CINXE.COM

<!DOCTYPE html> <html lang="en" dir="ltr"> <head>  <script async src="https://www.googletagmanager.com/gtag/js?id=G-P63WKM1TM1"></script> <script> window.dataLayer = window.dataLayer || []; function gtag(){dataLayer.push(arguments);} gtag('js', new Date()); gtag('config', 'G-P63WKM1TM1'); </script>  <script type="text/javascript" > (function(m,e,t,r,i,k,a){m[i]=m[i]||function(){(m[i].a=m[i].a||[]).push(arguments)}; m[i].l=1*new Date(); for (var j = 0; j < document.scripts.length; j++) {if (document.scripts[j].src === r) { return; }} k=e.createElement(t),a=e.getElementsByTagName(t)[0],k.async=1,k.src=r,a.parentNode.insertBefore(k,a)}) (window, document, "script", "https://mc.yandex.ru/metrika/tag.js", "ym"); ym(55165297, "init", { clickmap:false, trackLinks:true, accurateTrackBounce:true, webvisor:false }); </script> <noscript><div><img src="https://mc.yandex.ru/watch/55165297" style="position:absolute; left:-9999px;" alt="" /></div></noscript>    <title>Search results for: encompassing nucleotide positions 37 to 340</title> <meta name="description" content="Search results for: encompassing nucleotide positions 37 to 340"> <meta name="keywords" content="encompassing nucleotide positions 37 to 340"> <meta name="viewport" content="width=device-width, initial-scale=1, minimum-scale=1, maximum-scale=1, user-scalable=no"> <meta charset="utf-8"> <link href="https://cdn.waset.org/favicon.ico" type="image/x-icon" rel="shortcut icon"> <link href="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/css/bootstrap.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/plugins/fontawesome/css/all.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/css/site.css?v=150220211555" rel="stylesheet"> </head> <body> <header> <div class="container"> <nav class="navbar navbar-expand-lg navbar-light"> <a class="navbar-brand" href="https://waset.org"> <img src="https://cdn.waset.org/static/images/wasetc.png" alt="Open Science Research Excellence" title="Open Science Research Excellence" /> </a> <button class="d-block d-lg-none navbar-toggler ml-auto" type="button" data-toggle="collapse" data-target="#navbarMenu" aria-controls="navbarMenu" aria-expanded="false" aria-label="Toggle navigation"> <span class="navbar-toggler-icon"></span> </button> <div class="w-100"> <div class="d-none d-lg-flex flex-row-reverse"> <form method="get" action="https://waset.org/search" class="form-inline my-2 my-lg-0"> <input class="form-control mr-sm-2" type="search" placeholder="Search Conferences" value="encompassing nucleotide positions 37 to 340" name="q" aria-label="Search"> <button class="btn btn-light my-2 my-sm-0" type="submit"><i class="fas fa-search"></i></button> </form> </div> <div class="collapse navbar-collapse mt-1" id="navbarMenu"> <ul class="navbar-nav ml-auto align-items-center" id="mainNavMenu"> <li class="nav-item"> <a class="nav-link" href="https://waset.org/conferences" title="Conferences in 2024/2025/2026">Conferences</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/disciplines" title="Disciplines">Disciplines</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/committees" rel="nofollow">Committees</a> </li> <li class="nav-item dropdown"> <a class="nav-link dropdown-toggle" href="#" id="navbarDropdownPublications" role="button" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"> Publications </a> <div class="dropdown-menu" aria-labelledby="navbarDropdownPublications"> <a class="dropdown-item" href="https://publications.waset.org/abstracts">Abstracts</a> <a class="dropdown-item" href="https://publications.waset.org">Periodicals</a> <a class="dropdown-item" href="https://publications.waset.org/archive">Archive</a> </div> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/page/support" title="Support">Support</a> </li> </ul> </div> </div> </nav> </div> </header> <main> <div class="container mt-4"> <div class="row"> <div class="col-md-9 mx-auto"> <form method="get" action="https://publications.waset.org/abstracts/search"> <div id="custom-search-input"> <div class="input-group"> <i class="fas fa-search"></i> <input type="text" class="search-query" name="q" placeholder="Author, Title, Abstract, Keywords" value="encompassing nucleotide positions 37 to 340"> <input type="submit" class="btn_search" value="Search"> </div> </div> </form> </div> </div> <div class="row mt-3"> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Commenced</strong> in January 2007</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Frequency:</strong> Monthly</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Edition:</strong> International</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Paper Count:</strong> 1182</div> </div> </div> </div> <h1 class="mt-3 mb-3 text-center" style="font-size:1.6rem;">Search results for: encompassing nucleotide positions 37 to 340</h1> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1182</span> Forensic Analysis of MTDNA Hypervariable Region HVII by Sanger Sequence Method in Iraq Population</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=H.%20Imad">H. Imad</a>, <a href="https://publications.waset.org/abstracts/search?q=Y.%20Cheah"> Y. Cheah</a>, <a href="https://publications.waset.org/abstracts/search?q=O.%20Aamera"> O. Aamera </a> </p> <p class="card-text"><strong>Abstract:</strong></p> The aims of this research are to study the mitochondrial non-coding region by using the Sanger sequencing technique and establish the degree of variation characteristics of a fragment. FTA® Technology (FTA™ paper DNA extraction) utilized to extract DNA. A portion of a non-coding region encompassing positions 37 to 340 amplified in accordance with the Anderson reference sequence. PCR products purified by EZ-10 spin column then sequenced and detected by using the ABI 3730xL DNA Analyzer. New polymorphic positions 57, 63, and 101 are described may in future be suitable sources for identification purpose. The data obtained can be used to identify variable nucleotide positions characterized by frequent occurrence most promising for identification variants. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340" title="encompassing nucleotide positions 37 to 340">encompassing nucleotide positions 37 to 340</a>, <a href="https://publications.waset.org/abstracts/search?q=HVII" title=" HVII"> HVII</a>, <a href="https://publications.waset.org/abstracts/search?q=Iraq" title=" Iraq"> Iraq</a>, <a href="https://publications.waset.org/abstracts/search?q=mitochondrial%20DNA" title=" mitochondrial DNA"> mitochondrial DNA</a>, <a href="https://publications.waset.org/abstracts/search?q=polymorphism" title=" polymorphism"> polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=frequency" title=" frequency"> frequency</a> </p> <a href="https://publications.waset.org/abstracts/2121/forensic-analysis-of-mtdna-hypervariable-region-hvii-by-sanger-sequence-method-in-iraq-population" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/2121.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">761</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1181</span> Polymorphic Positions, Haplotypes, and Mutations Detected In The Mitochonderial DNA Coding Region By Sanger Sequence Technique </h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Imad%20H.%20Hameed">Imad H. Hameed</a>, <a href="https://publications.waset.org/abstracts/search?q=Mohammad%20A.%20Jebor"> Mohammad A. Jebor</a>, <a href="https://publications.waset.org/abstracts/search?q=Ammera%20J.%20Omer"> Ammera J. Omer </a> </p> <p class="card-text"><strong>Abstract:</strong></p> The aim of this research is to study the mitochonderial coding region by using the Sanger sequencing technique and establish the degree of variation characteristic of a fragment. FTA® Technology (FTA™ paper DNA extraction) utilized to extract DNA. Portion of coding region encompassing positions 11719 –12384 amplified in accordance with the Anderson reference sequence. PCR products purified by EZ-10 spin column then sequenced and Detected by using the ABI 3730xL DNA Analyzer. Five new polymorphic positions 11741, 11756, 11878, 11887 and 12133 are described may be suitable sources for identification purpose in future. The calculated value D= 0.95 and RMP=0.048 of the genetic diversity should be understood as high in the context of coding function of the analysed DNA fragment. The relatively high gene diversity and a relatively low random match probability were observed in Iraq population. The obtained data can be used to identify the variable nucleotide positions characterized by frequent occurrence which is most promising for various identifications. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=coding%20region" title="coding region">coding region</a>, <a href="https://publications.waset.org/abstracts/search?q=Iraq" title=" Iraq"> Iraq</a>, <a href="https://publications.waset.org/abstracts/search?q=mitochondrial%20DNA" title=" mitochondrial DNA"> mitochondrial DNA</a>, <a href="https://publications.waset.org/abstracts/search?q=polymorphic%20positions" title=" polymorphic positions"> polymorphic positions</a>, <a href="https://publications.waset.org/abstracts/search?q=sanger%20technique" title=" sanger technique"> sanger technique</a> </p> <a href="https://publications.waset.org/abstracts/2065/polymorphic-positions-haplotypes-and-mutations-detected-in-the-mitochonderial-dna-coding-region-by-sanger-sequence-technique" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/2065.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">437</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1180</span> Heterogeneity of Genes Encoding the Structural Proteins of Avian Infectious Bronchitis Virus </h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Shahid%20Hussain%20Abro">Shahid Hussain Abro</a>, <a href="https://publications.waset.org/abstracts/search?q=Siamak%20Zohari"> Siamak Zohari</a>, <a href="https://publications.waset.org/abstracts/search?q=Lena%20H.%20M.%20Renstr%C3%B6m"> Lena H. M. Renström</a>, <a href="https://publications.waset.org/abstracts/search?q=D%C3%A9sir%C3%A9e%20S.%20Jansson"> Désirée S. Jansson</a>, <a href="https://publications.waset.org/abstracts/search?q=Faruk%20Otman"> Faruk Otman</a>, <a href="https://publications.waset.org/abstracts/search?q=Karin%20Ullman"> Karin Ullman</a>, <a href="https://publications.waset.org/abstracts/search?q=Claudia%20Baule"> Claudia Baule</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Infectious bronchitis is an acute, highly contagious respiratory, nephropathogenic and reproductive disease of poultry that is caused by infectious bronchitis virus (IBV). The present study used a large data set of structural gene sequences, including newly generated ones and sequences available in the GenBank database to further analyze the diversity and to identify selective pressures and recombination spots. There were some deletions or insertions in the analyzed regions in isolates of the Italy-02 and D274 genotypes. Whereas, there were no insertions or deletions observed in the isolates of the Massachusetts and 4/91 genotype. The hypervariable nucleotide sequence regions spanned positions 152–239, 554–582, 686–737 and 802–912 in the S1 sub-unit of the all analyzed genotypes. The nucleotide sequence data of the E gene showed that this gene was comparatively unstable and subjected to a high frequency of mutations. The M gene showed substitutions consistently distributed except for a region between nucleotide positions 250–680 that remained conserved. The lowest variation in the nucleotide sequences of ORF5a was observed in the isolates of the D274 genotype. While, ORF5b and N gene sequences showed highly conserved regions and were less subjected to variation. Genes ORF3a, ORF3b, M, ORF5a, ORF5b and N presented negative selective pressure among the analyzed isolates. However, some regions of the ORFs showed favorable selective pressure(s). The S1 and E proteins were subjected to a high rate of mutational substitutions and non-synonymous amino acids. Strong signals of recombination breakpoints and ending break point were observed in the S and N genes. Overall, the results of this study revealed that very likely the strong selective pressures in E, M and the high frequency of substitutions in the S gene can probably be considered the main determinants in the evolution of IBV. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=IBV" title="IBV">IBV</a>, <a href="https://publications.waset.org/abstracts/search?q=avian%20infectious%20bronchitis" title=" avian infectious bronchitis"> avian infectious bronchitis</a>, <a href="https://publications.waset.org/abstracts/search?q=structural%20genes" title=" structural genes"> structural genes</a>, <a href="https://publications.waset.org/abstracts/search?q=genotypes" title=" genotypes"> genotypes</a>, <a href="https://publications.waset.org/abstracts/search?q=genetic%20diversity" title=" genetic diversity"> genetic diversity</a> </p> <a href="https://publications.waset.org/abstracts/24427/heterogeneity-of-genes-encoding-the-structural-proteins-of-avian-infectious-bronchitis-virus" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/24427.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">434</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1179</span> Tenofovir-Amino Acid Conjugates Act as Polymerase Substrates: Implications for Avoiding Cellular Phosphorylation in the Discovery of Nucleotide Analogs</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Weijie%20Gu">Weijie Gu</a>, <a href="https://publications.waset.org/abstracts/search?q=Sergio%20Martinez"> Sergio Martinez</a>, <a href="https://publications.waset.org/abstracts/search?q=Hoai%20Nguyen"> Hoai Nguyen</a>, <a href="https://publications.waset.org/abstracts/search?q=Hongtao%20Xu"> Hongtao Xu</a>, <a href="https://publications.waset.org/abstracts/search?q=Piet%20Herdewijn"> Piet Herdewijn</a>, <a href="https://publications.waset.org/abstracts/search?q=Steven%20De%20Jonghe"> Steven De Jonghe</a>, <a href="https://publications.waset.org/abstracts/search?q=Kalyan%20Das"> Kalyan Das</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Nucleotide analogs are used for treating viral infections such as HIV, hepatitis B, hepatitis C, influenza, and SARS-CoV-2. To become polymerase substrates, a nucleotide analog must be phosphorylated by cellular kinases, which are rate-limiting. The goal of this study is to develop dNTP/NTP analogs directly from nucleotides. Tenofovir (TFV) analogs were synthesized by conjugating with natural or unnatural amino acids. It demonstrates that some conjugates act as dNTP analogs, and HIV-1 reverse transcriptase (RT) catalytically incorporates the TFV part as the chain terminator. X-ray structures in complex with HIV-1 RT/dsDNA showed binding of the conjugates at the polymerase active site, however, in different modes in the presence of Mg²⁺ vs. Mn²⁺ ions. The adaptability of the compounds is seemingly essential for catalytic incorporation of TFV by RT. 4d with a carboxyl sidechain demonstrated the highest incorporation. 4e showed weak incorporation and rather behaved as a dNTP-competitive inhibitor. This result advocates the feasibility of designing NTP/dNTP analogs by chemical substitutions to nucleotide analogs. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=dNTP%20analogs" title="dNTP analogs">dNTP analogs</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide%20analogs" title=" nucleotide analogs"> nucleotide analogs</a>, <a href="https://publications.waset.org/abstracts/search?q=polymerase" title=" polymerase"> polymerase</a>, <a href="https://publications.waset.org/abstracts/search?q=tenofovir" title=" tenofovir"> tenofovir</a>, <a href="https://publications.waset.org/abstracts/search?q=X-ray%20structure" title=" X-ray structure"> X-ray structure</a> </p> <a href="https://publications.waset.org/abstracts/130804/tenofovir-amino-acid-conjugates-act-as-polymerase-substrates-implications-for-avoiding-cellular-phosphorylation-in-the-discovery-of-nucleotide-analogs" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/130804.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">153</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1178</span> Phylogenetic Characterization of Atrazine-Degrading Bacteria Isolated from Agricultural Soil in Eastern Thailand</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Sawangjit%20Sopid">Sawangjit Sopid</a> </p> <p class="card-text"><strong>Abstract:</strong></p> In this study sugarcane field soils with a long history of atrazine application in Chachoengsao and Chonburi provinces have been explored for their potential of atrazine biodegradation. For the atrazine degrading bacteria isolation, the soils used in this study named ACS and ACB were inoculated in MS-medium containing atrazine. Six short rod and gram-negative bacterial isolates, which were able to use this herbicide as a sole source of nitrogen, were isolated and named as ACS1, ACB1, ACB3, ACB4, ACB5 and ACB6. From the 16S rDNA nucleotide sequence analysis, the isolated bacteria ACS1 and ACB4 were identified as Rhizobium sp. with 89.1-98.7% nucleotide identity, ACB1 and ACB5 were identified as Stenotrophomonas sp. with 91.0-92.8% nucleotide identity, whereas ACB3 and ACB6 were Klebsiella sp. with 97.4-97.8% nucleotide identity. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=atrazine-degrading%20bacteria" title="atrazine-degrading bacteria">atrazine-degrading bacteria</a>, <a href="https://publications.waset.org/abstracts/search?q=bioremediation" title=" bioremediation"> bioremediation</a>, <a href="https://publications.waset.org/abstracts/search?q=Thai%20isolates" title=" Thai isolates"> Thai isolates</a>, <a href="https://publications.waset.org/abstracts/search?q=bacteria" title=" bacteria"> bacteria</a> </p> <a href="https://publications.waset.org/abstracts/12599/phylogenetic-characterization-of-atrazine-degrading-bacteria-isolated-from-agricultural-soil-in-eastern-thailand" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/12599.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">888</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1177</span> Sex Positions Decisions and Negotiations of Sexual Pleasure and Gender in Ghana</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Daniel%20Y.%20Fiaveh">Daniel Y. Fiaveh</a>, <a href="https://publications.waset.org/abstracts/search?q=Chimaraoke%20O.%20Izugbara"> Chimaraoke O. Izugbara</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Based on the narratives of 20 women and 16 men, the paper explores how knowing more about the factors that trigger sex positions decisions advance knowledge of male and female sexuality, and how these translate into higher levels of female sexual negotiations in Ghana. Findings demonstrated that the willingness to perform sex positions or not were gendered and derive, at least in part, from differences in demographic profiles (such as age, gender, and marriage), beliefs associated with sexual practices (such as anal sex), the desire to maximize sexual pleasure, and sexual myths and misconceptions e.g. fear of infecundity. The women were not passive to sex positions decisions and engaged in a dialogical sexual encounter with men including threats of sexual refusal in negotiating sex. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=sexual%20positions" title="sexual positions">sexual positions</a>, <a href="https://publications.waset.org/abstracts/search?q=sexual%20pleasure" title=" sexual pleasure"> sexual pleasure</a>, <a href="https://publications.waset.org/abstracts/search?q=masculinity" title=" masculinity"> masculinity</a>, <a href="https://publications.waset.org/abstracts/search?q=femininity" title=" femininity"> femininity</a>, <a href="https://publications.waset.org/abstracts/search?q=Ghana" title=" Ghana"> Ghana</a> </p> <a href="https://publications.waset.org/abstracts/21119/sex-positions-decisions-and-negotiations-of-sexual-pleasure-and-gender-in-ghana" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/21119.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">481</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1176</span> Localization of Mobile Robots with Omnidirectional Cameras</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Tatsuya%20Kato">Tatsuya Kato</a>, <a href="https://publications.waset.org/abstracts/search?q=Masanobu%20Nagata"> Masanobu Nagata</a>, <a href="https://publications.waset.org/abstracts/search?q=Hidetoshi%20Nakashima"> Hidetoshi Nakashima</a>, <a href="https://publications.waset.org/abstracts/search?q=Kazunori%20Matsuo"> Kazunori Matsuo</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Localization of mobile robots are important tasks for developing autonomous mobile robots. This paper proposes a method to estimate positions of a mobile robot using an omnidirectional camera on the robot. Landmarks for points of references are set up on a field where the robot works. The omnidirectional camera which can obtain 360 [deg] around images takes photographs of these landmarks. The positions of the robots are estimated from directions of these landmarks that are extracted from the images by image processing. This method can obtain the robot positions without accumulative position errors. Accuracy of the estimated robot positions by the proposed method are evaluated through some experiments. The results show that it can obtain the positions with small standard deviations. Therefore the method has possibilities of more accurate localization by tuning of appropriate offset parameters. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=mobile%20robots" title="mobile robots">mobile robots</a>, <a href="https://publications.waset.org/abstracts/search?q=localization" title=" localization"> localization</a>, <a href="https://publications.waset.org/abstracts/search?q=omnidirectional%20camera" title=" omnidirectional camera"> omnidirectional camera</a>, <a href="https://publications.waset.org/abstracts/search?q=estimating%20positions" title=" estimating positions"> estimating positions</a> </p> <a href="https://publications.waset.org/abstracts/11803/localization-of-mobile-robots-with-omnidirectional-cameras" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/11803.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">442</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1175</span> A Unified Model for Orotidine Monophosphate Synthesis: Target for Inhibition of Growth of Mycobacterium tuberculosis</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=N.%20Naga%20Subrahmanyeswara%20Rao">N. Naga Subrahmanyeswara Rao</a>, <a href="https://publications.waset.org/abstracts/search?q=Parag%20Arvind%20Deshpande"> Parag Arvind Deshpande</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Understanding nucleotide synthesis reaction of any organism is beneficial to know the growth of it as in Mycobacterium tuberculosis to design anti TB drug. One of the reactions of de novo pathway which takes place in all organisms was considered. The reaction takes places between phosphoribosyl pyrophosphate and orotate catalyzed by orotate phosphoribosyl transferase and divalent metal ion gives orotdine monophosphate, a nucleotide. All the reaction steps of three experimentally proposed mechanisms for this reaction were considered to develop kinetic rate expression. The model was validated using the data for four organisms. This model could successfully describe the kinetics for the reported data. The developed model can serve as a reliable model to describe the kinetics in new organisms without the need of mechanistic determination. So an organism-independent model was developed. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=mechanism" title="mechanism">mechanism</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide" title=" nucleotide"> nucleotide</a>, <a href="https://publications.waset.org/abstracts/search?q=organism" title=" organism"> organism</a>, <a href="https://publications.waset.org/abstracts/search?q=tuberculosis" title=" tuberculosis"> tuberculosis</a> </p> <a href="https://publications.waset.org/abstracts/58551/a-unified-model-for-orotidine-monophosphate-synthesis-target-for-inhibition-of-growth-of-mycobacterium-tuberculosis" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/58551.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">334</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1174</span> Assessing the Risk of Pressure Injury during Percutaneous Nephrolithotomy Using Pressure Mapping</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Jake%20Tempo">Jake Tempo</a>, <a href="https://publications.waset.org/abstracts/search?q=Taylor%20Smithurst"> Taylor Smithurst</a>, <a href="https://publications.waset.org/abstracts/search?q=Jen%20Leah"> Jen Leah</a>, <a href="https://publications.waset.org/abstracts/search?q=Skye%20Waddingham"> Skye Waddingham</a>, <a href="https://publications.waset.org/abstracts/search?q=Amanda%20Catlin"> Amanda Catlin</a>, <a href="https://publications.waset.org/abstracts/search?q=Richard%20Cetti"> Richard Cetti</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Introduction: Percutaneous nephrolithotomy (PCNL) is the gold-standard procedure for removing large or complex renal stones. Many operating positions can be used, and the debate over the ideal position continues. PCNL can be a long procedure during which patients can sustain pressure injuries. These injuries are often underreported in the literature. Interface pressure mapping records the pressure loading between a surface and the patient. High pressures with prolonged loading result in ischaemia, muscle deformation, and reperfusion which can cause skin breakdown and muscular injury. We compared the peak pressure indexes of common PCNL positions to identify positions which may be at high risk of pressure injuries. We hope the data can be used to adapt high-risk positions so that the PPI can be lessened by either adapting the positions or by using adjuncts to lower PPI. Materials and Methods: We placed a 23-year-old male subject in fourteen different PCNL positions while performing interface pressure mapping. The subject was 179 cm with a weight of 63.3 kg, BMI 19.8kg/m². Results: Supine positions had a higher mean PPI (119mmHg (41-137)) compared to prone positions (64mmHg (32-89)) (p=0.046 two tailed t-test). The supine flexed position with a bolster under the flank produced the highest PPI (194mmHg), and this was at the sacrum. Peak pressure indexes >100mmHg were recorded in eight PCNL positions. Conclusion: Supine PCNL positions produce higher PPI than prone PCNL positions. Our study shows where ‘at risk’ bony prominences are for each PCNL position. Surgeons must ensure these areas are protected during prolonged operations. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=PCNL" title="PCNL">PCNL</a>, <a href="https://publications.waset.org/abstracts/search?q=pressure%20ulcer" title=" pressure ulcer"> pressure ulcer</a>, <a href="https://publications.waset.org/abstracts/search?q=interface%20pressure%20mapping" title=" interface pressure mapping"> interface pressure mapping</a>, <a href="https://publications.waset.org/abstracts/search?q=surgery" title=" surgery"> surgery</a> </p> <a href="https://publications.waset.org/abstracts/145163/assessing-the-risk-of-pressure-injury-during-percutaneous-nephrolithotomy-using-pressure-mapping" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/145163.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">83</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1173</span> Studies of Single Nucleotide Polymorphism of Proteosomal Gene Complex and Their Association with HBV Infection Risk in India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Jasbir%20Singh">Jasbir Singh</a>, <a href="https://publications.waset.org/abstracts/search?q=Devender%20Kumar"> Devender Kumar</a>, <a href="https://publications.waset.org/abstracts/search?q=Davender%20Redhu"> Davender Redhu</a>, <a href="https://publications.waset.org/abstracts/search?q=Surender%20Kumar"> Surender Kumar</a>, <a href="https://publications.waset.org/abstracts/search?q=Vandana%20Bhardwaj"> Vandana Bhardwaj</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Single Nucleotide polymorphism (SNP) of proteosomal gene complex is involved in the pathogenesis of hepatitis B Virus (HBV) infection. Some of such proteosomal gene complex are large multifunctional proteins (LMP) and antigen associated transporters that help in antigen presentation. Both are involved in intracellular processing and presentation of viral antigens in association with Major Histocompatability Complex (MHC) Class I molecules. A total of hundred each of hepatitis B virus infected and control samples from northern India were studied. Genomic DNA was extracted from all studied samples and PCR-RFLP method was used for genotyping at different positions of LMP genes. Genotypes at a given position were inferred from the pattern of bands and genotype frequencies and haplotype frequencies were also calculated. Homozygous SNP {A>C} was observed at codon 145 of LMP7 gene and having a protective role against HBV as there was statistically significant high distribution of this SNP among controls than cases. Heterozygous SNP {A>C} was observed at codon 145 of LMP7 gene and made individuals more susceptible to HBV infection as there was statistically significant high distribution of this SNP among cases than control. SNP {T>C} was observed at codon 60 of LMP2 gene but statistically significant differences were not observed among controls and cases. For codon 145 of LMP7 and codon 60 of LMP2 genes, four haplotypes were constructed. Haplotype I (LMP2 ‘C’ and LMP7 ‘A’) made individuals carrying it more susceptible to HBV infection as there was statistically significant high distribution of this haplotype among cases than control. Haplotype II (LMP2 ‘C’ and LMP7 ‘C’) made individuals carrying it more immune to HBV infection as there was statistically significant high distribution of this haplotype among control than cases. Thus it can be concluded that homozygous SNP {A>C} at codon 145 of LMP7 and Haplotype II (LMP2 ‘C’ and LMP7 ‘C’) has a protective role against HBV infection whereas heterozygous SNP {A>C} at codon 145 of LMP7 and Haplotype I (LMP2 ‘C’ and LMP7 ‘A’) made individuals more susceptible to HBV infection. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Hepatitis%20B%20Virus" title="Hepatitis B Virus">Hepatitis B Virus</a>, <a href="https://publications.waset.org/abstracts/search?q=single%20nucleotide%20polymorphism" title=" single nucleotide polymorphism"> single nucleotide polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=low%20molecular%20weight%20proteins" title=" low molecular weight proteins"> low molecular weight proteins</a>, <a href="https://publications.waset.org/abstracts/search?q=transporters%20associated%20with%20antigen%20presentation" title=" transporters associated with antigen presentation"> transporters associated with antigen presentation</a> </p> <a href="https://publications.waset.org/abstracts/60533/studies-of-single-nucleotide-polymorphism-of-proteosomal-gene-complex-and-their-association-with-hbv-infection-risk-in-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/60533.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">308</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1172</span> Molecular Characterization of Functional Domain (LRR) of TLR9 Genes in Malnad Gidda Cattle and Their Comparison to Cross Breed Cattle</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ananthakrishna%20L.%20R.">Ananthakrishna L. R.</a>, <a href="https://publications.waset.org/abstracts/search?q=Ramesh%20D."> Ramesh D.</a>, <a href="https://publications.waset.org/abstracts/search?q=Kumar%20Wodeyar"> Kumar Wodeyar</a>, <a href="https://publications.waset.org/abstracts/search?q=Kotresh%20A.%20M."> Kotresh A. M.</a>, <a href="https://publications.waset.org/abstracts/search?q=Gururaj%20P.%20M."> Gururaj P. M.</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Malnad Gidda is the indigenous recognized cattle breed of Shivamogga District of Karnataka state, India is known for its disease resistance to many of the infectious diseases. There are 25 LRR (Leucine Rich Repeats) identified in bovine (Bos indicus) TLR9. The amino acid sequence of LRR is deduced to nucleotide sequence in BLASTx bioinformatic online tools. LRR2 to LRR10 are involved in pathogen recognition and binding in human TLR9 which showed a higher degree of nucleotide variations with respect to disease resistance to various pathogens. Hence, primers were designed to amplify the flanking sequences of LRR2 to LRR10, to discover the nucleotide variations if any, in Malnad Gidda breed of Cattle which is associated with disease resistance. The DNA isolated from peripheral blood mononuclear cells of ten Malnad Gidda cattle. A desired and specific amplification product of 0.8 kb was obtained at an annealing temperature of 56.6ᵒC. All the PCR products were sequenced on both sides by gene-specific primers. The sequences were compared with TLR9 sequence of cross breed cattle obtained from NCBI data bank. The sequence analysis between Malnad Gidda and crossbreed cattle revealed no nucleotide variations in the region LRR2 to LRR9 which shows the conserved in pathogen binding domain (LRR) of TLR9. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=leucine%20rich%20repeats" title="leucine rich repeats">leucine rich repeats</a>, <a href="https://publications.waset.org/abstracts/search?q=Malnad%20Gidda" title=" Malnad Gidda"> Malnad Gidda</a>, <a href="https://publications.waset.org/abstracts/search?q=cross%20breed" title=" cross breed"> cross breed</a>, <a href="https://publications.waset.org/abstracts/search?q=TLR9" title=" TLR9"> TLR9</a> </p> <a href="https://publications.waset.org/abstracts/84527/molecular-characterization-of-functional-domain-lrr-of-tlr9-genes-in-malnad-gidda-cattle-and-their-comparison-to-cross-breed-cattle" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/84527.