Sequence Submission System</a> (NSSS): an interactive application to enter all of items via web form</li> <li><a href="/ddbj/mss-e.html">Mass Submission System</a> (MSS): to send submission files to DDBJ, directly</li> </ul> <p>In general, we recommend to use NSSS. <br /> However, since NSSS can not accept all types of sequence data, it may be required to use MSS for your data submission.<br /> See <a href="/ddbj/submission-e.html#workflow">Workflow of the data submission to DDBJ</a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-submit-amino-acid-seq-e.html">How to submit amino acid sequences?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-17 01:22:17 +0900">2014/06/17</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In general, you can submit amino acid sequences by describing <a href="/ddbj/cds-e.html">CDS feature</a> for your nucleotide sequences. <br /> However, DDBJ does not accept amino acid sequences only, i.e. without any nucleotide sequences. <br /> In that case, please submit to <a href="http://www.uniprot.org/">UniProt</a>, directly. <br /> You can submit amino acid sequences to UniProt through <a href="https://www.ebi.ac.uk/swissprot/Submissions/spin/account/login">SPIN</a>. <br /> Please contact to datasubs@ebi.ac.uk.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-submit-assembled-est-e.html">How to submit assembled EST sequences?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-17 01:59:44 +0900">2014/06/17</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>DDBJ can not accept only assembled EST sequences. However, DDBJ can accept EST assembled sequences as <a href="/ddbj/tsa-e.html">TSA</a> with original (i.e. before assemble) sequence data. See also <a href="/ddbj/transcriptome-e.html">Data Submission form Transcriptome Project</a>. <br /> When original sequence data (primary entries) are generated from Next Generation Sequencers, submit to <a href="/dra/index-e.html">DDBJ sequence Read Archive (DRA)</a>, from traditional sequencers, submit as <a href="/ddbj/est-e.html">EST</a> via <a href="/ddbj/mss-e.html">Mass Submission System (MSS)</a>. <br /> Then, DDBJ can accept assembled sequences (both <em>de novo</em> and reference mapping) as TSA through MSS.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/organism-name-not-identified-not-defind-e.html">How to describe organism name, if the species is not identified or not defined?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-17 02:18:24 +0900">2014/06/17</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/ddbj/organism-e.html">Organism qualifier</a>. <br /> For detail, see either of following cases;</p> <p><a href="/ddbj/organism-e.html#unidentified">2. In case of unidentified species names, proposing a new species etc.</a> <br /> <a href="/ddbj/organism-e.html#env">3. environmental sample</a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-submit-seq-from-soil-sea-water-e.html">How to submit sequence data directly obtained from soil or sea water?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-17 02:38:00 +0900">2014/06/17</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In cases of sequences derived by direct molecular isolation from soil, sea water, etc. i.e. a bulk environmental DNA sample by PCR with or without subsequent cloning of the product, DGGE, or other anonymous methods, see <a href="/ddbj/env-e.html">What is ENV ? – environmental samples</a>. <br /> For description of <a href="/ddbj/organism-e.html">organism qualifier</a>, see <a href="/ddbj/organism-e.html#env">3. Environmental samples</a>.</p> <p>Though frequently confused, <span style="color: #ff0000; font-weight:bold">the term, ‘environmental samples’, does NOT mean “wild type”. </span> If sequences are derived from isolated or cultured organisms, the sequence data are not classified into environmental samples.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/organism-name-artificially-constructed-seq-e.html">How to describe organism name for artificially constructed sequence?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-17 02:44:11 +0900">2014/06/17</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>For description of <a href="/ddbj/organism-e.html">organism qualifier</a>, see <a href="/ddbj/organism-e.html#syn">4. Artificially constructed sequences</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-describe-evidence-speculation-feature-e.html">How to describe the evidence of speculation for the feature?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-17 02:54:32 +0900">2014/06/17</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>You can use <a href="/ddbj/qualifiers-e.html#experiment">experiment</a> or <a href="/ddbj/qualifiers-e.html#inference">inference</a> qualifier to describe evidence of speculation in each feature.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/offprint-related-seq-data-e.html">Should we send offprint related to our sequence data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-19 00:16:16 +0900">2014/06/19</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Generally, DDBJ do not need any offprint to process your data. <br /> Occasionally, DDBJ may contact the submitter of sequence data to ask sending an offprint, if necessary.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Use,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/ddbj-cited-article-e.html">We would like to cite the article of DDBJ.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-19 01:07:48 +0900">2014/06/19</time></li> <li class="tag-view" data-tag="Use">Use</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>When you kindly describe about using DDBJ on academic papers etc., in general, please use <a href="/services/references-e.html">the latest article for DDBJ</a> on Nucleic Acids Res. Database issue as a reference.</p> <p>However, please note followings.</p> <dl> <dt>In case of citation for each sequence record</dt> <dd>In general, it is enough to describe <a href="/documents/accessions.html">accession number</a> for it in your publication. <br /> If you discuss about the data in detail, please use <a href="/ddbj/submission.html#pcite">primary citation</a> for the data as a reference. In case of citation for each service provided at DDBJ</dd> <dd>In general, please use <a href="/services/references-e.html">original article for each service</a> as a reference.</dd> </dl>  <dl> <dt>References:</dt> <dd><a href="/faq/en/acknowledge-ddbj-e.html">We would like to acknowledge DDBJ in our publication.</a></dd> <dd><a href="/faq/en/acknowledge-nig-supercomputer-e.html">We would like to acknowledge the NIG Supercomputer System in our publication.</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/submit-both-genomic-mrna-seq-same-gene-e.html">Should we submit both genomic and mRNA sequences of the same gene to DDBJ?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-19 02:18:20 +0900">2014/06/19</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Basically, please submit every sequence that you have experimentally determined, whatever the resource of genome, mRNA or any others. <br /> In principle, DDBJ accepts submission of experimentally determined sequence in its contiguous structure. <br /> You can describe mRNA feature, CDS feature and so on as annotation for genomic sequence, however, descriptions of mRNA features do not mean “the mRNA sequence is experimentally determined.”, in general. <br /> If you have read mRNA sequences, please submit mRNA sequences to DDBJ. See also <a href="/documents/data-categories-e.html">Acceptable data for DDBJ</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/submit-seq-without-published-paper-e.html">Can I submit seuqence data without any published paper, during writing or in press?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-20 00:33:19 +0900">2014/06/20</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Yes you can. It ought to be required at ‘instructions to authors’ of most of journals to submit sequence data to DDBJ (, EMBL-Bank or GanBank) before the paper submission. <br /> During submission of sequence data, select status for your REFERENCE as follows.</p> <ul> <li>“Unpublished”; In cases of preparing paper, during paper submission, or you do not prepare any publication.</li> <li>“In Press”; When your paper is accepted and in press.</li> </ul> <p>Your citations will be appeared at <a href="/ddbj/flat-file-e.html#Reference2B">REFERENCE 2</a> or after on <a href="/ddbj/flat-file-e.html">DDBJ flat file</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/no-plan-paper-publication-how-describe-reference-e.html">When we have no plan to paper publication, how to describe REFERENCE?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-20 02:02:08 +0900">2014/06/20</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Regardless you are to publish academic paper or not, DDBJ accepts your submission of sequence data. <br /> If you have no plan to paper publication, you have to fill following items of REFERENCE.</p> <ul> <li>status: [Unpublished]</li> <li>year: tentative year (this year), i.e. 2014</li> <li>title: tentative title to explain your data</li> <li>ab_name (authors): abbreviation of tentative author(s) (often the same as ab_name of SUBMITTER)</li> </ul> <p>When you change your plan after sequence data submission, i.e. if you publish a paper, contact us from <a href="/ddbj/update-form-e.html">this form</a> to send request with subject “Our paper was published”.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/journal-has-no-requirement-submit-seq-e.html">Do we have to submit sequence data to DDBJ, when the journal has no requirement to do so?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-20 02:38:01 +0900">2014/06/20</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Though there is no requirement to submit sequence data to DDBJ (, EMBL-Bank or GenBank) on the journal, we strongly recommend to submit sequence data to DDBJ for improvement of data availability for readers of your paper.</p> <dl> <dt>References</dt> <dd><a href="/ddbj/submission.html#responsibility">Before Nucleotide Sequence Submission</a></dd> <dd><a href="/ddbj/submission.html">Nucleotide Sequence Submission</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/only-one-submitter-e.html">Is it OK to submit sequence data by only one submitter?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-20 02:51:07 +0900">2014/06/20</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>DDBJ accepts updating requests only from the original submitter of the entry. <br /> Basically, we strongly recommend to describe joint submitters more than two persons, e.g. at least a true worker and an adviser, to avoid lost communication in future.</p> <p>See <a href="/ddbj/submission.html#item">Required items for nucleotide sequence submission</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/submt-seq-to-genbank-e.html">Should I submit sequence data to GenBank?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-20 03:18:48 +0900">2014/06/20</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>When sequence data are published, the data will be shared among DDBJ, EMBL-Bank and GenBank. So, it is necessary and sufficient to submit sequence data to either of three data banks only once. <br /> If you submit sequence data to GenBank after submission of the same data to DDBJ, the data will be duplicated. So, do not submit the same data to two or more data banks.</p> <p>Though some journals instruct to authors to submit sequence data to GenBank, <a href="/documents/accessions.html">Accession Number</a> is commonly used by all of DDBJ, EMBL-Bank and GenBank to construct <a href="/about/insdc-e.html">INSD</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/submit-seq-related-patent-application-e.html">Can we submit sequence data related to patent application?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-20 03:54:39 +0900">2014/06/20</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Nucleotide sequence data related to patent applications are transferred from Japan Patent Office to DDBJ. <br /> So, usually, you do not have to submit such sequence data to DDBJ.</p> <p>However, if you apply to any other Patent Office, or if you need to publish a paper during patent application, confirm at Patent Office whether you can submit the data to DDBJ or not.</p> <p>Note that when the sequence data is published from DDBJ, the data becomes a part of the public domain, as “official notice”.</p> <dl> <dt>References</dt> <dd> <ul> <li><a href="/ddbj/patent-data-e.html">Sequence data included in patent applications</a></li> <li><a href="/policies-e.html#ownership">Patent, Intellectual Property and Priority</a></li> <li><a href="/activities/patent-e.html">Patent column from DDBJ</a></li> </ul> </dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/priorities-for-data-e.html">If I submit sequence data to DDBJ, can I get priorities for the data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-26 20:06:58 +0900">2014/06/26</time></li> <li class="tag-view" data-tag="submission">submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If you submit nucleotide sequence data to DDBJ, you can get <font color="#ff0000">NO priority</font> for the data. <br /> DDBJ takes no responsibility for any property or priority issues for patenting. For patent application, you should confirm <a href="http://www.jpo.go.jp/indexj.htm">JPO</a> or some other Patent Offices.</p> <p>References: <a href="/policies-e.html#ownership">Patent, Intellectual Property and Priority</a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/gene-protein-names-becom-official-e.html">If I submit sequence data with gene and protein names, will the names become official?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-26 20:32:51 +0900">2014/06/26</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>DDBJ does not have any right for the gene nomenclature. Also, DDBJ does not make any official collaboration with any committee of gene nomenclature. If there is no particular incident, the descriptions related to gene nomenclature are described as provided by submitter.<br /> Even if you name a gene during your sequence data submission to DDBJ, there is no guarantee that the gene name is accepted at research communities.</p> <dl> <dt>References</dt> <dd><a href="/ddbj/cds-e.html#product">Gene nomenclature at DDBJ</a></dd> <dd><a href="/policies-e.html#priority">Patent Priority and Other Priority</a></dd> </dl> <p>You should confirm each gene nomenclature committee, i.e. <a href="http://www.genenames.org/">HUGO Gene Nomenclature Committee (HGNC)</a> for human, <a href="http://www.informatics.jax.org/mgihome/nomen/index.shtml#mnrg">MGI - Mouse Nomenclature</a> for mouse, and so on.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-submit-dna-polymorphism-e.html">How to submit sequence data related to DNA polymorphism?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-26 20:36:24 +0900">2014/06/26</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/ddbj/representative-sequence-e.html">Representative submissions of identical sequences for variation studies</a>.</p> <dl> <dt>References</dt> <dd><a href="/faq/en/where-to-submit-variation-data-e.html">Where to submit variation data, such as single nucleotide variations, structural variations, copy number variations (CNVs) and so on?</a></dd> <dd><a href="/faq/en/submit-snp-reflect-dbsnp-e.html">After submission of SNP data to DDBJ, will it automatically reflect to dbSNP?</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-describe-a-base-substitution-e.html">How to describe a base substitution that causes an amino acid substitution?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-06-26 20:46:26 +0900">2014/06/26</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In general, you can describe base substitutions by using <a href="/ddbj/features-e.html#variation">variation</a> feature with <a href="/ddbj/qualifiers-e.html#replace">replace</a> and <a href="/ddbj/qualifiers-e.html#note">note</a> qualifiers.<br /> In case of using DDBJ Nucleotide Sequence Submission System, select ‘other’ for template.<br /> About format of feature annotation, see <a href="/ddbj/example-e.html#F01">F01) polymorphism and variation</a> at <a href="/ddbj/example-e.html">Example of Submission</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/submit-snp-reflect-dbsnp-e.html">After submission of SNP data to DDBJ, will it automatically reflect to dbSNP?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-01 01:02:54 +0900">2014/07/01</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Though you can submit sequence data including SNP (Single Nucleotide Polymorphisms) to DDBJ, the data will not automatically reflect to dbSNP. <br /> <a href="http://www.ncbi.nlm.nih.gov/SNP/">dbSNP</a> is an independent database from <a href="/about/insdc-e.html">INSDC</a>, operated by NCBI. <br /> For SNP data, we recommend you to submit to dbSNP.</p> <p>In case of submission to DDBJ, see format of feature annotation at <a href="/ddbj/example-e.html#F">F: Variation</a> on <a href="/ddbj/example-e.html">Example of Submission</a>.</p> <dl> <dt>References</dt> <dd> <ul> <li><a href="/faq/en/where-to-submit-variation-data-e.html">Where to submit variation data, such as single nucleotide variations, structural variations, copy number variations (CNVs) and so on?</a></li> <li><a href="/faq/en/how-to-submit-dna-polymorphism-e.html">How to submit sequence data related to DNA polymorphism?</a></li> </ul> </dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-describe-location-circular-genome-e.html">In a circular genome, when a feature is located in the base range joined from the last base to the first base, how to describe the location of the feature?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-01 01:22:10 +0900">2014/07/01</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>For instance, when the length of sequence is 199035 bp and a CDS feature is located in the range from 199001 to 100, you should describe the location of CDS feature as<br /> join(199001..199035,1..100)<br /> See also <a href="/ddbj/location-e.html">Description of Location</a> in detail.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/complete-seq-annotation-required-e.html">To submit a complete sequence of a genome, are annotation data for the genome required?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-01 01:34:49 +0900">2014/07/01</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>As feature annotation, we strongly recommend you to describe <a href="/ddbj/cds-e.html">CDS (protein-coding sequence)</a>，<a href="/ddbj/features-e.html#rRNA">rRNA</a>，<a href="/ddbj/features-e.html#tRNA">tRNA</a> and so on.<br /> Please inform us in detail, when you apply to <a href="/ddbj/mss-e.html">Mass Submission System</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-describe-not-standard-genetic-code-e.html">When the correspondences between nucleotides and amino acids are different from the standard genetic code, how to describe CDS feature?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-01 02:21:44 +0900">2014/07/01</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>At first, please confirm whether <a href="/ddbj/geneticcode-e.html">The Genetic Code</a> is appropriately selected or not.<br /> Generally, if <a href="/ddbj/qualifiers-e.html#transl_table">/transl_table</a> qualifier is appropriately described with a number of the genetic code, the nucleotide sequence is automatically translated to amino acid sequence according to the genetic code.</p> <p>In exceptional cases of specific codons (selenocysteine etc.) that is not followed the genetic codes, describe /<a href="/ddbj/qualifiers-e.html#transl_except">transl_except</a> qualifier, appropriately.</p> <p>In cases of <a href="/ddbj/example-e.html#B09">RNA editing，</a><a href="/ddbj/example-e.html#B10">ribosomal frameshift</a>，<a href="/ddbj/example-e.html#B11">mitochondrial TAA stop codon</a>, see <a href="/ddbj/example-e.html">Example of submission</a> and describe with /<a href="/ddbj/qualifiers-e.html#exception">exception</a> and /<a href="/ddbj/qualifiers-e.html#translation">translation</a>, /<a href="/ddbj/qualifiers-e.html#ribosomal_slippage">ribosomal_slippage</a>, /<a href="/ddbj/qualifiers-e.html#transl_except">transl_except</a>, respectively.</p> <p>In case of rare initiation of translation, staring with an amino acid other than methionine, describe the <a href="/ddbj/location-e.html">location</a> of CDS feature with starting from “<”, operatively indicating 5’end not complete. And describe brief explanation about the translation mechanism in /<a href="/ddbj/qualifiers-e.html#note">note</a> qualifier.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/who-should-be-contact-person-e.html">Who should be the Contact person?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-01 03:09:30 +0900">2014/07/01</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/ddbj/submission.html#contact">Contact person</a>. <br /> If your affiliation was changed after sequencing or when you belong two or more institutes, please describe the most responsible one as a representative.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/submitter-author-first-name-only-e.html">How to describe a submiter or an author who has first name only?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-01 03:41:35 +0900">2014/07/01</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <dl> <dt>In case of Mass Submission System</dt> <dd>Describe first name, only. <br /> Though some warning will be outputted, please ignore them.</dd> <dt>In case of Nucleotide Sequence Submission System</dt> <dd>Please enter first name with some dummy initial. <br /> Please inform us about the person with “Submission Information” on <a href="/ddbj/web-submission-help-e.html#flow-7a">Final confirmation screen</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Contact form,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-contact-submitter-e.html">How to contact the submitter of sequence data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-01 03:58:53 +0900">2014/07/01</time></li> <li class="tag-view" data-tag="Contact form">Contact form</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Since 2007, we have <a href="/ddbj/flat-file-e.html#submitter-info">removed E-mail addresses and phone numbers from sequence data</a>.<br /> If you can find a related paper at <a href="/ddbj/flat-file-e.html#Reference2B">REFERENCE</a> on <a href="/ddbj/flat-file-e.html">DDBJ flat file</a>, contact information would be available on the paper.<br /> When you wishes to contact to the submitter(s) of an entry of your interest, please select “Inquiry to the sequence submitters” in <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a> with reasons briefly, then we will forward your message to the submitter(s).</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/accession-number-not-received-e.html">I have not yet received accession number, how many days does it take to get accession number?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 01:13:15 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>We cannot answer necessary days to issue accession number(s) because it depends on the contents of your submission.<br /> If you do not receive any email from DDBJ after 5 working days, please contact us from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a>.</p> <p>Please make sure <a href="/precautions-e.html">not to block E-mails from DDBJ</a>.</p> <h3 id="ddbj">DDBJ</h3> <p>In case of using <a href="/ddbj/web-submission-e.html">DDBJ Nucleotide Sequence Submission System</a>, please confirm whether you have received a mail from DDBJ with “DDBJ: Web submission completed” in its subject or not. This mail is automatically sent to contact person, when DDBJ accepts your sequence data via Nucleotide Sequence Submission System.</p> <dl> <dt>If you have NOT received the mail,</dt> <dd>your submission is not yet finished, so, please complete your submission.</dd> <dt>If you have received the mail,</dt> <dd>please contact us from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a> with contact person E-mail address and Submission ID of your data.</dd> </dl> <h3 id="dra">DRA</h3> <p>Login D-way and check the status of <a href="/dra/submission-e.html#status">your DRA submission</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/reject-submission-e.html">Is there any case to reject submission to DDBJ?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 01:22:45 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/documents/data-categories-e.html#accept">Acceptable data for DDBJ</a> and <a href="/ddbj/sequence-e.html#not_acceptable">Not acceptable sequences</a>. <br /> If you have any question, please contact us from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a>.</p> <p>Reference: <a href="/faq/en/restricton-seq-length-e.html">Is there any restriction of sequence length to submit to DDBJ?</a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/lost-accession-number-e.html">I lost my accession number</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 01:50:54 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If you have specific ID for your data other than accession number, such as EntryID or any, contact us from <a href="/contact-ddbj-e.html#to-ddbj">contact form</a> with ID and E-mail address of <a href="/ddbj/submission.html#contact">contact person</a>. <br /> In case of uncertain, tell us following items as far as you know, then we will search your data.</p> <ul> <li>Your name</li> <li>Your affiliation at the time of submission</li> <li>Your current affiliation</li> <li>Your mail address at the time of submission</li> <li>Your current mail address</li> <li>The date, month and/or year, when you submit your data</li> <li>Tool that you used to submit your sequence</li> <li>Your sequence(s) (if many, just a few representatives)</li> <li>Biological feature of your sequence</li> </ul> <p>When we can not find your data, we will ask you to submit your data as new one.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/describe-acc-number-on-adademic-paper-e.html">How to describe accession numbers on the academic paper?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 02:01:45 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In general, see the rule of the journal (i.e. Instructions to Authors), and follow it.</p> <p>At <a href="/about/insdc-e.html">INSDC</a>, we recommend you to describe accession numbers in the footnote on the title page of your paper as following; <br /> Note: Nucleotide sequence data reported are available in the DDBJ/EMBL/GenBank databases under the accession number(s)—-‘.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="format,search,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/what-is-date-locus-line-e.html">What is the date in LOCUS line?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 02:13:41 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="format">format</li> <li class="tag-view" data-tag="search">search</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>It is the date of the last release of the data. <br /> See <a href="/ddbj/flat-file-e.html#LocusB">LOCUS</a> of <a href="/ddbj/flat-file-e.html">Explanation of DDBJ flat file format</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="search,submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/what-is-direct-submission-ref-1-e.html">What is "Direct Submission" in TITLE of REFERENCE 1?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 02:26:45 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="search">search</li> <li class="tag-view" data-tag="submission">submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>It indicates that this data is directly submitted from the submitter. The term is the antonym to “journal scan”. <br /> <a href="/ddbj/flat-file-e.html#Reference1B">REFERENCE 1</a> is the information of submitter(s), not general reference. <br /> So, do not describe “Direct Submission” in the title for literature in <a href="/ddbj/flat-file-e.html#Reference2B">REFERENCE 2</a> or after.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/reference-feature-qualifier-e.html">Is there any reference for Feature/Qualifier?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 02:32:00 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See followings.</p> <ul> <li><a href="/ddbj/feature-table-e.html">The DDBJ/EMBL/GenBank Feature Table Definition</a></li> <li><a href="/ddbj/features-e.html">Definition of Feature Key</a></li> <li><a href="/ddbj/qualifiers-e.html">Definition of Qualifier Key</a></li> <li><a href="/ddbj/example-e.html">Example of Submission</a></li> <li><a href="/ddbj/features-e.html#usage">Feature/Qualifier Usage Matrix</a></li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data,release,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/announcement-from-ddbj-e.html">When the data submitted with hold date is published, is there any announcement from DDBJ?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 03:17:20 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="Data">Data</li> <li class="tag-view" data-tag="release">release</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If you set <a href="/ddbj/submission-e.html#holddate">the hold date</a> for your data, the data will be published according to <a href="/documents/data-release-policy-e.html">Principle of “Hold-Until-Published” data release</a>.<br /> After setting to publish the data, the mail with “[DDBJ] Publicized your data” in its subject is sent to <a href="/ddbj/submission.html#contact">contact person</a>.<br /> So, <a href="/precautions-e.html">Do not block E-mails from DDBJ</a>.</p> <p>If the information of contact person is old or invalid, we may be unable to acknowledge publication of your data or any other important announcement.<br /> Contact us from <a href="/ddbj/update-form-e.html">this form</a> to send request by selecting the subject, “Change the contact person, belonging, institution, etc..”.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data release,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/release-unpublished-data-e.html">Tell us conditions to release unpublished data.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 03:23:31 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="Data release">Data release</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/documents/data-release-policy-e.html">Principle of “Hold-Until-Published” data release</a> and <a href="/about/insdc-e.html#policy">Overview of International Nucleotide Sequence Databases Policies</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="format,search,submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/date-when-data-submitted-e.html">I would like to know the date when the data was submitted.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-02 03:44:41 +0900">2014/07/02</time></li> <li class="tag-view" data-tag="format">format</li> <li class="tag-view" data-tag="search">search</li> <li class="tag-view" data-tag="submission">submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In general, you can find <a href="/ddbj/submission-e.html#acceptdate">accept date</a> in JOURNAL line of <a href="/ddbj/flat-file-e.html#Reference1B">REFERENCE 1</a> on <a href="/ddbj/flat-file-e.html">DDBJ flat file</a>.<br /> Please note that some old data do not have the description of accept date.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Search,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cannot-find-data-already-published-e.html">I can not find sequence data that should be published.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-03 19:48:53 +0900">2014/07/03</time></li> <li class="tag-view" data-tag="Search">Search</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>There are some possibilities as followings.</p> <ol> <li>In case of the meantime of data distribution: <br /> The data may be on the process of data distribution. If you are unable to retrieve the data longer than a week, please send us an inquiry including the accession number from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a>.</li> <li>The specified <a href="/ddbj/submission-e.html#holddate">hold date</a> of the data is in <a href="/ddbj/submission-e.html#working-day">holidays of DDBJ</a>: <br /> We will release the data after <a href="/ddbj/submission-e.html#working-day">holidays of DDBJ</a>. See also DDBJ Calender.</li> <li>In case of not yet confirmed the accession number is published on a paper or others: <br /> Please let us know the paper or other media in which the accession number is described.</li> <li>In case of the data submitted BEFORE January 1, 1998: <br /> The sequence data be still unpublished after <a href="/ddbj/submission-e.html#holddate">hold date</a>.</li> </ol> <p>In case of 3 or 4, we will check and support it.<br /> Please contact us from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a> by selecting the item, “Updating Submitted Data” with accession numbers.</p> <p><strong>References</strong></p> <ul> <li><a href="/documents/data-release-policy-e.html">Principle of “Hold-Until-Published” data release</a></li> <li><a href="/faq/en/cannot-find-accession-number-cited-paper-e.html">Can not find the sequence data, though the accession number cited on a paper.</a></li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data release,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/specify-hold-date-until-related-paper-published-e.html">I like to hold my sequence data until publication of related paper, should l specify the hold date?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-03 20:15:08 +0900">2014/07/03</time></li> <li class="tag-view" data-tag="Data release">Data release</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See “<a href="/documents/data-release-policy-e.html#requirement">Why is the hold-date required?</a>”. Please specify the date. <br /> Though DDBJ does not restrict the date, we strongly recommend to specify the date within two years. <br /> If not specified, the data will be published, immediately.</p> <p>After data submission, you can change the hold date as needed. <br /> Contact us from <a href="/ddbj/update-form-e.html">this form</a> by selecting “Change the hold-date” in [Subject].</p> <dl> <dt>References</dt> <dd> <ul> <li><a href="/faq/en/postpone-hold-date-e.html">How to postpone the hold date?</a></li> <li><a href="/documents/data-release-policy-e.html">Principle of “Hold-Until-Published” data release</a></li> </ul> </dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data release,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-data-released-at-emble-genbank-e.html">How are the data released from DDBJ published at EMBL-Bank, GenBank?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-03 20:44:32 +0900">2014/07/03</time></li> <li class="tag-view" data-tag="Data release">Data release</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>DDBJ is functioning as one of <a href="/about/insdc-e.html">the international nucleotide sequence databases</a>, including EMBL-Bank/EBI in Europe and GenBank/NCBI in the USA as the two other members.<br /> When DDBJ releases the submitted data, EMBL-Bank and GenBank will load the data into their own services, respectively.<br /> See <a href="/ddbj/submission-e.html#data_flow">Sequence Data Transition</a>.<br /> Note that the data are converted into EMBL-Bank or GenBank format.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data release,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/temporal-differences-data-releases-e.html">How long are the temporal differences of data releases among DDBJ, EMBL-Bank and GenBank?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-03 21:02:46 +0900">2014/07/03</time></li> <li class="tag-view" data-tag="Data release">Data release</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In general, the data released from EMBL-Bank or GenBank are loaded into DDBJ services and published from DDBJ within their released date. <br /> The data released from DDBJ are loaded into ENA/EBI and GenBank and published from them within a few days. <br /> However, the data release processes at all three databases may be delayed, because of system maintenance, troubles on the network, or any other reasons. So, we can not specify the temporal differences among them.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequence data,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-input-amino-acid-seq-e.html">How can I input amino acid sequence (/translation qualifier) for CDS feature?