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">225</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1171</span> Sequence Polymorphism and Haplogroup Distribution of Mitochondrial DNA Control Regions HVS1 and HVS2 in a Southwestern Nigerian Population</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ogbonnaya%20O.%20Iroanya">Ogbonnaya O. Iroanya</a>, <a href="https://publications.waset.org/abstracts/search?q=Samson%20T.%20Fakorede"> Samson T. Fakorede</a>, <a href="https://publications.waset.org/abstracts/search?q=Osamudiamen%20J.%20Edosa"> Osamudiamen J. Edosa</a>, <a href="https://publications.waset.org/abstracts/search?q=Hadiat%20A.%20Azeez"> Hadiat A. Azeez</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The human mitochondrial DNA (mtDNA) is about 17 kbp circular DNA fragments found within the mitochondria together with smaller fragments of 1200 bp known as the control region. Knowledge of variation within populations has been employed in forensic and molecular anthropology studies. The study was aimed at investigating the polymorphic nature of the two hypervariable segments (HVS) of the mtDNA, i.e., HVS1 and HVS2, and to determine the haplogroup distribution among individuals resident in Lagos, Southwestern Nigeria. Peripheral blood samples were obtained from sixty individuals who are not related maternally, followed by DNA extraction and amplification of the extracted DNA using primers specific for the regions under investigation. DNA amplicons were sequenced, and sequenced data were aligned and compared to the revised Cambridge Reference Sequence (rCRS) GenBank Accession number: NC_012920.1) using BioEdit software. Results obtained showed 61 and 52 polymorphic nucleotide positions for HVS1 and HVS2, respectively. While a total of three indels mutation were recorded for HVS1, there were seven for HVS2. Also, transition mutations predominate nucleotide change observed in the study. Genetic diversity (GD) values for HVS1 and HVS2 were estimated to be 84.21 and 90.4%, respectively, while random match probability was 0.17% for HVS1 and 0.89% for HVS2. The study also revealed mixed haplogroups specific to the African (L1-L3) and the Eurasians (U and H) lineages. New polymorphic sites obtained from the study are promising for human identification purposes. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=hypervariable%20region" title="hypervariable region">hypervariable region</a>, <a href="https://publications.waset.org/abstracts/search?q=indels" title=" indels"> indels</a>, <a href="https://publications.waset.org/abstracts/search?q=mitochondrial%20DNA" title=" mitochondrial DNA"> mitochondrial DNA</a>, <a href="https://publications.waset.org/abstracts/search?q=polymorphism" title=" polymorphism"> polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=random%20match%20probability" title=" random match probability"> random match probability</a> </p> <a href="https://publications.waset.org/abstracts/125506/sequence-polymorphism-and-haplogroup-distribution-of-mitochondrial-dna-control-regions-hvs1-and-hvs2-in-a-southwestern-nigerian-population" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/125506.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">114</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1170</span> Deleterious SNP’s Detection Using Machine Learning</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Hamza%20Zidoum">Hamza Zidoum</a> </p> <p class="card-text"><strong>Abstract:</strong></p> This paper investigates the impact of human genetic variation on the function of human proteins using machine-learning algorithms. Single-Nucleotide Polymorphism represents the most common form of human genome variation. We focus on the single amino-acid polymorphism located in the coding region as they can affect the protein function leading to pathologic phenotypic change. We use several supervised Machine Learning methods to identify structural properties correlated with increased risk of the missense mutation being damaging. SVM associated with Principal Component Analysis give the best performance. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=single-nucleotide%20polymorphism" title="single-nucleotide polymorphism">single-nucleotide polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=machine%20learning" title=" machine learning"> machine learning</a>, <a href="https://publications.waset.org/abstracts/search?q=feature%20selection" title=" feature selection"> feature selection</a>, <a href="https://publications.waset.org/abstracts/search?q=SVM" title=" SVM"> SVM</a> </p> <a href="https://publications.waset.org/abstracts/45046/deleterious-snps-detection-using-machine-learning" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/45046.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">377</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1169</span> Variation in Carboxylesterase Activity in Spodoptera litura Fabricious (Noctuidae: Lepidoptera) Populations from India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=V.%20Karuppaiah">V. Karuppaiah</a>, <a href="https://publications.waset.org/abstracts/search?q=J.%20C.%20Padaria"> J. C. Padaria</a>, <a href="https://publications.waset.org/abstracts/search?q=C.%20Srivastava"> C. Srivastava</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura Fab (Lepidoptera: Noctuidae) is a polyphagous pest various field and horticulture crops in India. Pest had virtually developed resistance to all commonly used insecticides. Enhanced detoxification is the prime mechanism that is dictated by detoxification different enzymes and carboxylesterase is one of the major enzyme responsible development of resistance. In India, insecticide resistance studies on S. litura are mainly deployed on detoxification enzymes activity and investigation at gene level alteration i.e. at nucleotide level is very merger. In the present study, we collected the S. litura larvae from three different cauliflower growing belt viz., IARI, New Delhi (Delhi), Palari, Sonepat (Haryana) and Varanasi (Uttar Pradesh) to study the role of carboxylesterase activity and its gene level variation The CarE activity was measured using UV-VIS spectrophotometer with 3rd instar larvae of S. litura. The elevated activity of CarE was observed in Sonepat strain (28.09 ± 0.09 µmol/min/mg of protein) followed by Delhi (26.72 ± 0.04 µmol/min/mg of protein) and Varanasi strain (10.00 ± 0.44 µmol/min/mg of protein) of S. litura. The genomic DNA was isolated from 3rd instar larvae and CarE gene was amplified using a primer sequence, F:5’tccagagttccttgtcaggcac3’; R:5’ctgcatcaagcatgtctc3. CarE gene, about 500bp was partially amplified, sequenced and submitted to NCBI (Accession No. KF835886, KF835887 and KF835888). The sequence data revealed polymorphism at nucleotide level in all the three strains and gene found to have 88 to 97% similarity with previous available nucleotide sequences of S. litura, S. littoralis and S. exiqua. The polymorphism at the nucleotide level could be a reason for differential activity of carboxylesterase enzymes among the strains. However, investigation at gene expression level would be useful to analyze the overproduction of carboxylesterase enzyme. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=carboxylesterase" title="carboxylesterase">carboxylesterase</a>, <a href="https://publications.waset.org/abstracts/search?q=CarE%20gene" title=" CarE gene"> CarE gene</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide%20polymorphism" title=" nucleotide polymorphism"> nucleotide polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a> </p> <a href="https://publications.waset.org/abstracts/13619/variation-in-carboxylesterase-activity-in-spodoptera-litura-fabricious-noctuidae-lepidoptera-populations-from-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/13619.