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 00:54:55 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Sequence data">Sequence data</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The amino acid sequence for <a href="/ddbj/cds-e.html">CDS feature</a> will be automatically translated from nucleotide sequence according to location and other items, and reflected into <a href="/ddbj/qualifiers-e.html#translation">/translation qualifier</a>. So, in general, do not enter it.</p> <dl> <dt>References</dt> <dd><a href="/faq/en/how-to-confirm-translated-amino-acid-seq-e.html">How to confirm translated amino acid sequences (i.e. /translation qualifier) for CDS features?</a></dd> <dd><a href="/faq/en/translation-qualifier-seems-incorrect-e.html">The amino acid sequence in the value of /translation qualifier seems to be incorrect.</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="format,search,submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/translation-qualifier-seems-incorrect-e.html">The amino acid sequence in the value of /translation qualifier seems to be incorrect.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 01:28:42 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="format">format</li> <li class="tag-view" data-tag="search">search</li> <li class="tag-view" data-tag="submission">submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The rule to translate nucleotide sequence into amino acid sequence is specified in accordance with agreements of <a href="/about/insdc-e.html">International Nucleotide Sequence Database Collaboration</a>. <br /> The codon table using a CDS feature is specified in the value of /<a href="/ddbj/qualifiers-e.html#transl_table">transl_table</a> qualifier as a number of <a href="/ddbj/geneticcode-e.html">The Genetic Codes</a>.</p> <p>There are three points frequently misunderstood.</p> <ul> <li>You should specify /<a href="/ddbj/qualifiers-e.html#organelle">organelle</a> qualifier to assign correct genetic code for mitochondrion or chloroplast.</li> <li>The initiation codon is M, Met, methyonine, not G or V. <br /> See <a href="http://en.wikipedia.org/wiki/Start_codon">Start codon</a> and <a href="http://en.wikipedia.org/wiki/Formylmethionine">N-Formylmethionine</a></li> <li>When an amino acid can be specified by two bases (i.e. degeneracy of codons), it will be outputted.</li> </ul> <p>There are some <a href="/faq/en/how-to-describe-not-standard-genetic-code-e.html">exceptional cases</a>, represented by <a href="/ddbj/cds-e.html#stop_e">RNA editing</a> and so on.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/whether-to-use-nsss-or-mss-e.html">Which should I use to submit to DDBJ, Nucleotide Sequence Submission System or Mass Submission System?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 01:46:12 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p><a href="/ddbj/web-submission-e.html">Nucleotide Sequence Submission System</a> (NSSS) is an interactive application to enter all of items required for your submission on step by step basis. <br /> To use <a href="/ddbj/mss-e.html">Mass Submission System (MSS)</a>, submitters have to make submission files by themselves. <br /> However, since NSSS can not accept all types of sequence data, it may be required to use MSS for your data submission.</p> <p>Use <a href="/submission-navigation-e.html">Submission navigation</a>. <br /> See <a href="/ddbj/submission-e.html#workflow">Workflow of the data submission to DDBJ</a> <br /> Based on above information, select either of them as needed.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Mass Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-many-data-submit-using-mss-e.html">How many data can I submit by using Mass Submission System?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 01:55:39 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Mass Submission System">Mass Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>You can use <a href="/ddbj/mss-e.html">Mass Submission System</a> (MSS) not only for many sequences but also for one long sequence with many features (i.e. complete genome with annotation). <br /> There is no limit of the number of sequences to use MSS and, in some cases, it is required to use of MSS by factors other than the number of sequences. <br /> Use <a href="/submission-navigation-e.html">Submission navigation</a>. <br /> See <a href="/ddbj/submission-e.html#workflow">Workflow of the data submission to DDBJ</a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequence data,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-exclude-vector-contami-e.html">How can I check my sequence to exclude vector contamination?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 02:53:32 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Sequence data">Sequence data</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/ddbj/sequence-e.html">Nucleotide sequences</a>.</p> <p>You can use <a href="http://ddbj.nig.ac.jp/vecscreen/?lang=en">VecScreen</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-suspend-resume-submission-e.html">How to suspend and resume my submission?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 02:58:18 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/ddbj/web-submission-help-e.html#flow-2-1">How to suspend/resume</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-get-protein-id-e.html">How can I get protein_id?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 03:16:31 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The <a href="/ddbj/qualifiers-e.html#protein_id">protein_id</a> will be automatically assigned at DDBJ during release of your nucleotide sequence with <a href="/ddbj/cds-e.html">CDS feature</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-enter-two-or-more-features-e.html">How to entetr two or more features for a sequence?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 20:54:24 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>At <a href="/ddbj/web-submission-help-e.html#flow-6">6. Template</a>, a) select ‘other’ and click [Input annotation] or b) Click [Upload annotation file].<br /> Then, you can describe two or more features for each sequence as follows.</p> <p>In case of a), see <a href="/ddbj/web-submission-help-e.html#flow-7-2">7.Annotation (Annotation when template “other” is selected)</a>.</p> <p>In case of b), see <a href="/ddbj/web-submission-help-e.html#flow-7-6">7. Annotation: Submission by uploading the annotation file</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-describe-definition-e.html">How can I describe DEFINITION?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 23:12:07 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Since DEFINITION is constructed by DDBJ according to <a href="/ddbj/flat-file-e.html#DefinitionB">rules</a>, there is no field to enter it.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cannot-find-input-field-some-qualifier-e.html">Can not find input field for some qualifier</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-04 23:45:21 +0900">2014/07/04</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Click <strong>[Select Qualifier]</strong>, check qualifiers in the dialog as needed and click [Save] button.<br /> Then, you can find input fields for qualifiers on <a href="/ddbj/web-submission-help-e.html#flow-7">7.Annotation</a>.</p> <p>Related to this issue, in case of selecting “other” on <a href="/ddbj/web-submission-help-e.html#flow-6">6. template</a>, you have to specify some features other than source. So, click <strong>[Add feature]</strong> and select some feature on the list.</p> <p><strong>Reference</strong><br /> <a href="/ddbj/web-submission-help-e.html#flow-7-2">7.Annotation (when “other” was selected at template)</a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-fix-error-msg-first-codon-e.html">How to fix error message: "First codon [***] is not a start codon." / "Final codon [***] is not a stop codon."?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-05 00:30:54 +0900">2014/07/05</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>These errors mean amino acid translation for <a href="/ddbj/cds-e.html">CDS (protein coding sequence) feature</a> is not appropriate in the 5’ or 3’ end, respectively. When the CDS feature is not complete (i.e. partial) at 5’ and/or 3’ ends, its location is required to include flag for ‘not complete’. According to rules on <a href="/ddbj/location-e.html">Description of Location</a>, partial sequences should be appropriately specified with flags for 5’ end not complete, “<”, and/or for 3’ end not complete, “>” on its feature location.</p> <table> <thead> <tr> <th>location</th> <th>condition</th> </tr> </thead> <tbody> <tr> <td><1..295</td> <td>[not start with initiation codon] and [stop with termination codon]</td> </tr> <tr> <td>1.. >295</td> <td>[start with initiation codon] and [not stop with termination codon]</td> </tr> <tr> <td><1.. >295</td> <td>[not start with initiation codon] and [not stop with termination codon]</td> </tr> </tbody> </table> <p>For example: partial CDS feature in the range, 1..295</p> <dl> <dt>References</dt> <dd><a href="/faq/en/how-to-fix-error-msg-stop-codon-e.html">How to fix error message: “Stop codon ‘*’ is found in the range.”?</a></dd> <dd><a href="/faq/en/how-to-fix-error-msg-codon-start-e.html">How to fix error message: “Value of [ codon_start ] is not 1, but [</a></dd> <dd><a href="/ddbj/cds-e.html#frame">Offset of the frame at translation initiation by codon_start</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-fix-error-msg-cds-feature-e.html">How to fix error message: "To use [translation] qualifier, [exception] qualifier is required in the [CDS] feature." ?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-05 02:21:10 +0900">2014/07/05</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>This error message is outputted, because you select /<a href="/ddbj/qualifiers-e.html#translation">translation</a> for <a href="/ddbj/cds-e.html#translation">CDS feature</a> by dialog of [Select Qualifier] button.<br /> Generally, since /translation qualifier is automatically created according to items under CDS feature, do not enter any amino acid sequence.<br /> So, you can fix the error by removing /translation qualifier.</p> <p>For your information, /translation qualifier is required only in case describing with /<a href="/ddbj/qualifiers-e.html#exception">exception</a> qualifier.<br /> Typically, /exception qualifier indicates “RNA editing” is occurred on mRNA. In that case, conceptual amino acid translation of genome sequence is different from protein product of real mRNA molecules.</p> <dl> <dt>References</dt> <dd><a href="/ddbj/example-e.html">Example of Submission</a>: <a href="/ddbj/example-e.html#B09">B09) RNA editing</a></dd> <dd><a href="/faq/en/how-to-input-amino-acid-seq-e.html">How can I input amino acid sequence (/translation qualifier) for CDS feature?</a></dd> <dd><a href="/faq/en/how-to-confirm-translated-amino-acid-seq-e.html">How to confirm translated amino acid sequences (i.e. /translation qualifier) for CDS features?</a></dd> <dd><a href="/faq/en/translation-qualifier-seems-incorrect-e.html">The amino acid sequence in the value of /translation qualifier seems to be incorrect.</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-fix-error-msg-transl-table-e.html">How to fix error message: "Invalid value [***] for [transl_table] qualifier."?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-05 04:09:43 +0900">2014/07/05</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The error is occurred because you do not enter correct <a href="/ddbj/geneticcode-e.html">genetic code</a>. <br /> See <a href="/ddbj/web-submission-help-e.html#flow-7-4">7.Annotation – Organism name</a>. <br /> To specify <a href="/ddbj/geneticcode-e.html">genetic code</a>, enter digit in the input field. <br /> The value will be automatically applied for /<a href="/ddbj/qualifiers-e.html#transl_table">transl_table</a> qualifier for <a href="/ddbj/cds-e.html">CDS feature</a>.</p> <p>For your information, in case of a previously reported organism, the genetic code is automatically specified, by describing Scientific name (<a href="/ddbj/organism-e.html">/organism qualifier</a>) and <a href="/ddbj/qualifiers-e.html#organelle">/organelle qualifier</a>. If your sequence is derived from an organelle other than nuclei, you have to specify /organelle qualifier to set the genetic code for mitochondrion, chloroplast or some, appropriately.</p> <dl> <dt>References</dt> <dd><a href="/ddbj/web-submission-help-e.html#flow-7">7.Annotation</a></dd> <dd><a href="/ddbj/web-submission-help-e.html#flow-7-4">7.Annotation – Organism name</a></dd> <dd><a href="/ddbj/geneticcode-e.html">The Genetic Codes</a></dd> <dd><a href="/ddbj/qualifiers-e.html#transl_table">About /transl_table qualifier</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/browser-still-waiting-for-response-e.html">browser still waiting for response on the process of data input</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-07 01:15:29 +0900">2014/07/07</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>At first, please save the URL of the page of Nucleotide Sequence Submission System.<br /> Then, clear cache of the browser and reopen the saved URL.<br /> It is likely to resolve the condition.</p> <p>If not resolved, confirm if you use either of browsers <strong><a href="http://www.mozilla.org/en-US/firefox/all/">Firefox</a></strong> or <strong><a href="http://www.google.com/chrome">Chrome</a></strong> that we recommend to use.<br /> If not, change to Firefox or Chrome and reopen the URL.</p> <p>If you still have any problem, please contact us with followings from <a href="/contact-ddbj-e.html#to-ddbj">contact form</a> by selecting the item, “DDBJ Nucleotide Sequence Submission System”.</p> <ul> <li>URL</li> <li>Number of your sequences</li> <li>OS: Windows, MacOSX, or Linux, and its version</li> <li>Browser: software and its version</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-fix-error-msg-codon-start-e.html">How to fix error message: "Value of [ codon_start ] is not 1, but [###..###] is 5' complete type."?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-07 01:30:25 +0900">2014/07/07</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>You may enter incorrect values for <a href="/ddbj/location-e.html">Location</a> and/or /<a href="/ddbj/qualifiers-e.html#codon_start">codon_start</a> of <a href="/ddbj/cds-e.html">CDS</a> feature.<br /> If the value of /codon_start is either of “2” or “3”, the location of CDS feature should be 5’ end not complete.</p> <p>See <a href="/ddbj/location-e.html">Description of Location</a> and modify the location with flag for “5’ end not complete”, for an example, from “1..300” to “<1..300”.<br /> When the CDS feature is started with an initiation codon, correct /codon_start with “1”.</p> <dl> <dt>References</dt> <dd><a href="/ddbj/cds-e.html#frame">Offset of the frame at translation initiation by codon_start</a></dd> <dd><a href="/faq/en/how-to-fix-error-msg-first-codon.html">How to fix error message: “First codon [***] is not a start codon.” / “Final codon [***] is not a stop codon.”?</a></dd> <dd><a href="/faq/en/how-to-fix-error-msg-stop-codon.html">How to fix error message: “Stop codon ‘*’ is found in the range.”?</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/modify-go-back-to-each-page-e.html">Can I modify descriptions on a previous page?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-07 20:16:54 +0900">2014/07/07</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>You can modify your inputs on any pages before finishing your submission. <br /> You can go back to each page by clicking either of <strong>1.Contact person</strong>, <strong>2.Hold date</strong>, <strong>3.Submitter</strong>, <strong>4.Reference</strong>, <strong>5.Sequence</strong>, <strong>6.Template</strong> or <strong>7.Annotation</strong> in progress bar at upside of pages.</p> <div class="figure"> <a class="group1" href="/assets/images/news/37296-e.png"> <figure class="image"> <img src="/assets/images/news/37296-e.png" class="w550" /> <figcaption></figcaption> </figure> </a> </div> <dl> <dt><span style="color: #ff0000">※Caution</span></dt> <dd>After inputting feature annotation on <a href="/ddbj/web-submission-help-e.html#flow-7">7.Annotation</a>, if you do either of followings, feature annotation will be removed. <ul> <li>modify your sequences on <a href="/ddbj/web-submission-help-e.html#flow-5">5.Sequence</a></li> <li>change your template on <a href="/ddbj/web-submission-help-e.html#flow-6">6.Template</a></li> </ul> </dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cannot-upload-ann-file-e.html">I can not upload my annotation file</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-07 20:37:33 +0900">2014/07/07</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Confirm following points.</p> <ul> <li>You have to input the same entry names for both sequences and in <a href="/ddbj/file-format-e.html#annotation">annotation file</a>.</li> <li>The format of annotation file must be tab delimited text consisting with 5 columns.</li> <li>The line feed code of annotation file must be in LF (unix format) or CR-LF (windows format).</li> <li>You have to use correct names for <a href="/ddbj/features-e.html">feature</a> and <a href="/ddbj/qualifiers-e.html">qualifier</a> keys.</li> </ul> <p>If you still have any problem, contact us from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-submit-more-than-one-seq-e.html">How to submit more than one sequence at once?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-07 21:38:44 +0900">2014/07/07</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>On <a href="/ddbj/web-submission-help-e.html#flow-5">5.Sequence</a>, input all of your sequences in <strong><a href="/faq/en/acceptable-sequence-format-e.html">multi-FASTA format</a></strong>. We will assign consequent accession numbers for your sequences. <br /> Moving to <a href="/ddbj/web-submission-help-e.html#flow-7">7.Annotation</a>, you can enter feature annotation for each sequence at once. <br /> <strong><span style="color: #ff0000">Caution</span></strong></p> <ul> <li>All of following items must be unified for all sequences. You can not specify thenm for each sequence. <ul> <li>Contact person</li> <li>Hold date</li> <li>Submitter</li> <li>Reference</li> </ul> </li> <li>You can select only one template on <a href="/ddbj/web-submission-help-e.html#flow-6">6.Template</a> for all sequences. You can not select a template for each sequence.</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-confirm-translated-amino-acid-seq-e.html">How to confirm translated amino acid sequences (i.e. /translation qualifier) for CDS features?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-07 23:17:55 +0900">2014/07/07</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>You can confirm amino acid sequences for <a href="/ddbj/cds-e.html">CDS features</a> as follows.</p> <ol> <li> <p>Download UME_win.zip (for Windows) or UME_mac.zip (for MacOSX) from <a href="/ddbj/mss-e.html#tool">Mass Submission System</a>.</p> </li> <li> <p>Download both annotation and sequence files at <a href="/ddbj/web-submission-help-e.html#flow-8">8. Finish</a> on DDBJ Nucleotide Sequence Submission System.</p> </li> <li> <p><a href="/ddbj/ume-e.html">Run UME</a> and load both annotation and sequence files. Then click [Execute] of transChecker.</p> </li> </ol> <p>The function to confirm amino acid sequences will be applied on DDBJ Nucleotide Sequence Submission System.</p> <dl> <dt>References</dt> <dd><a href="/faq/en/how-to-input-amino-acid-seq-e.html">How can I input amino acid sequnce (/translation qualifier) for CDS feature?</a></dd> <dd><a href="/faq/en/translation-qualifier-seems-incorrect-e.html">The amino acid sequence in the value of /translation qualifier seems to be incorrect.</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-fix-error-msg-mga-e.html">How to fix error message: "MGA:No entry name is found other than [ COMMON ], without feature [ DATATYPE/type=MGA ]."?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-07 23:57:17 +0900">2014/07/07</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Though you have not yet enter either /<a href="/ddbj/qualifiers-e.html#organism">organism</a> or /<a href="/ddbj/qualifiers-e.html#mol_type">mol_type</a> on annotation table, you click [Confirm] button.<br /> You must fill mandatory items of annotation (feature, location, qualifier) before clicking [Confirm] button.</p> <p>On <a href="/ddbj/web-submission-help-e.html#flow-7">7.Annotation</a>, click [Select Qualifier] button beside ‘source’, and select qualifiers as needed. Then, click [Edit] button beside entry name and input /organism and others. Note that it is required to input at least one feature other than source.<br /> See also <a href="/ddbj/web-submission-help-e.html#flow-7-4">7.Annotation – Organism name</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Nucleotide Sequence Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-fix-error-msg-stop-codon-e.html">How to fix error message: "Stop codon ‘*’ is found in the range."?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-08 02:41:01 +0900">2014/07/08</time></li> <li class="tag-view" data-tag="Nucleotide Sequence Submission System">Nucleotide Sequence Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In general, see <a href="/ddbj/cds-e.html#stop">How to describe CDS feature, when termination codon is found in the range</a>.<br /> You can also see <a href="/ddbj/cds-e.html">Protein Coding Sequence; CDS feature</a> to describe CDS feature.<br /> Following items are case study for the error.</p> <ol> <li> <p>Did you correctly specify /<a href="/ddbj/qualifiers-e.html#codon_start">codon_start</a> qualifier to indicate reading frame of the CDS feature?<br /> Select 1, 2 or 3, appropriately.</p> <dl> <dt>References:</dt> <dd><a href="/ddbj/cds-e.html#frame">Offset of the frame at translation initiation by codon_start</a></dd> <dd><a href="/faq/en/how-to-fix-error-msg-first-codon-e.html">How to fix error message: “First codon [***] is not a start codon.” / “Final codon [***] is not a stop codon.”?</a> How to fix error message: “Value of [ codon_start ] is not 1, but [</dd> </dl> </li> <li> <p>Have you specify correct <a href="/ddbj/geneticcode-e.html">genetic code</a> for /<a href="/ddbj/qualifiers-e.html#transl_table">transl_table</a> qualifier?<br /> See followings and specify genetic code, appropriately.</p> <dl> <dt>References:</dt> <dd><a href="/ddbj/geneticcode-e.html">The Genetic Codes</a></dd> <dd><a href="/ddbj/qualifiers-e.html#transl_table">About /transl_table qualifier</a></dd> <dd><a href="/faq/en/how-to-fix-error-msg-transl-table-e.html">How to fix error message: “Invalid value [***] for [transl_table] qualifier.”?</a></dd> </dl> </li> <li> <p>Are there really some stop codons in the range of CDS feature because of frame shift, nonsense mutation, or some other reason?</p> <ol> <li> <p>In case of pseudogene<br /> Click [Select Qualifier] button beside CDS and add <a href="/ddbj/qualifiers-e.html#pseudogene">/pseudogene qualifier</a>. Then, you can specify /pseudogene qualifier with <a href="/ddbj/pseudogene-e.html">its controlled vocabularies</a>.<br /> See also <a href="/ddbj/cds-e.html#stop_b">b) considered pseudogene</a> in detail.</p> </li> <li> <p>In cases of unsure whether it is pseudogene or not, the reason of stop codon is uncertain, or on the process of diversity increasing related to acquired immunity, describe misc_feature, not CDS feature.<br /> See <a href="/ddbj/cds-e.html#stop_a">a) Putative nonsense mutation, frameshift caused by uncertain reason, or on the process of diversity increasing related to acquired immunity for IgG etc.</a> in detail.</p> </li> </ol> </li> <li> <p>In other cases. <br /> There are some possibilities to output this error because of <a href="/ddbj/cds-e.html#stop_d">ribosomal slippage</a>, <a href="/ddbj/cds-e.html#stop_e">RNA editing</a>, <a href="/ddbj/cds-e.html#stop_f">exceptional amino acid usage</a>, <a href="/ddbj/cds-e.html#stop_g">transpon insertion</a> and so on.</p> </li> </ol> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/secondary-accession-number-e.html">What is secondary accession number?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-08 04:23:45 +0900">2014/07/08</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p><a href="/about/insdc-e.html#insd">INSD; International Nucleotide Sequence Database</a> are composed of DDBJ, ENA and NCBI, and collect experimentally determined nucleotide sequence data. <br /> A unique <strong>accession number</strong> issued by INSD for each submitted sequence data is defined as <a href="/documents/accessions.html">the INSD accession number</a>. <br /> On <a href="/ddbj/flat-file-e.html">DDBJ flat file</a>, the accession number is described in <a href="/ddbj/flat-file-e.html#AccessionB">ACCESSION</a> line.</p> <p>If multiple entries are united to an entry, or if an entry is extensively modified after the submission, the responsible data banks may assign a new accession number to it. In these cases, the new accession number is called the primary accession number, and the old accession number(s) is/are called the secondary accession number(s).</p> <p>In the flat file, the primary accession number is indicated first, then the secondary accession number(s) follows.</p> <p><strong>Example</strong></p> <pre class="flatfile">ACCESSION <span style="border-bottom:solid 3px #ff0000;">AB999999</span> <span style="border-bottom:solid 3px #0000ff;">AB888888</span> <span style="border-bottom:solid 3px #0000ff;">AB777777</span></pre> <p><span style="color: #ff0000">AB999999 – primary accession number</span> <br /> <span style="color: #0000ff">AB888888 AB777777 – secondary accession number</span></p> <p>You can find the same updated entry with both the primary and the secondary accession numbers, in general. <br /> However, if the old entry with secondary accession number has previously been open to the public, the old one is not removed. So, you can find the old record by <a href="http://getentry.ddbj.nig.ac.jp/top-e.html">getentry</a>.</p> <dl> <dt>References</dt> <dd> <ul> <li><a href="/services/getentry-e.html">getentry HELP</a></li> <li><a href="/about/insdc-status-e">INSDC Status Document</a>: Replaced</li> <li><a href="/faq/en/why-retracted-data-available-e.html">Why is the retracted data still available?</a></li> </ul> </dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sample,attributes,biosample"> <div class="upper"> <h2 class="title"> <a href="/faq/en/biome-feature-material-e.html">What is the difference between env_broad_scale, env_local_scale and env_medium?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-07-24 19:49:53 +0900">2014/07/24</time></li> <li class="tag-view" data-tag="Sample">Sample</li> <li class="tag-view" data-tag="attributes">attributes</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>These three sample attributes describe environmental systems have influences on living organisms.</p> <p><a href="/biosample/attribute-e.html?all=all#env_broad_scale">env_broad_scale</a><br /> Add terms that identify the major environment type(s) where your sample was collected. Recommend subclasses of biome [<a href="https://www.ebi.ac.uk/ols/ontologies/envo/terms?iri=http%3A%2F%2Fpurl.obolibrary.org%2Fobo%2FENVO_00000428">ENVO:00000428</a>]. Multiple terms can be separated by one or more pipes e.g. mangrove biome [ENVO:01000181]|estuarine biome [ENVO:01000020]</p> <p><a href="/biosample/attribute-e.html?all=all#env_local_scale">env_local_scale</a><br /> Add terms that identify environmental entities having causal influences upon the entity at time of sampling, multiple terms can be separated by pipes, e.g.: shoreline [ENVO:00000486]|intertidal zone [ENVO:00000316]</p> <p><a href="/biosample/attribute-e.html?all=all#env_medium">env_medium</a> <br /> Add terms that identify the material displaced by the entity at time of sampling. Recommend subclasses of environmental material [<a href="https://www.ebi.ac.uk/ols/ontologies/envo/terms?iri=http%3A%2F%2Fpurl.obolibrary.org%2Fobo%2FENVO_00010483">ENVO:00010483</a>]. Multiple terms can be separated by pipes e.g.: estuarine water [ENVO:01000301]|estuarine mud [ENVO:00002160]</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Metadata,biosample"> <div class="upper"> <h2 class="title"> <a href="/faq/en/no-value-for-attributes-e.html">What should be provided when information is unavailable?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-09-03 01:43:31 +0900">2014/09/03</time></li> <li class="tag-view" data-tag="Metadata">Metadata</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please see the <a href="/biosample/submission-e.html#missing-value-reporting">Missing value reporting</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequencing data,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/scp-e.html">I can not scp transfer my files.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-11-19 23:07:21 +0900">2014/11/19</time></li> <li class="tag-view" data-tag="Sequencing data">Sequencing data</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>First, confirm the following basic points.</p> <ul> <li>Authentification is by using SSH key not by password.</li> <li>A private key is pair of a public key registered in a D-way submission account.</li> <li>A private key file has read permission.</li> <li>A private key file permission is set as others cannot access. For example, rw——-.</li> <li>A passphrase for private key is correctly entered.</li> </ul> <p>When transferring data files by using a private key generated in the other operating system, please check format of a private key. <a href="/account-e.html#convert-private-key">Convert private key</a></p> <p>Environments and private key formats:</p> <ul> <li>Unix/Mac OS X: Use an OpenSSH-format key. Convert a key in the Windows PuTTY file format into the OpenSSH.</li> <li>Windows WinSCP: Use a PuTTY-format key. Convert a key in the Unix/Mac OS X OpenSSH file format into the Windows PuTTY format.</li> </ul> <p>When these are correct, because we do not support technical details regarding use of third-party softwares, please refer to websites of softwares or confirm your system administrators whether scp (port 22) is allowed or not.</p> <h3 id="ps">Windows PowerShell</h3> <h4 id="invalid-format-error">invalid format error</h4> <p>A PuTTY-format private key causes “invalid format” error, <a href="/account-e.html#putty-openssh">convert the key into OpenSSH-format</a>.</p> <h4 id="unprotected">UNPROTECTED PRIVATE KEY FILE WARNING</h4> <p>If the private key access permission is too open, following error will be shown.</p> <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ @ WARNING: UNPROTECTED PRIVATE KEY FILE! @ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ Permissions for './private-key-for-auth' are too open. It is required that your private key files are NOT accessible by others. This private key will be ignored. Load key "./private-key-for-auth": bad permissions test07@ftp-private.ddbj.nig.ac.jp: Permission denied (publickey,gssapi-keyex,gssapi-with-mic). lost connection </code></pre></div></div> <p>Right-click the private key file and select the property.<br /> <a href="/assets/images/books/win-ps-1.jpg" title="file property" class="group1"><img src="/assets/images/books/win-ps-scp-1.jpg" alt="file property" title="file property" class="w300" /></a></p> <p>Select detailed setting of the security tab.<br /> <a href="/assets/images/books/win-ps-scp-2.jpg" title="detailed setting of security" class="group1"><img src="/assets/images/books/win-ps-scp-2.jpg" alt="detailed setting of security" title="detailed setting of security" class="w300" /></a></p> <p>Disable access permission entry inheritance to enable permission deletion.<br /> <a href="/assets/images/books/win-ps-scp-3.jpg" title="Disable access permission entry inheritance" class="group1"><img src="/assets/images/books/win-ps-scp-3.jpg" alt="Disable access permission entry inheritance" title="Disable access permission entry inheritance" class="w300" /></a></p> <p>Convert explicit access permission.<br /> <a href="/assets/images/books/win-ps-scp-4.jpg" title="Convert explicit access permission" class="group1"><img src="/assets/images/books/win-ps-scp-4.jpg" alt="Convert explicit access permission" title="Convert explicit access permission" class="w300" /></a></p> <p>Delete all permissions.<br /> <a href="/assets/images/books/win-ps-scp-5.jpg" title="Delete all permissions" class="group1"><img src="/assets/images/books/win-ps-scp-5.jpg" alt="Delete all permissions" title="Delete all permissions" class="w300" /></a></p> <p>Add access permission.<br /> <a href="/assets/images/books/win-ps-scp-6.jpg" title="Add access permission" class="group1"><img src="/assets/images/books/win-ps-scp-6.jpg" alt="Add access permission" title="Add access permission" class="w300" /></a></p> <p>Add a Windows user (example, test07). <a href="/assets/images/books/win-ps-scp-7.jpg" title="Add a Windows user" class="group1"><img src="/assets/images/books/win-ps-scp-7.jpg" alt="Add a Windows user" title="Add a Windows user" class="w300" /></a></p> <p>Allow full control to the Windows user. <br /> <a href="/assets/images/books/win-ps-scp-8.jpg" title="Allow full control" class="group1"><img src="/assets/images/books/win-ps-scp-8.jpg" alt="Allow full control" title="Allow full control" class="w300" /></a></p> <p>Change the file permission. <br /> <a href="/assets/images/books/win-ps-scp-9.jpg" title="Change the file permission" class="group1"><img src="/assets/images/books/win-ps-scp-9.jpg" alt="Change the file permission" title="Change the file permission" class="w300" /></a></p> <p>Run scp.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data release,bioproject,biosample,dra,gea,metabobank"> <div class="upper"> <h2 class="title"> <a href="/faq/en/bp-bs-seq-release-e.html">How are linked BioProject/BioSample/experimental data released?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-12-15 20:41:03 +0900">2014/12/15</time></li> <li class="tag-view" data-tag="Data release">Data release</li> <li class="tag-view" data-tag="bioproject" title="BioProject">BioProject</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> <li class="tag-view" data-tag="gea" title="Genomic Expression Archive (GEA)">GEA</li> <li class="tag-view" data-tag="metabobank" title="MetaboBank">MetaboBank</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Linked <a href="/bioproject/index-e.html">BioProject</a>, <a href="/biosample/index-e.html">BioSample</a>, <a href="/ddbj/submission.html">DDBJ</a>, <a href="/dra/index-e.html">DRA</a>, <a href="/gea/index-e.html">GEA</a> and <a href="/metabobank/index-e.html">MetaboBank</a> data are released as follows.</p> <ul> <li>Release of the BioProject and BioSample records DO NOT trigger release of the other linked data.</li> <li>Release of the BioSample records trigger release of the referencing BioSample in derived_from attributes.</li> <li>Release of the DDBJ, DRA, GEA and MetaboBank data DO trigger release of the linked BioProject and BioSample records.</li> <li>Release of DDBJ triggers release of DRA Run(s) linked from DBLINK(s).</li> <li>Release of GEA triggers release of linked DRA Run(s).</li> <li>Release of the DRA data DO NOT trigger release of the DDBJ records.</li> </ul> <p class="attention">All metadata and sequencing data in a DRA submission are released at once.</p> <figure><a href="/assets/images/books/bp-bs-seq_release.jpg" title="Release of linked BioProject/BioSample/experimental data"><img src="/assets/images/books/bp-bs-seq_release.jpg" alt="Release of linked BioProject/BioSample/experimental data" title="Release of linked BioProject/BioSample/experimental data" class="w400" /></a> <figcaption class="caption">Release of linked BioProject/BioSample/experimental data</figcaption> </figure> <figure><a href="/assets/images/books/bp-bs-seq_release-2.jpg" title="Release of the other data linked to BioProject/BioSample"><img src="/assets/images/books/bp-bs-seq_release-2.jpg" alt="Release of the other data linked to BioProject/BioSample" title="Release of the other data linked to BioProject/BioSample" class="w550" /></a> <figcaption class="caption">Release of the other data linked to BioProject/BioSample</figcaption> </figure> <figure><a href="/assets/images/books/bp-bs-seq_release-3.jpg" title="Release of derived BioSample"><img src="/assets/images/books/bp-bs-seq_release-3.jpg" alt="Release of derived BioSample" title="Release of derived BioSample" class="w400" /></a> <figcaption class="caption">Release of derived BioSample</figcaption> </figure> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequencing data,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/data-files-sra-e.html">How are my data files processed?