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">922</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1168</span> Comparison of Linear Discriminant Analysis and Support Vector Machine Classifications for Electromyography Signals Acquired at Five Positions of Elbow Joint</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Amna%20Khan">Amna Khan</a>, <a href="https://publications.waset.org/abstracts/search?q=Zareena%20Kausar"> Zareena Kausar</a>, <a href="https://publications.waset.org/abstracts/search?q=Saad%20Malik"> Saad Malik</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Bio Mechatronics has extended applications in the field of rehabilitation. It has been contributing since World War II in improving the applicability of prosthesis and assistive devices in real life scenarios. In this paper, classification accuracies have been compared for two classifiers against five positions of elbow. Electromyography (EMG) signals analysis have been acquired directly from skeletal muscles of human forearm for each of the three defined positions and at modified extreme positions of elbow flexion and extension using 8 electrode Myo armband sensor. Features were extracted from filtered EMG signals for each position. Performance of two classifiers, support vector machine (SVM) and linear discriminant analysis (LDA) has been compared by analyzing the classification accuracies. SVM illustrated classification accuracies between 90-96%, in contrast to 84-87% depicted by LDA for five defined positions of elbow keeping the number of samples and selected feature the same for both SVM and LDA. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=classification%20accuracies" title="classification accuracies">classification accuracies</a>, <a href="https://publications.waset.org/abstracts/search?q=electromyography" title=" electromyography"> electromyography</a>, <a href="https://publications.waset.org/abstracts/search?q=linear%20discriminant%20analysis%20%28LDA%29" title=" linear discriminant analysis (LDA)"> linear discriminant analysis (LDA)</a>, <a href="https://publications.waset.org/abstracts/search?q=Myo%20armband%20sensor" title=" Myo armband sensor"> Myo armband sensor</a>, <a href="https://publications.waset.org/abstracts/search?q=support%20vector%20machine%20%28SVM%29" title=" support vector machine (SVM)"> support vector machine (SVM)</a> </p> <a href="https://publications.waset.org/abstracts/73619/comparison-of-linear-discriminant-analysis-and-support-vector-machine-classifications-for-electromyography-signals-acquired-at-five-positions-of-elbow-joint" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/73619.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">368</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1167</span> Effect of CYP2B6 c.516G>T and c.983T>C Single Nucleotide Polymorphisms on Plasma Nevirapine Levels in Zimbabwean HIV/AIDS Patients</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Doreen%20Duri">Doreen Duri</a>, <a href="https://publications.waset.org/abstracts/search?q=Danai%20Zhou"> Danai Zhou</a>, <a href="https://publications.waset.org/abstracts/search?q=Babil%20Stray-Pedersen"> Babil Stray-Pedersen</a>, <a href="https://publications.waset.org/abstracts/search?q=Collet%20Dandara"> Collet Dandara</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Given the high prevalence of HIV/AIDS in sub-Saharan Africa, and the elusive search for a cure, understanding the pharmacogenetics of currently used drugs is critical in populations from the most affected regions. Compared to Asian and Caucasian populations, African population groups are more genetically diverse, making it difficult to extrapolate findings from one ethnic group to another. This study aimed to investigate the role of genetic variation in CYP2B6 (c.516G>T and c.983T>C) single nucleotide polymorphisms on plasma nevirapine levels among HIV-infected adult Zimbabwean patients. Using a cross-sectional study, patients on nevirapine-containing HAART, having reached steady state (more than six weeks on treatment) were recruited to participate. Blood samples were collected after patients provided consent and samples were used to extract DNA for genetic analysis or to measure plasma nevirapine levels. Genetic analysis was carried out using PCR and RFLP or Snapshot for the two single nucleotide polymorphisms; CYP2B6 c.516G>T and c.983T>C, while LC-MS/MS was used in analyzing nevirapine concentration. CYP2B6 c.516G>T and c.983T>C significantly predicted plasma nevirapine concentration with the c.516T and c.983T being associated with elevated plasma nevirapine concentrations. Comparisons of the variant allele frequencies observed in this group to those reported in some African, Caucasian and Asian populations showed significant differences. We conclude that pharmacogenetics of nevirapine can be creatively used to determine patients who are likely to develop nevirapine-associated side effects as well as too low plasma concentrations for viral suppression. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=allele%20frequencies" title="allele frequencies">allele frequencies</a>, <a href="https://publications.waset.org/abstracts/search?q=genetically%20diverse" title=" genetically diverse"> genetically diverse</a>, <a href="https://publications.waset.org/abstracts/search?q=nevirapine" title=" nevirapine"> nevirapine</a>, <a href="https://publications.waset.org/abstracts/search?q=single%20nucleotide%20polymorphism" title=" single nucleotide polymorphism"> single nucleotide polymorphism</a> </p> <a href="https://publications.waset.org/abstracts/32617/effect-of-cyp2b6-c516gt-and-c983tc-single-nucleotide-polymorphisms-on-plasma-nevirapine-levels-in-zimbabwean-hivaids-patients" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/32617.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">455</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1166</span> Isolation and Characterization of Cotton Infecting Begomoviruses in Alternate Hosts from Cotton Growing Regions of Pakistan</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=M.%20Irfan%20Fareed">M. Irfan Fareed</a>, <a href="https://publications.waset.org/abstracts/search?q=Muhammad%20Tahir"> Muhammad Tahir</a>, <a href="https://publications.waset.org/abstracts/search?q=Alvina%20Gul%20Kazi"> Alvina Gul Kazi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Castor bean (Ricinus communis; family Euphorbiaceae) is cultivated for the production of oil and as an ornamental plant throughout tropical regions. Leaf samples from castor bean plants with leaf curl and vein thickening were collected from areas around Okara (Pakistan) in 2011. PCR amplification using diagnostic primers showed the presence of a begomovirus and subsequently the specific pair (BurNF 5’- CCATGGTTGTGGCAGTTGATTGACAGATAC-3’, BurNR 5’- CCATGGATTCACGCACAGGGGAACCC-3’) was used to amplify and clone the whole genome of the virus. The complete nucleotide sequence was determined to be 2,759 nt (accession No. HE985227). Alignments showed the highest levels of nucleotide sequence identity (98.8%) with Cotton leaf curl Burewala virus (CLCuBuV; accession No. JF416947) No. JF416947). The virus in castor beans lacks on intact C2 gene, as is typical of CLCuBuV in cotton. An amplification product of ca. 1.4 kb was obtained in PCR with primers for betasatellites and the complete nucleotide sequence of a clone was determined to be 1373 nt (HE985228). The sequence showed 96.3% nucleotide sequence identity to the recombinant Cotton leaf curl Multan betasatellite (CLCuMB; JF502389). This is the first report of CLCuBuV and its betasatellite infecting castor bean, showing this plant species as an alternate host of the virus. Already many alternate host have been reported from different alternate host like tobacco, tomato, hibiscus, okra, ageratum, Digera arvensis, habiscus, Papaya and now in Ricinus communis. So, it is suggested that these alternate hosts should be avoided to grow near cotton growing regions. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ricinus%20communis" title="Ricinus communis">Ricinus communis</a>, <a href="https://publications.waset.org/abstracts/search?q=begomovirus" title=" begomovirus"> begomovirus</a>, <a href="https://publications.waset.org/abstracts/search?q=betasatellite" title=" betasatellite"> betasatellite</a>, <a href="https://publications.waset.org/abstracts/search?q=agriculture" title=" agriculture"> agriculture</a> </p> <a href="https://publications.waset.org/abstracts/21282/isolation-and-characterization-of-cotton-infecting-begomoviruses-in-alternate-hosts-from-cotton-growing-regions-of-pakistan" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/21282.