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2014-12-25 19:38:13 +0900">2014/12/25</time></li> <li class="tag-view" data-tag="Sequencing data">Sequencing data</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Uploaded data files are processed per Run. All files under a Run are merged into single <a href="https://www.ncbi.nlm.nih.gov/sra/docs/sra-data-formats/">binary SRA file</a> by using <a href="http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc">SRA toolkit</a>. During this conversion, length and format of all reads are checked.</p> <p>Read names are editted and identifiers (DRR accession number + serial number) are automatically inserted (<a href="http://trace.ncbi.nlm.nih.gov/Traces/sra/?view=run_browser&run=DRR000001">example: DRR000001</a>).<br /> Original read names should be unique in a Run.<br /> A DRR accession number is used as a filename. If the <a href="/dra/metadata-e.html#File_Type">fastq</a> is selected for the filetype, read names are replaced with the DRR accession number + serial number. (<a href="http://trace.ncbi.nlm.nih.gov/Traces/sra/?view=run_browser&run=DRR030615">example: DRR030615</a>).</p> <p>When “PAIRED” is selected in Experiment, paired reads are grouped in a Run.</p> <p>DRA generates fastq from SRA files by using <a href="http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc">SRA toolkit</a> and provide sequencing data in both file formats.</p> <p>More than two fastq files are provided for paired reads. Paired reads are divided into a file with “_1” (example, DRR000001_1.fastq.bz2) and “_2” (example, DRR000001_2.fastq.bz2). Reads without pair are provided in a file without “_1” nor “_2” (example, DRR000001.fastq.bz2).</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Analysis,blast"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-is-e-value-calculated-e.html">Regarding the E value displayed in the BLAST analysis results: How is this value calculated?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-02 02:00:35 +0900">2015/06/02</time></li> <li class="tag-view" data-tag="Analysis">Analysis</li> <li class="tag-view" data-tag="blast" title="BLAST">BLAST</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The E value is computed using the following formula, in which l denotes the length of the query string, n denotes the number of strings stored in the database, and S is a score that measures the homology between nucleic acids or between amino acids. Note that k and m are positive constants.<br /> E=k*l*n*exp^(－mS)<br /> If the BLAST output results computed using this formula are displayed in the form 1E-X, this means that the quantity has the value 10<sup>-X</sup>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Analysis,blast"> <div class="upper"> <h2 class="title"> <a href="/faq/en/what-rules-blast-search-results-displyed-e.html">What rules govern the order in which BLAST search results are displayed?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-02 02:03:30 +0900">2015/06/02</time></li> <li class="tag-view" data-tag="Analysis">Analysis</li> <li class="tag-view" data-tag="blast" title="BLAST">BLAST</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>BLAST search results are displayed in descending order of homology score. <br /> There is no way to assign priorities to strings with identical scores, so there is no particular regularity to the order in which such strings are displayed.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Analysis,blast"> <div class="upper"> <h2 class="title"> <a href="/faq/en/search-results-shown-too-small-e.html">The number of search results shown is too small! (I receive the message “No hit found.”)</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-02 02:07:03 +0900">2015/06/02</time></li> <li class="tag-view" data-tag="Analysis">Analysis</li> <li class="tag-view" data-tag="blast" title="BLAST">BLAST</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If the number of search results shown is fewer than the number specified for the options “Number of Search Results to Display” and “Number of Alignments to Display,” you may increase the number of displayed results by increasing the value of the “Expectation value” under the “Advanced settings” field. <br /> In such a case, try setting the expectation value to an extremely large number such as 10,000. <br /> Note that, if the string is too short (a sequence length of 10 or so), BLAST will frequently be unable to find matches.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Analysis,blast"> <div class="upper"> <h2 class="title"> <a href="/faq/en/enter-seq-replaced-n-x-e.html">A portion of the sequence that I entered was replaced with [N](X)! What happened?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-04 01:51:00 +0900">2015/06/04</time></li> <li class="tag-view" data-tag="Analysis">Analysis</li> <li class="tag-view" data-tag="blast" title="BLAST">BLAST</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The sequence that you entered was filtered by the BLAST program. <br /> The filtering has the effect of replacing regions of your input sequence of low structural complexity with “N” (or “X” for amino-acid sequences). For details on filtering, see the section “<a href="/services/blast-e.html#filter">FILTER</a>” in the BLAST HELP. To disable filtering, select the OFF radio button in the “FILTER” option in the lower portion of the Settings screen. <br /> Note with caution that setting this option to “OFF” may result in search times that are longer than normal.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Analysis,blast"> <div class="upper"> <h2 class="title"> <a href="/faq/en/view-search-results-later-e.html">Is it possible to view search results at a later time?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-05 01:06:17 +0900">2015/06/05</time></li> <li class="tag-view" data-tag="Analysis">Analysis</li> <li class="tag-view" data-tag="blast" title="BLAST">BLAST</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <dl> <dt>Search results may be accessed via the following URL, which contains a Request ID field.</dt> <dd>http://blast.ddbj.nig.ac.jp/blast/r/<strong>Request ID</strong></dd> <dt>Request ID</dt> <dd>Note that the Request ID will be displayed in the window that appears after transmitting the input. Make sure to note down this.</dd> </dl> <div class="figure"> <a class="group1" href="/assets/images/news/Request-ID-300x118.gif" title="Input content post-transmission window"> <figure class="image"> <img src="/assets/images/news/Request-ID-300x118.gif" alt="Input content post-transmission window" class="w300" /> <figcaption>Input content post-transmission window</figcaption> </figure> </a> </div> <div class="figure"> <a class="group1" href="/assets/images/news/results.gif" title="Search results display window"> <figure class="image"> <img src="/assets/images/news/results.gif" alt="Search results display window" class="w300" /> <figcaption>Search results display window</figcaption> </figure> </a> </div> <dl> <dt>Reading period</dt> <dd>Search results may be viewed up to 7 days after the execution of the search.</dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Use,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/ddbj-references-e.html">Where can I find the original papers and other related papers on the DDBJ search and analysis software?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-05 01:42:59 +0900">2015/06/05</time></li> <li class="tag-view" data-tag="Use">Use</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please see the DDBJ home page <a href="/services/references-e.html">References</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Use,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/description-format-using-ddbj-software-in-paper-e.html">What format should I use when including results obtained with DDBJ search and analysis software in a journal publication?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-08 20:35:19 +0900">2015/06/08</time></li> <li class="tag-view" data-tag="Use">Use</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The format differs from journal to journal; please ask the publisher. <br /> In your publications, please cite the original papers for the appropriate tools and state that you used DDBJ software for searching and analyzing gene sequence data.</p> <p>Please see the DDBJ home page <a href="/services/references-e.html">References</a> about the original papers and other related papers on the DDBJ search and analysis software.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Search,Analysis,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/ddbj-search-analysis-services-e.html">Does DDBJ offer data search and analysis services?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-08 20:44:25 +0900">2015/06/08</time></li> <li class="tag-view" data-tag="Search">Search</li> <li class="tag-view" data-tag="Analysis">Analysis</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>There are two ways of searching and analyzing data, as discussed below. Please select the option that is appropriate for your needs.</p> <ul> <li>Conducting searches and analyses using a network server such as an FTP or web server.<br /> You may access these networking tools via <a href="/searches-e.html">Search / Analysis</a>.　</li> <li>Conducting searches and analyses by logging in to the supercomputer system at the National Institute of Genetics (NIG).<br /> (This requires a supercomputer user ID. You will need to <a href="https://sc.ddbj.nig.ac.jp/en/application/registration/">sign up for a new user account on the NIG supercomputer system</a>.)</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Search,Analysis,arsa,blast,getentry"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cannot-get-expected-search-results-e.html">I did not obtain the search results that I was expecting. Did I make a mistake in conducting my search?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-08 23:14:54 +0900">2015/06/08</time></li> <li class="tag-view" data-tag="Search">Search</li> <li class="tag-view" data-tag="Analysis">Analysis</li> <li class="tag-view" data-tag="arsa" title="ARSA">ARSA</li> <li class="tag-view" data-tag="blast" title="BLAST">BLAST</li> <li class="tag-view" data-tag="getentry" title="getentry">getentry</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The DDBJ/EMBL/GenBank data banks share the sequences stored within each data bank, and in principle all three data banks should contain the same data. However, due to time delays in the inter-data-bank sharing of data released by individual data banks, as well as delays between the time at which data are entered into a data bank and the time at which the data are reflected in the corresponding search service, searches conducted using different services at the similar time on the same day may yield slightly different results. If you do not obtain the search results that you were expecting, time delays of this sort are the most likely culprit; however, for cases requiring a more detailed investigation, please contact the DDBJ via the “Other general questions” section of the contact portal. In this case, make sure to specify the following information:</p> <ul> <li>The name of the search program and/or the URL that you used to conduct the search.</li> <li>The search conditions that you used.</li> <li>The date and time at which you conducted the search.</li> <li>Accession number of the entry that should have been found.</li> <li>URL of the search results.</li> <li>Any other relevant information.</li> </ul> <p>Also, please see the sections of this document corresponding to the following questions.</p> <ul> <li><a href="/faq/en/cannot-find-accession-number-cited-paper-e.html">Can not find the sequence data, though the accession number cited on a paper.</a></li> <li><a href="/faq/en/cannot-find-data-already-published-e.html">I am having trouble finding an accession number that should be publicly available.</a></li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="DDBJ,release,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/after-scheduled-ddbj-rel-e.html">Regarding the phrase “after a scheduled DDBJ release”: When, specifically, does this phrase describe?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-08 23:19:50 +0900">2015/06/08</time></li> <li class="tag-view" data-tag="DDBJ">DDBJ</li> <li class="tag-view" data-tag="release">release</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>“Newly arrived DDBJ data (new data that have arrived after a scheduled DDBJ release)” are data made publicly available on the next day of the deadline or after for the most recent DDBJ release. The deadlines for the most recent releases are listed in the text of <a href="https://ddbj.nig.ac.jp/public/ddbj_database/ddbj/ddbjrel.txt">the release notes</a>. For example, if the most recent release were Release 67, then the deadline would be 8/25/2006, as stated below; thus, in this case, “newly arrived DDBJ data” would be data made publicly available after 8/26/2006.</p> <p>The present release contains the newest data prepared by the DNA Data Bank ofJapan (DDBJ), GenBank (*), and European Molecular Biology Laboratory/EuropeanBioinformatics Institute (EMBL/EBI) as of August 25, 2006. (This statement comes from the release notes for Rel. 67; the remainder of that discussion is omitted here.)</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="PR,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/ddbj-publication-archives-e.html">Please see the DDBJ publication archive.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-09 01:00:49 +0900">2015/06/09</time></li> <li class="tag-view" data-tag="PR">PR</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The services that exist for communicating information about DDBJ are as follows. <br /> Choose whichever resource is most appropriate for your purposes.</p> <ul> <li><a href="/policies-e.html#third-party-sites">Official Sites on Social Media</a></li> <li><a href="/data-feed-e.html">RSS feed</a></li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Search,getentry"> <div class="upper"> <h2 class="title"> <a href="/faq/en/link-to-accession-numbers-e.html">Is there a way to link directly to data (accession numbers) registered in the DDBJ?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-09 01:04:36 +0900">2015/06/09</time></li> <li class="tag-view" data-tag="Search">Search</li> <li class="tag-view" data-tag="getentry" title="getentry">getentry</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>See <a href="/services/getentry-e.html#ge_createlinks">How to Create Links to DDBJ Entries</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Use,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/link-to-ddbj-web-use-screenshots-e.html">I would like to link to the DDBJ website or to include some Web screenshots on my website</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-09 01:09:25 +0900">2015/06/09</time></li> <li class="tag-view" data-tag="Use">Use</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>While no limitations are placed on information citations from the DDBJ website, DDBJ is not responsible for websites that cite information from DDBJ or how the cited information is displayed. <br /> When citing information from this website, please clearly indicate that the information has been taken from the DDBJ website.</p> <p>If possible, please let us know the following information from <a href="https://forms.gle/7g2YCoBjqvbBBW9V8">Contact</a></p> <ul> <li>The website on which the information will be cited (or where image(s) will be reproduced)</li> <li>The URL or the image(s) that will be cited</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Use,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/distribute-clone-e.html">Please distribute clones.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-09 01:11:06 +0900">2015/06/09</time></li> <li class="tag-view" data-tag="Use">Use</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>The DDBJ is a database center of nucleotide sequences, so it does not distribute any clones. <br /> Please contact the submitter of the clone sequence directly.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequencing data,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/validate-data-files-e.html">How can I turn the "Validate data files" button active?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-10-05 18:26:41 +0900">2015/10/05</time></li> <li class="tag-view" data-tag="Sequencing data">Sequencing data</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>When all sequencing data files listed in the Run metadata are uploaded to the DRA server, the “Validate data files” button becomes clickable and users are able to start the validation process.If the button remains inactive after submitting metadata (“metadata_submitted”), check the following points.</p> <ul> <li>Have all data files listed in the Run metadata been uploaded?</li> <li>Doesn’t data files contain spaces?</li> <li>Aren’t uploaded files contained in sub-directories?</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,bioproject"> <div class="upper"> <h2 class="title"> <a href="/faq/en/project-update-e.html">How do I update my BioProject?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-10-14 00:18:28 +0900">2015/10/14</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="bioproject" title="BioProject">BioProject</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p><a href="https://forms.gle/d9cZxyzQzxPMSqW59">Contact the BioProject team</a> to request updates and withdrawals.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Update,biosample"> <div class="upper"> <h2 class="title"> <a href="/faq/en/sample-update-e.html">How do I update my BioSample?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-10-14 00:44:42 +0900">2015/10/14</time></li> <li class="tag-view" data-tag="Update">Update</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>It is necessary for submitters <a href="https://forms.gle/d9cZxyzQzxPMSqW59">to contact the BioSample team</a> to request updates and withdrawals as necessary. You can confirm updated samples by downloding the <a href="/submission.html#update-biosample">attribute tsv</a> (example, SSUB000001.txt) in the ATTRIBUTES of the D-way BiSample submission page.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/restricton-seq-length-e.html">Is there any restriction of sequence length to submit to DDBJ?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2016-02-26 22:32:27 +0900">2016/02/26</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <dl> <dt>Upper limit</dt> <dd>If the sequence is really observed, there is no upper limitation of the sequence length to submit to DDBJ. <br /> However, we can not accept any operationally joined sequence, for example, joining chromosomes. We accept each chromosome sequence, respectively. <br /> For whole genome scale sequences, submit by using <a href="/ddbj/mss-e.html">Mass Submission System (MSS)</a> instead of <a href="/ddbj/web-submission-e.html">Nucleotide Sequence Submission System (NSSS)</a>. <br /> See <a href="/ddbj/submission-e.html#workflow">Workflow of the data submission to DDBJ</a></dd> <dt>Lower limit</dt> <dd>Since June 2021, when the sequence is less than 100 bp in its length, we will refuse the sequence data submission.</dd> <dt>References</dt> <dd><a href="/faq/en/reject-submission-e.html">Is there any case to reject submission to DDBJ?</a></dd> <dd><a href="/documents/data-categories-e.html#accept">Acceptable data for DDBJ</a></dd> <dd><a href="/ddbj/sequence-e.html#not_acceptable">Not acceptable sequences</a></dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/where-to-submit-variation-data-e.html">Where to submit variation data, such as single nucleotide variations, structural variations, copy number variations (CNVs) and so on?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2016-02-26 22:37:12 +0900">2016/02/26</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>At DDBJ, we do not provide any official services to accept SNV, CGH analysis, microarray, variation and so on. <br /> We assume that you can submit your data at NCBI or EBI. <br /> Please submit to some of followings. If you have any questions, please ask each database, directly.</p> <ul> <li><a href="http://www.ncbi.nlm.nih.gov/">NCBI</a>: <a href="http://www.ncbi.nlm.nih.gov/geo/">Gene Expression Omnibus (GEO)</a>, <a href="http://www.ncbi.nlm.nih.gov/SNP/">dbSNP</a>, <a href="http://www.ncbi.nlm.nih.gov/dbvar">dbVar</a>, <a href="http://www.ncbi.nlm.nih.gov/clinvar/">ClinVar</a></li> <li><a href="http://www.ebi.ac.uk/">EBI</a>: <a href="http://www.ebi.ac.uk/arrayexpress/">ArrayExpress</a>, <a href="http://www.ebi.ac.uk/eva/">European Variation Archive (EVA)</a>, <a href="http://www.ebi.ac.uk/dgva">Database of Genomic Variants archive (DGVa)</a></li> </ul> <p>If your data are derived from human subjects, it may be required to submit your data to either of following <a href="/policies-e.html#human">controlled access databases</a>.</p> <ul> <li><a href="http://www.ncbi.nlm.nih.gov/gap">The database of Genotypes and Phenotypes (dbGaP)</a></li> <li><a href="http://www.ebi.ac.uk/ega/">European Genome-phenome Archive (EGA)</a></li> <li><a href="/jga/index-e.html">Japanese Genotype-phenotype Archive (JGA)</a></li> </ul> <dl> <dt>References</dt> <dd> <ul> <li><a href="/faq/en/submit-snp-reflect-dbsnp-e.html">After submission of SNP data to DDBJ, will it automatically reflect to dbSNP?</a></li> <li><a href="/faq/en/how-to-submit-dna-polymorphism-e.html">How to submit sequence data related to DNA polymorphism?</a></li> </ul> </dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Search,getentry"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-get-wgs-tsa-tls-fasta-format-e.html">How do I get a FASTA format of WGS, TSA, or TLS entries?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2016-05-19 20:11:12 +0900">2016/05/19</time></li> <li class="tag-view" data-tag="Search">Search</li> <li class="tag-view" data-tag="getentry" title="getentry">getentry</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>To get a FASTA format of WGS, TSA, or TLS entries, please use (http://getentry.ddbj.nig.ac.jp/top-e.html)[getentry], specifying the following values.</p> <ul> <li>ID : Specify the Accession Number.</li> <li>Output format : Select <strong>“total nt seq FASTA”</strong> for the result.</li> <li>Result : Select one from the following filetype for the output. <ul> <li>html</li> <li>text</li> <li>compress (gz)</li> </ul> </li> <li>Limit : Set an upper limit number of the result.When you specify the Limit “0”, there is no upper limit of the data acquisition. For more information about each value, please see <a href="/services/getentry-e.html">getenry HELP</a>.</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Metadata,jga"> <div class="upper"> <h2 class="title"> <a href="/faq/en/jga-phenotypes-e.html">Are there any required variables/phenotypes that need to be included in JGA samples?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2016-06-01 00:59:22 +0900">2016/06/01</time></li> <li class="tag-view" data-tag="Metadata">Metadata</li> <li class="tag-view" data-tag="jga" title="Japanese Genotype-phenotype Archive (JGA)">JGA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>In the JGA submission, fields including the Subject ID and Gender are required. <br /> Specifically, that the main variable (e.g., heart disease) and co-variates (e.g., age, weight) used in the analysis are submitted to JGA so that other people can reproduce the information in your publication. <br /> The goal is to include the data that would be required for another researcher to be able to reproduce the published analysis.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequence data,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/acceptable-sequence-format-e.html">Sequence format acceptable for submission (FASTA, multi-FASTA)</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2017-06-09 21:41:47 +0900">2017/06/09</time></li> <li class="tag-view" data-tag="Sequence data">Sequence data</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>For the DDBJ nucleotide sequence submission system (<a href="/ddbj/web-submission-e.html">NSSS</a>), you must input nucleotide sequence(s) in FASTA format (for 1 sequence only) or in multi-FASTA format (for 2 or more sequences).<br /> Related page: <a href="/ddbj/web-submission-help-e.html#flow-5-1">Format of the nucleotide sequences that you can paste or upload</a></p> <p>You must insert the end flag (//) at the end of each sequence when you use MSS for your submission. Please see <a href="/ddbj/file-format-e.html#sequence">“How to Make Sequence File”</a>.</p> <p>See also <a href="https://en.wikipedia.org/wiki/FASTA_format">Wikipedia, FASTA format</a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Use,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/acknowledge-ddbj-e.html">How should I acknowledge the DDBJ service in our publication?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2017-06-27 02:03:35 +0900">2017/06/27</time></li> <li class="tag-view" data-tag="Use">Use</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please see <a href="/policies-e.html#credit-for-service">our policies</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Use,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/acknowledge-nig-supercomputer-e.html">How should I acknowledge the NIG Supercomputer System usage in our publication?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2017-06-27 02:03:42 +0900">2017/06/27</time></li> <li class="tag-view" data-tag="Use">Use</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please see <a href="https://sc.ddbj.nig.ac.jp/en/#about-acknowledgements">About Acknowledgements</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Contact form,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/data-update-request-form-not-displayed-e.html">Application form for Data Update Requests is not displayed</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2017-08-25 18:50:00 +0900">2017/08/25</time></li> <li class="tag-view" data-tag="Contact form">Contact form</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p><strong>Subject</strong> ： Select from the following items.</p> <ul> <li>Our paper was publishied</li> <li>Our paper was accepted</li> <li>Change the hold-date</li> <li>Change discription about the contact person</li> </ul> <p><strong>To</strong> ： <a href="mailto:ddbjupdt@ddbj.nig.ac.jp">Data updates / Corrections</a> (click the service name to send an e-mail)<br /> <strong>Body</strong> :(<span class="red">*</span> Required)</p> <dl> <dt>[For all subjects]</dt> <dd>Applicant Name<span class="red">*</span></dd> <dd>Applicant Email address<span class="red">*</span></dd> <dd>Contact person Name（When you are not contact person, please input this item.）</dd> <dd>Contact person Email address（When you are not contact person, please input this item.）</dd> <dd>Accession Numbers<span class="red">*</span></dd> </dl>  <dl> <dt>[Our paper was publishied]</dt> <dd>Paper Title <span class="red">*</span></dd> <dd>Paper All authors <span class="red">*</span></dd> <dd>Paper Journal <span class="red">*</span></dd> <dd>Paper Volume</dd> <dd>Paper Issue</dd> <dd>Paper Start page - End page</dd> <dd>Paper Year</dd> <dd>Paper URL</dd> <dd>Paper PubMed ID</dd> <dd>Paper DOI</dd> </dl>  <dl> <dt>[Our paper was accepted]</dt> <dd>Paper Title <span class="red">*</span></dd> <dd>Paper All authors <span class="red">*</span></dd> <dd>PaperJournal <span class="red">*</span></dd> <dd>Paper Volume</dd> <dd>Paper Issue</dd> <dd>Paper Start page - End page</dd> <dd>Paper Year</dd> <dd>Paper URL</dd> <dd>Paper PubMed ID</dd> <dd>Paper DOI</dd> <dd>When will you release the data?（Select from the following items.）<span class="red">*</span></dd> </dl> <ul> <li>Release immediately</li> <li>Specify the hold-date → Please specify the hold-date</li> </ul>  <dl> <dt>[Change the hold-date]</dt> <dd>New hold-date（Select from the following items.）<span class="red">*</span></dd> </dl> <ul> <li>Release immediately</li> <li>Specify the hold-date → Please specify the hold-date</li> </ul>  <dl> <dt>[Change discription about the contact person]</dt> <dd>Name ( Current )</dd> <dd>Name ( Update )</dd> <dd>Email address( Current )</dd> <dd>Email address( Update )</dd> <dd>Institution ( Current )</dd> <dd>Institution ( Update )</dd> <dd>Address ( Current )</dd> <dd>Address ( Update )</dd> <dd>Phone ( Current )</dd> <dd>Phone ( Update )</dd> <dd>FAX ( Current )</dd> <dd>FAX ( Update )</dd> </dl>  <dl> <dt>[For all subjects]</dt> <dd>Message</dd> </dl> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Contact form,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/contact-form-not-displayed-e.html">Contact form is not displayed</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2017-08-28 23:37:00 +0900">2017/08/28</time></li> <li class="tag-view" data-tag="Contact form">Contact form</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p><span class="red">* Required </span><br /> Name<span class="red">*</span><br /> E-mail address<span class="red">*</span><br /> Affiliation<span class="red">*</span><br /> Title<span class="red">*</span><br /> Accession number/Submission ID<br /> D-way account<br /> Request ID<br /> User ID<br /> Contacts<span class="red">*</span></p> <p>Contacts(click the service name to send an e-mail)</p> <ul> <li><a href="mailto:ddbjsub@ddbj.nig.ac.jp">DDBJ Nucleotide Sequence Submission System (NSSS)</a></li> <li><a href="mailto:ddbjupdt@ddbj.nig.ac.jp">Data updates / Corrections</a></li> <li><a href="mailto:mass@ddbj.nig.ac.jp">Mass Submission System (MSS)</a></li> <li><a href="mailto:trace@ddbj.nig.ac.jp">BioProject/BioSample/Sequence Read Archive (DRA)</a></li> <li><a href="mailto:dway@ddbj.nig.ac.jp">Submission account D-way</a></li> <li><a href="mailto:jga@ddbj.nig.ac.jp">Japanese Genotype-phenotype Archive (JGA)</a></li> <li><a href="mailto:ddbj@ddbj.nig.ac.jp">Search / Analysis</a></li> <li><a href="mailto:pipeline_dev@ddbj.nig.ac.jp">DDBJ Read Anotation Pipeline</a></li> <li><a href="mailto:ddbjing@ddbj.nig.ac.jp">Training course</a></li> <li><a href="mailto:sc-info@nig.ac.jp">NIG SuperComputer system</a></li> <li><a href="mailto:ddbj@ddbj.nig.ac.jp">Other</a></li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="PR,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/subscribe-change-unsbscribe-mail-mag-e.html">How to subscribe, change E-mail address, or unsubscribe to DDBJ Mail Magazine?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2017-10-14 19:08:00 +0900">2017/10/14</time></li> <li class="tag-view" data-tag="PR">PR</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>You can request from (/subscribe-ddbj-e.html)[Application for DDBJ Mail Magazine]” page.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags=",gea"> <div class="upper"> <h2 class="title"> <a href="/faq/en/gea-exchange-e.html">Do GEA, ArrayExpress and GEO exchange data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2018-07-25 20:19:00 +0900">2018/07/25</time></li> <li class="tag-view" data-tag="gea" title="Genomic Expression Archive (GEA)">GEA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Mutual data exchange between <a href="https://www.ncbi.nlm.nih.gov/geo/">NCBI GEO</a> and <a href="https://www.ebi.ac.uk/arrayexpress/">ArrayExpress</a> is not realized so GEA data are not shared with GEO. ArrayExpress had been imported GEO data, however, this import was suspended.</p> <p>BioProject and BioSample registered during GEA submission are exchanged with NCBI/EBI in the framework of INSDC.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Mass Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/mss-submission-flow-e.html">Could you show me the registration flow for MSS?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2020-11-25 20:19:00 +0900">2020/11/25</time></li> <li class="tag-view" data-tag="Mass Submission System">Mass Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please visit the <a href="/ddbj/mss-e.html">MSS - Mass Submission System</a> for detail.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Mass Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/mss-submission-sequence-e.html">Can only sequence file be accepted for an MSS submission?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2020-11-25 20:19:00 +0900">2020/11/25</time></li> <li class="tag-view" data-tag="Mass Submission System">Mass Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>No. Both annotation and sequence files are necessary for an MSS submission. <br /> Please visit the following sites for detailed instructions to prepare submission files.</p> <ul> <li><a href="/ddbj/file-format-e.html#sequence">Sequence file</a></li> <li><a href="/ddbj/file-format-e.html#annotation">Annotation file</a></li> <li><a href="/ddbj/file-format-e.html#sample">Sample annotation file</a></li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="System,Data release,ddbj,dra,gea,jga"> <div class="upper"> <h2 class="title"> <a href="/faq/en/reviewer-access-e.html">How to provide my private data to journal reviewers?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2020-12-11 03:14:34 +0900">2020/12/11</time></li> <li class="tag-view" data-tag="System">System</li> <li class="tag-view" data-tag="Data release">Data release</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> <li class="tag-view" data-tag="gea" title="Genomic Expression Archive (GEA)">GEA</li> <li class="tag-view" data-tag="jga" title="Japanese Genotype-phenotype Archive (JGA)">JGA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>By using the <a href="/gea/reviewer-access-e.html">GEA reviewer access</a>, you can provide metadata, microarray data and NGS processed data to reviewers.</p> <p>Reviewer access services are not available in <a href="/dra/index-e.html">DRA</a>, <a href="/ddbj/index-e.html">DDBJ</a> and <a href="/jga/index-e.html">JGA</a>.</p> <p>For DDBJ, see <a href="/faq/ja/paper-show-referee-e.html">‘On the process of submission of a paper to a journal, we have to show the referee our nucleotide sequence submitted as “Hold-Until-Published” status’</a>.</p> <p>For DRA, you may send a metadata summary list attached to the accession number notification e-mail. For sequencing data, download <a href="/dra/submission-e.html#fastq-sra-files">archived fastq files</a> and provide them to reviewers through access-controlled file sharing services or servers.</p> <p>For JGA, we can not offer the reviewer access service due to <a href="https://humandbs.dbcls.jp/faq#faq-20">the policy</a>.</p> <p>For open-access GEA/DRA/DDBJ/MetaboBank, if you make your data public, all users including reviewers can access the data.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="System,jga"> <div class="upper"> <h2 class="title"> <a href="/faq/en/sftp-e.html">The JGA server is not accessible by sftp</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-05-05 15:46:24 +0900">2021/05/05</time></li> <li class="tag-view" data-tag="System">System</li> <li class="tag-view" data-tag="jga" title="Japanese Genotype-phenotype Archive (JGA)">JGA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Confirm the following points.</p> <ul> <li>Authentification is by using SSH key not by password.</li> <li>A private key is pair of a public key registered in a D-way account. <a href="/account-e.html#public-key">Manual</a></li> <li>Make sure to specify a private key for authentification and not a private key for dataset encryption/decryption. <a href="/jga/download-e.html#data-use-approval-download">Manual</a></li> <li>A private key file has read permission.</li> <li>A private key file permission is set as others cannot access. For example, rw——-.</li> <li>A passphrase for private key is correctly entered.</li> <li>The ssh connection with the port number 443 is allowed in your network (Please ask your network administrator)</li> </ul> <p>When transferring data files by using a private key generated in the other operating system, please check format of a private key. <a href="/account-e.html#convert-private-key">Convert private key</a></p> <ul> <li>In Unix/Mac OS X: Convert a key in the Windows PuTTY file format into the OpenSSH.