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">531</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1165</span> Manager-Sensitive Theological Curricula: Rethinking Pastoral Care for Christians in High Positions Based on a Namibian Case Study</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Florence%20Matsveru">Florence Matsveru</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The 21st-century church in Africa is faced with a myriad of challenges, which need attention. One of those challenges is pastoral ministry to congregants in high positions. This paper is based on a Ph.D. study entitled, ‘Wellbeing and work performance of Christians in managerial positions: A Namibian case study’ conducted between 2015 and 2018. The study was conducted with 32 purposively selected Christians working in managerial positions in Ohangwena Region, Namibia. The study employed a mixed-methods approach, i.e., both qualitative (to get participants’ feelings and perceptions) and quantitative (to get proportions of the experiences and perceptions). The research process involved a questionnaire survey and interviews. The study revealed that Christians in managerial positions have both common and unique experiences in three spheres: the workplace, the family and the church. The experiences lead to physical, emotional, psychological, social and spiritual needs. The findings also showed that some of the expectations placed upon Christians in managerial positions in the church may be unrealistic, while at the same time this group of congregants want to use their work experiences for the benefit of the church. A worrying finding was that pastors are generally not well-trained for ministry to congregants in high positions. Since these were perceptions of the participants (some of whom were also pastors), the researcher went further to do a short internet survey of the curricula of a number of theological colleges in Southern Africa. This survey did not show any ‘manager-sensitive’ modules in the surveyed colleges. Theological education for pastors, especially in African theological institutions, seems to ignore the unique needs of congregants in high positions. This paper argues that the needs of Christians in high positions should be considered in pastoral care and that theological education is key in equipping pastors with the necessary knowledge and skills. This paper is, therefore, a call to theological institutions to include ministry to people in high positions in their curricula. Pastors who are already beyond theological school may find it helpful to attend or hold workshops that focus on congregants in high positions so that this kind of 'sheep' will find good pasture in the church. A paper of this nature helps to strengthen pastoral ministry and to enhance the relevance of theological education. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Christian%20managers" title="Christian managers">Christian managers</a>, <a href="https://publications.waset.org/abstracts/search?q=theological%20curricula" title=" theological curricula"> theological curricula</a>, <a href="https://publications.waset.org/abstracts/search?q=pastoral%20care" title=" pastoral care"> pastoral care</a>, <a href="https://publications.waset.org/abstracts/search?q=African" title=" African"> African</a> </p> <a href="https://publications.waset.org/abstracts/100988/manager-sensitive-theological-curricula-rethinking-pastoral-care-for-christians-in-high-positions-based-on-a-namibian-case-study" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/100988.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">131</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1164</span> Detection of MspI Polymorphism and SNP of GH Gene in Some Camel Breeds Reared in Egypt</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Sekena%20H.%20Abd%20El-Aziem">Sekena H. Abd El-Aziem</a>, <a href="https://publications.waset.org/abstracts/search?q=Heba%20A.%20M.%20Abd%20El-Kader"> Heba A. M. Abd El-Kader</a>, <a href="https://publications.waset.org/abstracts/search?q=Sally%20S.%20Alam"> Sally S. Alam</a>, <a href="https://publications.waset.org/abstracts/search?q=Othman%20E.%20Othman"> Othman E. Othman </a> </p> <p class="card-text"><strong>Abstract:</strong></p> Growth hormone (GH) is an anabolic hormone synthesized and secreted by the somatotroph cells of the anterior lobe of the pituitary gland in a circadian and pulsatile manner, the pattern of which plays an important role in postnatal longitudinal growth and development, tissue growth, lactation, reproduction as well as protein, lipid and carbohydrate metabolism. The aim of this study was to detect the genetic polymorphism of GH gene in five camel breeds reared in Egypt; Sudany, Somali, Mowaled, Maghrabi and Falahy, using PCR-RFLP technique. Also this work aimed to identify the single nucleotide polymorphism between different genotypes detected in these camel breeds. The amplified fragment of camel GH at 613-bp was digested with the restriction enzyme MspI and the result revealed the presence of three different genotypes; CC, CT and TT in tested breeds and significant differences were recorded in the genotype frequencies between these camel breeds. The result showed that the Maghrabi breed that is classified as a dual purpose camels had higher frequency for allele C (0.75) than those in the other tested four breeds. The sequence analysis declared the presence of a SNP (C→T) at position 264 in the amplified fragment which is responsible for the destruction of the restriction site C^CGG and consequently the appearance of two different alleles C and T. The nucleotide sequences of camel GH alleles T and C were submitted to nucleotide sequences database NCBI/Bankit/GenBank and have accession numbers: KP143517 and KP143518, respectively. It is concluded that only one SNP C→T was detected in GH gene among the five tested camel breeds reared in Egypt and this nucleotide substitution can be used as a marker for the genetic biodiversity between camel breeds reared in Egypt. Also, due to the possible association between allele C and higher growth rate, we can used it in MAS for camels and enter the camels possess this allele in breeding program as a way for enhancement of growth trait in camel breeds reared in Egypt. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=camel%20breeds%20in%20Egypt" title="camel breeds in Egypt">camel breeds in Egypt</a>, <a href="https://publications.waset.org/abstracts/search?q=GH" title=" GH"> GH</a>, <a href="https://publications.waset.org/abstracts/search?q=PCR-RFLP" title=" PCR-RFLP"> PCR-RFLP</a>, <a href="https://publications.waset.org/abstracts/search?q=SNPs" title=" SNPs"> SNPs</a> </p> <a href="https://publications.waset.org/abstracts/25932/detection-of-mspi-polymorphism-and-snp-of-gh-gene-in-some-camel-breeds-reared-in-egypt" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/25932.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">465</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1163</span> Genetic Variations of Two Casein Genes among Maghrabi Camels Reared in Egypt</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Othman%20E.%20Othman">Othman E. Othman</a>, <a href="https://publications.waset.org/abstracts/search?q=Amira%20M.%20Nowier"> Amira M. Nowier</a>, <a href="https://publications.waset.org/abstracts/search?q=Medhat%20El-Denary"> Medhat El-Denary</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Camels play an important socio-economic role within the pastoral and agricultural system in the dry and semidry zones of Asia and Africa. Camels are economically important animals in Egypt where they are dual purpose animals (meat and milk). The analysis of chemical composition of camel milk showed that the total protein contents ranged from 2.4% to 5.3% and it is divided into casein and whey proteins. The casein fraction constitutes 52% to 89% of total camel milk protein and it divided into 4 fractions namely αs1, αs2, β and κ-caseins which are encoded by four tightly genes. In spite of the important role of casein genes and the effects of their genetic polymorphisms on quantitative traits and technological properties of milk, the studies for the detection of genetic polymorphism of camel milk genes are still limited. Due to this fact, this work focused - using PCR-RFP and sequencing analysis - on the identification of genetic polymorphisms and SNPs of two casein genes in Maghrabi camel breed which is a dual purpose camel breed in Egypt. The amplified fragments at 488-bp of the camel κ-CN gene were digested with AluI endonuclease. The results showed the appearance of three different genotypes in the tested animals; CC with three digested fragments at 203-, 127- and 120-bp, TT with three digested fragments at 203-, 158- and 127-bp and CT with four digested fragments at 203-, 158-, 127- and 120-bp. The frequencies of three detected genotypes were 11.0% for CC, 48.0% for TT and 41.0% for CT genotypes. The sequencing analysis of the two different alleles declared the presence of a single nucleotide polymorphism (C→T) at position 121 in the amplified fragments which is responsible for the destruction