</li> <li>In Windows WinSCP: Convert a key in the Unix/Mac OS X OpenSSH file format into the Windows PuTTY format.</li> </ul> <p>When these are correct, because we do not support technical details regarding use of third-party softwares, please refer to websites of softwares or confirm your system administrators whether ssh (in the case of JGA, port 443) is allowed or not.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Sequencing data,dta,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/trace-archive-e.html">Where to submit sequencing traces (chromatograms)?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-05-16 19:21:37 +0900">2021/05/16</time></li> <li class="tag-view" data-tag="Sequencing data">Sequencing data</li> <li class="tag-view" data-tag="dta" title="DDBJ Trace Archive (DTA)">DTA</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Because the <a href="/dta/index-e.html">DDBJ Trace Archive</a> will be integrated to SRA, we do not accept sequencing traces (chromatograms).<br /> Please submit fastq files (bases and quality values) to DRA by choosing a Genetic Analyzer series instrument in the DRA Experiment <a href="/dra/metadata-e.html#Instrument">Instrument Model</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,bioproject,biosample,ddbj,dra,gea,metabobank"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cite-accession-e.html">Which accession numbers should be cited in publication?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-05-24 20:59:04 +0900">2021/05/24</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="bioproject" title="BioProject">BioProject</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> <li class="tag-view" data-tag="gea" title="Genomic Expression Archive (GEA)">GEA</li> <li class="tag-view" data-tag="metabobank" title="MetaboBank">MetaboBank</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Please cite accession numbers according to journal instructions.<br /> It is recommended to cite accession numbers assigned to your data submissions, e.g. the DDBJ nucleotide sequence or DRA Run accession numbers.<br /> Please cite a BioProject accession to reference all data from the project. It is necessary that metadata are described to enable users understand relationship between data in the publication and in the databases.</p> <h2 id="ddbj">DDBJ</h2> <p>Cite accession number(s) assigned to nucleotide sequence(s). <br /> <a href="/prefix-e.html">Prefix Letter List</a></p> <h2 id="dra">DRA</h2> <p>Cite Run accession number(s) (prefix DRR) assigned to sequencing reads. <a href="/dra/metadata-e.html">Metadata</a> <br /> Please cite a BioProject accession to reference all data from the project. It is necessary that metadata are described to enable users understand relationship between data in the publication and in the databases.<br /> Because data cannot be added to existing DRA submission, more than one DRA submission accessions will be created after data addition (<a href="/dra/update-e.html">Update</a>). Therefore, citing DRA submission accessions (prefix DRA) is not recommended. Instead, we recommend to cite a BioProject accession.</p> <h2 id="gea">GEA</h2> <p>Cite Experiment accession “E-GEAD-n”.<br /> <a href="/gea/overview-e.html#acc">GEA Accession</a></p> <h2 id="metabobank">MetaboBank</h2> <p>Cite Study accession “MTBKSn”.<br /> <a href="/metabobank/submission-e.html#accession">MetaboBank Accession</a></p> <h2 id="bioproject">BioProject</h2> <p>If an individual BioProject needs to be referenced, state that “The data have been deposited with links to BioProject accession number PRJDBxxxxxx in the DDBJ BioProject database.” along with the accession numbers assigned to the data submissions.</p> <h2 id="biosample">BioSample</h2> <p>If an individual BioSample needs to be referenced, state that “BioSample metadata are available in the DDBJ BioSample database under accession number SAMDxxxxxxxx”.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data release,ddbj,bioproject,biosample,dra,gea,metabobank"> <div class="upper"> <h2 class="title"> <a href="/faq/en/request-release-e.html">How to request data release?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-05-26 03:14:34 +0900">2021/05/26</time></li> <li class="tag-view" data-tag="Data release">Data release</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> <li class="tag-view" data-tag="bioproject" title="BioProject">BioProject</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> <li class="tag-view" data-tag="gea" title="Genomic Expression Archive (GEA)">GEA</li> <li class="tag-view" data-tag="metabobank" title="MetaboBank">MetaboBank</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If you want to release your data, specify DDBJ/DRA/GEA/MetaboBank accession numbers to be released.</p> <table class="table_faq"> <thead> <tr> <th>Database</th> <th>Example of Accession number</th> <th>How to request</th> </tr> </thead> <tbody> <tr> <td>DDBJ</td> <td>AB12345678, ABCDEF010123456　</td> <td><a href="https://forms.gle/TcvmVvw4faD2DV4fA">Application Form for Data Update Requests form</a></td> </tr> <tr> <td>DRA</td> <td>DRR000001</td> <td>Login to <a href="https://ddbj.nig.ac.jp/D-way">D-way</a> and <a href="/dra/update-e.html#change-hold-date">change the hold date</a></td> </tr> <tr> <td>GEA</td> <td>E-GEAD-1</td> <td><a href="https://forms.gle/TtzttjjxShnJ1LxdA">GEA update request form</a></td> </tr> <tr> <td>MetaboBank</td> <td>MTBKS1</td> <td><a href="https://forms.gle/5TAMFHAWmhjZTrny7">MeatboBank Update request form</a></td> </tr> <tr> <td>BioProject</td> <td>PRJDB1</td> <td><a href="https://forms.gle/d9cZxyzQzxPMSqW59">BioProject/BioSample/DRA update request form</a></td> </tr> <tr> <td>BioSample</td> <td>SAMD00000001</td> <td><a href="https://forms.gle/d9cZxyzQzxPMSqW59">BioProject/BioSample/DRA update request form</a></td> </tr> </tbody> </table> <h4 id="how-are-linked-bioprojectbiosampleexperimental-data-released">How are linked BioProject/BioSample/experimental data released?</h4> <p>FAQ: <a href="/faq/en/bp-bs-seq-release-e.html">How are linked BioProject/BioSample/sequence data released?</a></p> <ul> <li>When only BioProject accession is informed, only the BioProject record is released and related data are not released.</li> <li>When only BioSample accession is informed, only the BioSample record is released and related data are not released.</li> <li>DDBJ/DRA/GEA/MetaboBank data release triggers relase of referencing BioProject and BioSample.</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Submission,ddbj,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/how-to-submit-seq-related-bol-e.html">How to submit sequence data related to the Barcode of Life (BoL)?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-06-19 00:06:09 +0900">2021/06/19</time></li> <li class="tag-view" data-tag="Submission">Submission</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>For sequence data related to the <a href="https://ibol.org/">Barcode of Life project</a>, submit nucletide sequence(s) to <a href="/ddbj/index-e.html">DDBJ</a>.</p> <p>Because all data in <a href="https://trace.ncbi.nlm.nih.gov/Traces/trace.cgi?view=list_arrivals">Trace Archive</a> will be migrated to <a href="https://www.ncbi.nlm.nih.gov/sra">SRA</a>, <a href="/dta/index-e.html">DDBJ Trace Archive</a> no longer accepts trace data. You may submit fastq files from Sanger-type sequencers to <a href="/dra/submission-e.html">DRA</a>. Submit fastq files and select a Sanger-type sequencer in the Experiment <a href="/dra/metadata-e.html#Instrument">Instrument Model</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="attributes,biosample"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cannot-upload-attribute-file-e.html">BioSample attribute file cannot be uploaded.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-09-22 19:00:00 +0900">2021/09/22</time></li> <li class="tag-view" data-tag="attributes">attributes</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <h3 id="header">Header must be enter with sample name</h3> <p>If you upload an Excel file instead of a tab-separated text (tsv) file, an error will occur. <br /> If you are uploading a tsv file, please fill in the sample information from the second line, one sample per line.</p> <p>Please refer to the <a href="https://docs.google.com/spreadsheets/d/1zVgr1JWDVsHwotDBfhhp32KCp8cKCv83UQ3Hygmcewg/edit#gid=726659595">example of BioSample submission files</a>.</p> <p>For other messages and validation rules, please see the <a href="/biosample/validation-e.html">Validation rules page</a> and upload the revised file.</p> <p><a href="/assets/images/books/bs-tsv-1.jpg" title="Example of valid tsv file" class="group1"><img src="/assets/images/books/bs-tsv-1.jpg" alt="Example of valid tsv file" title="Example of valid tsv file" class="w600" /></a></p> <p><a href="/assets/images/books/bs-tsv-2.jpg" title="Example of invalid tsv file which lacks a header" class="group1"><img src="/assets/images/books/bs-tsv-2.jpg" alt="Example of invalid tsv file which lacks a header" title="Example of invalid tsv file which lacks a header" class="w600" /></a></p> <p><a href="/assets/images/books/bs-tsv-3.jpg" title="Example of invalid tsv file which has a blank line between sample lines" class="group1"><img src="/assets/images/books/bs-tsv-3.jpg" alt="Example of invalid tsv file which has a blank line between sample lines" title="Example of invalid tsv file which has a blank line between sample lines" class="w600" /></a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Downloading files,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/fastq-not-found-e.html">Are fastq files of NCBI/ENA SRA not available?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-12-09 19:39:46 +0900">2021/12/09</time></li> <li class="tag-view" data-tag="Downloading files">Downloading files</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>We have stopped to generating fastq files from mirrored NCBI/ENA SRA data to save storage spaces since 11th December 2019. We have generated and will generate fastq files of DRA data.</p> <ul> <li>NCBI SRA: sra file only</li> <li>ENA SRA: sra and fastq files</li> <li>DDBJ SRA: Before 10th December 2019, sra and fastq files. After 11th December 2019, fastq of DRA only.</li> </ul> <table> <thead> <tr> <th>Archive</th> <th>sra files</th> <th>NCBI SRA fastq</th> <th>ENA SRA fastq</th> <th>DDBJ SRA fastq</th> </tr> </thead> <tbody> <tr> <td>NCBI SRA</td> <td>O</td> <td>X</td> <td>X</td> <td>X</td> </tr> <tr> <td>ENA SRA</td> <td>O</td> <td>O</td> <td>O</td> <td>O</td> </tr> <tr> <td>DDBJ SRA</td> <td>O</td> <td>X (since 2019-12-10)</td> <td>X (since 2019-12-10)</td> <td>O</td> </tr> </tbody> </table> <p>For NCBI/ENA SRA data whose fastq files are not generated, you may obtain the fastq as follows.</p> <h3 id="ena">Download from ENA</h3> <p>If ENA has generated fastq of the Run of your interest (for example, ERR3350433), you may download the fastq from ENA.</p> <p><a href="https://www.ebi.ac.uk/ena/browser/view/ERR3350433?show=reads">ERR3350433</a></p> <figure><a href="/assets/images/books/ena-sra-fastq.jpg" title="Download fastq from ENA"><img src="/assets/images/books/ena-sra-fastq.jpg" alt="Download fastq from ENA" title="Download fastq from ENA" class="w450" /></a> <figcaption class="caption">Download fastq from ENA</figcaption> </figure> <h3 id="dra">Generating fastq from DRA mirrored sra file</h3> <p>Search the Run in <a href="https://ddbj.nig.ac.jp/search?query=%22ERR3350433%22">DDBJ Search</a>. <br /> Example; <a href="https://ddbj.nig.ac.jp/resource/sra-run/ERR3350433">ERR3350433</a></p> <figure><a href="/assets/images/books/ddbj-sra-download.jpg" title="Download the sra file from DRA"><img src="/assets/images/books/ddbj-sra-download.jpg" alt="Download the sra file from DRA" title="Download the sra file from DRA" class="w250" /></a> <figcaption class="caption">Download the sra file from DRA</figcaption> </figure> <p>sra filepath;</p> <ul> <li>https://ddbj.nig.ac.jp/public/ddbj_database/dra/sralite/ByExp/litesra/ERX/ERX337/ERX3374941/ERR3350433/ERR3350433.sra</li> <li>ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra/sralite/ByExp/litesra/ERX/ERX337/ERX3374941/ERR3350433/ERR3350433.sra</li> </ul> <p>Please see <a href="https://github.com/ncbi/sra-tools/wiki/08.-prefetch-and-fasterq-dump">How to use prefetch and fasterq-dump to extract FASTQ-files from SRA-accessions</a> regarding how to generate fastq from sra.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Decryption,jga"> <div class="upper"> <h2 class="title"> <a href="/faq/en/decryption-error-e.html">Unable to decrypt JGA data</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2022-03-09 18:35:51 +0900">2022/03/09</time></li> <li class="tag-view" data-tag="Decryption">Decryption</li> <li class="tag-view" data-tag="jga" title="Japanese Genotype-phenotype Archive (JGA)">JGA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If you decrypt JGA data by using a PuTTY-format private key, an “Unable to load Private Key” error will be shown. <br /> <a href="/account-e.html#convert-private-key">Convert a PuTTY-format private key into an OpenSSH-format key</a> and use the OpenSSH-format private key. <br /> Both OpenSSH and PuTTY format public keys can be registered in data use applications, you do not need to convert the registered public key format.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="attributes,biosample"> <div class="upper"> <h2 class="title"> <a href="/faq/en/biosample-attributes-e.html">How to find an appropriate BioSample attribute?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-06 18:52:37 +0900">2023/09/06</time></li> <li class="tag-view" data-tag="attributes">attributes</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Here is an example of how to find an appropriate attribute to describe “transplant recipient tissues”.</p> <h3 id="ncbi-biosample">NCBI BioSample</h3> <p>If you have some idea, you may grasp the overview by seeing attribute name and their numbers in the NCBI BioSample <a href="https://www.ncbi.nlm.nih.gov/biosample/advanced">Advanced Search Builder</a>.</p> <p>Select “Attribute Name” for the field name and input “transplant”, then names and their numbers are displayed. You may find most used name. If you want to see BioSample records using the name, select the name and search.</p> <div class="figure"> <a class="group1" href="/assets/images/faq/ncbi-bs-advanced.jpg" title="Advanced Search Builder"> <figure class="image"> <img src="/assets/images/faq/ncbi-bs-advanced.jpg" alt="Advanced Search Builder" class="w600" /> <figcaption>Advanced Search Builder</figcaption> </figure> </a> </div> <h3 id="biosample-dump-file">BioSample dump file</h3> <p>Download the BioSample XML file which contains all public records.</p> <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>wget https://ddbj.nig.ac.jp/public/ddbj_database/biosample/biosample_set.xml.gz </code></pre></div></div> <p>Search attribute names and values by using grep.</p> <div class="language-plaintext highlighter-rouge"><div class="highlight"><pre class="highlight"><code>grep "attribute_name=\"transplant" biosample_set.xml <Attribute attribute_name="transplant">intertidal</Attribute> <Attribute attribute_name="transplant">subtidal</Attribute> <Attribute attribute_name="transplant">subtidal</Attribute> <Attribute attribute_name="transplant">intertidal</Attribute> <Attribute attribute_name="transplanted with">non-targeting scramble shRNA control MLL-AF9 primary AML</Attribute> <Attribute attribute_name="transplanted with">non-targeting scramble shRNA control MLL-AF9 primary AML</Attribute> <Attribute attribute_name="transplanted with">Cdkn1b specific shRNA expressing MLL-AF9 primary AML</Attribute> ... </code></pre></div></div> </div> </li> <li class="tagging-item-view taggingitem" data-tags="spatiotemporal,biosample,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/ancient-dna-sample-e.html">I have an ancient DNA sample - how do I provide the spatiotemporal information for my sample?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-10 21:39:51 +0900">2023/09/10</time></li> <li class="tag-view" data-tag="spatiotemporal">spatiotemporal</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>For ancient DNA samples, the location and date to be reported depend on what information is important to interpret the sequencing data from the samples. If the original geographic location and original collection date are known and important to interpret the data, provide these information. If the sample was from a museum and the location of the museum and time of collection are important to interpret the data, enter these location and time. If relevant information does not exist, enter one of <a href="/biosample/submission-e.html#missing-value-reporting">the missing values</a>, e.g. “not collected”.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="spatiotemporal,biosample,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/appropriate-exemption-not-found-e.html">I am not able to report on my spatiotemporal metadata but my exemption reason is not on the list - what should I do?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-10 21:39:51 +0900">2023/09/10</time></li> <li class="tag-view" data-tag="spatiotemporal">spatiotemporal</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>If you feel unable to share these metadata but your exemption is not on <a href="/biosample/submission-e.html#missing-value-reporting">the list</a>, please <a href="/contact-ddbj-e.html">contact us</a>.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="spatiotemporal,biosample,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/data-agreement-established-pre-2023-e.html">As part of my consortium, we set up an agreement that the data would be submitted to INSDC but that all metadata would not be shared until after 2 years. This agreement was organised prior to the standards change so we can’t comply. How do I report this?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-10 21:39:51 +0900">2023/09/10</time></li> <li class="tag-view" data-tag="spatiotemporal">spatiotemporal</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>This is considered a valid <a href="(/biosample/submission-e.html#missing-value-reporting)">exemption</a> as we recognise that some consortia will have agreements that pre-date the new standard and you can report this as a reason that the metadata are missing.</p> <p>In this case, during initial sample registration you would report:</p> <ul> <li>geo_loc_name (or /country) = missing: data agreement-established pre-2023</li> <li>collection date = missing: data agreement-established pre-2023</li> </ul> <p>Submissions can be updated at a later date to include the missing metadata.</p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="spatiotemporal,biosample,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/either-one-of-location-and-date-cannot-be-described-e.html">What do I do if I can submit one of the mandatory fields but not the other?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-10 21:39:51 +0900">2023/09/10</time></li> <li class="tag-view" data-tag="spatiotemporal">spatiotemporal</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>We recognise there may be valid exemptions for this which are included for <a href="/biosample/submission-e.html#missing-value-reporting">missing value reporting</a>. For example, you may have collected a control sample from a collection instrument to sequence a negative control. In this case, the location of where you collected that control is not applicable to report as it was prepared in a lab but you could report the date in which you collected the control sample.</p> <p>In this case, you would report:</p> <ul> <li>geo_loc_name (or /country) = missing: control sample</li> <li>collection date = 2020-05-25</li> </ul> </div> </li> <li class="tagging-item-view taggingitem" data-tags=",gea"> <div class="upper"> <h2 class="title"> <a href="/faq/en/cibex-e.html">How to access CIBEX data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2025-02-09 20:19:00 +0900">2025/02/09</time></li> <li class="tag-view" data-tag="gea" title="Genomic Expression Archive (GEA)">GEA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> <p>Bioinformation and DDBJ Center had operated the gene expression database “CIBEX” (Center for Information Biology gene Expression database) until March 2012. All CIBEX date were migrated to GEA (Genomic Expression Archive).</p> <p>Query BioProject with a CIBEX accession number (for example, CBX114) in DDBJ Search and follow a link to a corresponding GEA data.</p> <ul> <li><a href="https://ddbj.nig.ac.jp/search?query=%22CBX114%22&isPartOf=%5B%22BioProject%22%5D">DDBJ Search: BioProject CBX114</a></li> <li><a href="https://ddbj.nig.ac.jp/search/entry/bioproject/PRJDB20087">BioProject: PRJDB20087</a></li> <li><a href="https://ddbj.nig.ac.jp/public/ddbj_database/gea/experiment/E-GEAD-000/E-GEAD-986/">GEA: E-GEAD-986</a></li> </ul> <p>A CIBEX accession number is retained in a GEA IDF metadata.</p> <table class="table_faq"> <tbody> <tr> <td>Comment[GEAAccession]</td> <td>E-GEAD-986</td> </tr> <tr> <td>Comment[SecondaryAccession]</td> <td>CBX114</td> </tr> <tr> <td>Comment[BioProject]</td> <td>PRJDB20087</td> </tr> </tbody> </table> <p><a href="https://ddbj.nig.ac.jp/search?query=%22CIBEX%22&isPartOf=%5B%22BioProject%22%5D">GEA data migrated from CIBEX</a></p> </div> </li> <li class="tagging-item-view taggingitem" data-tags="Analysis,blast"> <div class="upper"> <h2 class="title"> <a href="/faq/en/interpret-search-results-e.html">How do I interpret the search results?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2015-06-04 23:50:20 +0900">2015/06/04</time></li> <li class="tag-view" data-tag="Analysis">Analysis</li> <li class="tag-view" data-tag="blast" title="BLAST">BLAST</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> Search results are displayed in the following order. 1. Precedence table of sequences with high homology scores 1. Homologous sequences and their alignment 1. Parameters and statistics Note that the symbol “|” in the BLAST search results for nucleotide sequences indicates agreement between nucleotide sequences. For amino-acid sequences, matching amino acids will be displayed. The symbol “+” is used to indicate similarities between amino acids. For further details, refer the original papers on BLAST. [BLAST Reference](/blast-e.html#reference) </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data exchange,jga"> <div class="upper"> <h2 class="title"> <a href="/faq/en/jga-dbgap-ega-e.html">Do DDBJ JGA/NCBI dbGaP/EBI EGA exchange data?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2016-07-01 22:38:42 +0900">2016/07/01</time></li> <li class="tag-view" data-tag="Data exchange">Data exchange</li> <li class="tag-view" data-tag="jga" title="Japanese Genotype-phenotype Archive (JGA)">JGA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> [DDBJ JGA](/jga/index-e.html) / [NCBI dbGaP](https://www.ncbi.nlm.nih.gov/gap) / [EBI EGA](https://www.ebi.ac.uk/ega) do not exchange data. </div> </li> <li class="tagging-item-view taggingitem" data-tags="Data transfer,bioproject,biosample,ddbj,dra,gea"> <div class="upper"> <h2 class="title"> <a href="/faq/en/known-hosts-e.html">Access to the ftp-private is blocked by the remote host key identification warning.</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-09-28 18:16:30 +0900">2021/09/28</time></li> <li class="tag-view" data-tag="Data transfer">Data transfer</li> <li class="tag-view" data-tag="bioproject" title="BioProject">BioProject</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> <li class="tag-view" data-tag="gea" title="Genomic Expression Archive (GEA)">GEA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> The BioProject/BioSample/DRA/GEA systems have been migrated to new supercomputer at 28th September 2021. Due to this migration, access to ftp-private.ddbj.nig.ac.jp may be blocked by the remote host key identification warning. ``` @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ @ WARNING: POSSIBLE DNS SPOOFING DETECTED! @ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ The RSA host key for ftp-private.ddbj.nig.ac.jp has changed, and the key for the corresponding IP address 133.39.224.111 is unknown. This could either mean that DNS SPOOFING is happening or the IP address for the host and its host key have changed at the same time. @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ @ WARNING: REMOTE HOST IDENTIFICATION HAS CHANGED! @ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ IT IS POSSIBLE THAT SOMEONE IS DOING SOMETHING NASTY! Someone could be eavesdropping on you right now (man-in-the-middle attack)! It is also possible that a host key has just been changed. The fingerprint for the RSA key sent by the remote host is SHA256:MQi8isve0moRNQj/9z73dZy6lBcprrd5p87ynoznZ3o. Please contact your system administrator. Add correct host key in /home/test07/.ssh/known_hosts to get rid of this message. Offending RSA key in /home/test07/.ssh/known_hosts:11 remove with: ... snipped ... RSA host key for ftp-private.ddbj.nig.ac.jp has changed and you have requested strict checking. Host key verification failed. lost connection ``` Delete a line where "ftp-private.ddbj.nig.ac.jp" or the IP address "133.39.224.111" are recorded from the known_hosts file under your home directory (for example, test07). /home/test07/.ssh/known_hosts You may know the line number to be deleted from the warning message (example below is 11). ``` Offending RSA key in /home/test07/.ssh/known_hosts:11 ``` After deleting the line of the known_hosts file, access to the server. Because the access is regarded as a first time access, you are asked whether record the server key or not. Please select "yes" and access the server. </div> </li> <li class="tagging-item-view taggingitem" data-tags="attributes,biosample"> <div class="upper"> <h2 class="title"> <a href="/faq/en/taxonomy-for-non-organism-e.html">Which taxonomy ID should be used for non-organism samples such as reference compound and buffer?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2021-11-11 11:27:55 +0900">2021/11/11</time></li> <li class="tag-view" data-tag="attributes">attributes</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> Use the following taxonomy IDs for non-organism samples commonly used for metabolomics experiments. * [blank sample (taxid: 2582415)](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=2582415) * [unidentified (taxid: 32644)](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=32644) </div> </li> <li class="tagging-item-view taggingitem" data-tags="Metadata,biosample,metabobank"> <div class="upper"> <h2 class="title"> <a href="/faq/en/organism-for-material-e.html">Which organism name should I use for non-living sample?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2022-04-26 10:54:06 +0900">2022/04/26</time></li> <li class="tag-view" data-tag="Metadata">Metadata</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="metabobank" title="MetaboBank">MetaboBank</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> It is common to analyze non-living material samples in metabolomics experiments. For these samples, choose an appropriate name from [metagenomes](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=408169&lvl=3&keep=1&srchmode=1&unlock) of NCBI Taxonomy (please think excluding metagenome). Here are a few examples. * food sample: [food metagenome](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=870726&lvl=3&lin=f&keep=1&srchmode=1&unlock) * soil sample: [soil metagenome](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=410658&lvl=3&lin=f&keep=1&srchmode=1&unlock) For some non-living samples, please use names other than [metagenomes](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=408169&lvl=3&keep=1&srchmode=1&unlock). * blank measurement: "[blank sample](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?name=blank+sample)" * reference compound: "[unidentified](https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=32644)" </div> </li> <li class="tagging-item-view taggingitem" data-tags="Mass Submission System,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/mss-submission-transfer-e.html">How can I submit files when the files are too large or too many to upload from the MSS form?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2022-06-17 09:00:00 +0900">2022/06/17</time></li> <li class="tag-view" data-tag="Mass Submission System">Mass Submission System</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> If you are unable to upload submission files from the MSS form, please [upload the files by SFTP](/upload-e.html). </div> </li> <li class="tagging-item-view taggingitem" data-tags="metadata,metabobank"> <div class="upper"> <h2 class="title"> <a href="/faq/en/isotope-labeling-e.html">How to describe samples labeled by isotopes?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2022-08-05 18:52:37 +0900">2022/08/05</time></li> <li class="tag-view" data-tag="metadata">metadata</li> <li class="tag-view" data-tag="metabobank" title="MetaboBank">MetaboBank</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> ### Samples are metabolically labeled by isotopes When samples are labeled by metabolically uptaking stable isotopes (metabolic isotope labeling), describe isotope-labeled compounds in the “isotope_labeled_compound” attributes of BioSample records. Stable isotopes are described in the “isotope” attributes. * isotope_labeled_compound=[U-13C]-glucose * isotope=13C In the SDRF rows correspond to the samples, describe the compounds and isotopes in the Characteristics columns. |Characteristics[isotope_labeled_compound]|Characteristics[isotope]| |[U-13C]-glucose|13C| In this case, isotopes are described at sample-level, so the Labeled Extract Name and Label column values can be left empty. ### Extracted metabolites are chemically labeled by isotopes When samples are chemically labeled by isotopes (chemical isotope labeling), describe isotopes in the SDRF Label column and isotope-labeled compounds in the Comment[isotope_labeled_compound] column. |Labeled Extract Name|Label|Comment[isotope_labeled_compound]| |human urine sample 1 12C|12C|12C-dansyl chloride| |human urine pooled sample 13C|13C|13C-dansyl chloride| In this case, isotopes are described at the extract-level, so BioSample records may not contain attributes for isotopes. </div> </li> <li class="tagging-item-view taggingitem" data-tags="Accession number,dra"> <div class="upper"> <h2 class="title"> <a href="/faq/en/sra-secondary-accession-e.html">What is a SRA secondary accession?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-03-16 20:16:30 +0900">2023/03/16</time></li> <li class="tag-view" data-tag="Accession number">Accession number</li> <li class="tag-view" data-tag="dra" title="Sequence Read Archive (DRA)">DRA</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> If a public SRA Run is replaced by a new Run, the previous accession will be a secondary accession of the new one to track replacement. For example, when DRR046787 was replaced by DRR049544, DRR049544 became primary and DRR046787 became secondary accession (below is the DRR049544 Run XML). ``` <RUN accession="DRR049544" center_name="HOKU_FS" alias="DRR049544"> <IDENTIFIERS> <PRIMARY_ID>DRR049544</PRIMARY_ID> <SECONDARY_ID>DRR046787</SECONDARY_ID> </IDENTIFIERS> <TITLE>454 GS Junior sequencing of SAMD00041397</TITLE> <EXPERIMENT_REF accession="DRX042075" refcenter="HOKU_FS" refname="DRX042075"/> </RUN> ``` DRR049544 is displayed when searching DRR046787 at NCBI SRA ([https://ncbi.nlm.nih.gov/sra/DRR046787](https://ncbi.nlm.nih.gov/sra/DRR046787)) . In the NCBI SRA Run Browser, the secondary DRR046787 is displayed in small characters with the primary DRR049544 ([DRR049544](https://trace.ncbi.nlm.nih.gov/Traces/?view=run_browser&acc=DRR049544&display=metadata)). Secondary accessions of Experiment DRX and Submission DRA are treated similarly. </div> </li> <li class="tagging-item-view taggingitem" data-tags="spatiotemporal,biosample,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/location-and-date-of-sample-e.html">My sample was collected in Shizuoka of Japan at 14:12:55 on the 5th May 2023. How do I format this for submission?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-10 21:39:51 +0900">2023/09/10</time></li> <li class="tag-view" data-tag="spatiotemporal">spatiotemporal</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> You should report the collection date in the format year-month-day followed by the time in ISO8601 standard format. Collection times must be in Coordinated Universal Time (UTC). You should report the country and the region in an related field. For example: * geo_loc_name (or /country) = Japan:Shizuoka * collection date = 2023-05-05T05:12:55 </div> </li> <li class="tagging-item-view taggingitem" data-tags="spatiotemporal,biosample,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/sample-from-collection-e.html">I cultured and sequenced a bacterial strain distributed from a culture collection. How should I describe the location and time?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-10 21:39:51 +0900">2023/09/10</time></li> <li class="tag-view" data-tag="spatiotemporal">spatiotemporal</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> Enter the collection code and ID in [culture_collection](/biosample/attribute-e.html#culture_collection), and provide original location and date recorded in the collection. If original information is not known, use "not collected" of [missing values](/biosample/submission-e.html#missing-value-reporting). If the strain has been subcultured for a long term and its nature is changed, provide the date of sampling for sequencing. If the laboratory location is not appropriate for reporting, use "missing: lab stock" of [exemption terms](/biosample/submission-e.html#missing-value-reporting). In this case, describe the fact that "nature of the strain was changed by long-term subculture at the laboratory" in description. Example: [Arthrospira platensis NIES-39 strain](https://mcc.nies.go.jp/strainList.do?strainId=37&strainNumberEn=NIES-39) of the Microbial Culture Collection at the National Institute for Environmental Studies (NIES Collection). Collected at Lake Chad but the date is not recorded. * geo_loc_name (or /country) = Chad: Lake Chad * collection date = not collected </div> </li> <li class="tagging-item-view taggingitem" data-tags="spatiotemporal,biosample,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/sample-from-none-natural-environment-e.html">I collected my sample for sequencing from a species outside of its natural environment (e.g. zoo, botanic garden) - how do I provide the spatiotemporal information for my sample?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-10 21:39:51 +0900">2023/09/10</time></li> <li class="tag-view" data-tag="spatiotemporal">spatiotemporal</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> For species originating elsewhere to where the sample was originally collected e.g. species in a museum, zoo, aquaculture, botanic garden or farm, describe the collection location which is useful to interpret the sequencing data obtained from the sample. If the museum, zoo, aquaculture, botanic garden or farm are important to interpret the data, enter these locations. If not, enter the location of origin. Treat the collection date in a similar manner. </div> </li> <li class="tagging-item-view taggingitem" data-tags="spatiotemporal,biosample,ddbj"> <div class="upper"> <h2 class="title"> <a href="/faq/en/sample-from-pacific-ocean-2010-e.html">My sample was collected from the Pacific Ocean but the date was not recorded and I only know the year in which it was sampled was sometime in 2010 - how do I report this?</a> </h2> <ul class="tag-list-view"> <li class="date"><time datetime="2023-09-10 21:39:51 +0900">2023/09/10</time></li> <li class="tag-view" data-tag="spatiotemporal">spatiotemporal</li> <li class="tag-view" data-tag="biosample" title="BioSample">BioSample</li> <li class="tag-view" data-tag="ddbj" title="Annotated/Assembled Sequences (DDBJ)">DDBJ</li> </ul> </div> <div class="bottom -collapsed md-content"> <div class="collapsedbutton"></div> The minimum requirement is the name of the ocean/sea (or country) of the collection event and date to the nearest year. In this case, as you know the ocean and the year of collection, there is no reason that you can not share these metadata. You would report: * geo_loc_name (or /country) = Pacific Ocean * collection_date = 2010 </div> </li> </ul> </main> </div> </div> </div> <footer></footer> <div id="back-top"></div> </body> </html>

CINXE.COM

FAQ