of a restriction site (AG/CT) in allele T and resulted in the presence of two different alleles C and T in tested animals. The nucleotide sequences of κ-CN alleles C and T were submitted to GenBank with the accession numbers; KU055605 and KU055606, respectively. The primers used in this study amplified 942-bp fragments spanning from exon 4 to exon 6 of camel αS1-Casein gene. The amplified fragments were digested with two different restriction enzymes; SmlI and AluI. The results of SmlI digestion did not show any restriction site whereas the digestion with AluI endonuclease revealed the presence of two restriction sites AG^CT at positions 68^69 and 631^632 yielding the presence of three digested fragments with sizes 68-, 563- and 293-bp.The nucleotide sequences of this fragment from camel αS1-Casein gene were submitted to GenBank with the accession number KU145820. In conclusion, the genetic characterization of quantitative traits genes which are associated with the production traits like milk yield and composition is considered an important step towards the genetic improvement of livestock species through the selection of superior animals depending on the favorable alleles and genotypes; marker assisted selection (MAS). <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=genetic%20polymorphism" title="genetic polymorphism">genetic polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=SNP%20polymorphism" title=" SNP polymorphism"> SNP polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=Maghrabi%20camels" title=" Maghrabi camels"> Maghrabi camels</a>, <a href="https://publications.waset.org/abstracts/search?q=%CE%BA-Casein%20gene" title=" κ-Casein gene"> κ-Casein gene</a>, <a href="https://publications.waset.org/abstracts/search?q=%CE%B1S1-Casein%20gene" title=" αS1-Casein gene"> αS1-Casein gene</a> </p> <a href="https://publications.waset.org/abstracts/45961/genetic-variations-of-two-casein-genes-among-maghrabi-camels-reared-in-egypt" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/45961.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">613</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1162</span> The Association between IFNAR2 and Dpp9 Genes Single Nucleotide Polymorphisms Frequency with COVID-19 Severity in Iranian Patients</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Sima%20Parvizi%20Omran">Sima Parvizi Omran</a>, <a href="https://publications.waset.org/abstracts/search?q=Rezvan%20Tavakoli"> Rezvan Tavakoli</a>, <a href="https://publications.waset.org/abstracts/search?q=Mahnaz%20Safari"> Mahnaz Safari</a>, <a href="https://publications.waset.org/abstracts/search?q=Mohammadreza%20Aghasadeghi"> Mohammadreza Aghasadeghi</a>, <a href="https://publications.waset.org/abstracts/search?q=Abolfazl%20Fateh"> Abolfazl Fateh</a>, <a href="https://publications.waset.org/abstracts/search?q=Pooneh%20Rahimi"> Pooneh Rahimi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Background: SARS-CoV-2, a single-stranded RNA betacoronavirus causes the global outbreak of coronavirus disease 2019 (COVID-19). Several clinical and scientific concerns are raised by this pandemic. Genetic factors can contribute to pathogenesis and disease susceptibility. There are single nucleotide polymorphisms (SNPs) in many of the genes in the immune system that affect the expression of specific genes or functions of some proteins related to immune responses against viral infections. In this study, we analyzed the impact of polymorphism in the interferon alpha and beta receptor subunit 2 (IFNAR2) and dipeptidyl peptidase 9 (Dpp9) genes and clinical parameters on the susceptibility and resistance to Coronavirus disease (COVID-19). Methods: A total of 330- SARS-CoV-2 positive patients (188 survivors and 142 nonsurvivors) were included in this study. All single-nucleotide polymorphisms (SNPs) on IFNAR2 (rs2236757) and Dpp9 (rs2109069) were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Results: In survivor patients, the frequency of the favourable genotypes of IFNAR2 SNP (rs2236757 GC) was significantly higher than in nonsurvivor patients, and also Dpp9 (rs2109069 AT) genotypes were associated with the severity of COVID-19 infection. Conclusions: This study demonstrated that the severity of COVID- 19 patients was strongly associated with clinical parameters and unfavourable IFNAR2, Dpp9 SNP genotypes. In order to establish the relationship between host genetic factors and the severity of COVID-19 infection, further studies are needed in multiple parts of the world. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=SARS-CoV-2" title="SARS-CoV-2">SARS-CoV-2</a>, <a href="https://publications.waset.org/abstracts/search?q=COVID-19" title=" COVID-19"> COVID-19</a>, <a href="https://publications.waset.org/abstracts/search?q=interferon%20alpha%20and%20beta%20receptor%20subunit%202" title=" interferon alpha and beta receptor subunit 2"> interferon alpha and beta receptor subunit 2</a>, <a href="https://publications.waset.org/abstracts/search?q=dipeptidyl%20peptidase%209" title=" dipeptidyl peptidase 9"> dipeptidyl peptidase 9</a>, <a href="https://publications.waset.org/abstracts/search?q=single-nucleotide%20polymorphisms" title=" single-nucleotide polymorphisms"> single-nucleotide polymorphisms</a> </p> <a href="https://publications.waset.org/abstracts/155792/the-association-between-ifnar2-and-dpp9-genes-single-nucleotide-polymorphisms-frequency-with-covid-19-severity-in-iranian-patients" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/155792.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">163</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1161</span> Phylogenetic Analysis of the Myxosporea Detected from Emaciated Olive Flounder (Paralichthys olivaceus) in Korea</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Seung%20Min%20Kim">Seung Min Kim</a>, <a href="https://publications.waset.org/abstracts/search?q=Lyu%20Jin%20Jun"> Lyu Jin Jun</a>, <a href="https://publications.waset.org/abstracts/search?q=Joon%20Bum%20Jeong"> Joon Bum Jeong</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The Myxosporea to cause emaciation disease in the olive flounder (Paralichthys olivaceus) is a pathogen to cause severe losses in the aquafarming industry in Korea. The 3,362 bp of DNA nucleotide sequences of four myxosporean strains (EM-HM-12, EM-MA-13, EM-JJ-14, and EM-MS-15) detected by PCR method from olive flounder suffering from emaciation disease in Korea during 2012-2015 were sequenced and deposited in GenBank database (GenBank accession numbers: KU377574, KT321705, KU377575 and KU377573, respectively). The homologies of DNA nucleotide sequences of four strains were compared to each other and were more than 99.7% homologous between the four strains. All of the strains were identified as Parvicapsula petunia based on the results of phylogenetic analysis. The results in this study would be useful for the research of emaciation disease in olive flounder of Korea. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=disease" title="disease">disease</a>, <a href="https://publications.waset.org/abstracts/search?q=emaciation" title=" emaciation"> emaciation</a>, <a href="https://publications.waset.org/abstracts/search?q=olive%20flounder" title=" olive flounder"> olive flounder</a>, <a href="https://publications.waset.org/abstracts/search?q=phylogenetic%20analysis" title=" phylogenetic analysis"> phylogenetic analysis</a> </p> <a href="https://publications.waset.org/abstracts/97913/phylogenetic-analysis-of-the-myxosporea-detected-from-emaciated-olive-flounder-paralichthys-olivaceus-in-korea" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/97913.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">299</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1160</span> Nucleotide Diversity and Bacterial Endosymbionts of the Black Cherry Aphid Myzus cerasi (Fabricus, 1775) (Hemiptera: Aphididae) from Turkey</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Burcu%20Inal">Burcu Inal</a>, <a href="https://publications.waset.org/abstracts/search?q=Irfan%20Kandemir"> Irfan Kandemir</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Sequences of mitochondrial cytochrome oxidase I (COI) gene of twenty-five Turkish and one Greek Myzus cerasi (Fabricus) (Hemiptera: Aphididae) in populations were collected from Prunus avium and Prunus cerasus. The partial coding region of COI studied is 605 bp for all the populations, from which 565 nucleotides were conserved, 40 were variable, 37 were singleton, and 3 sites were parsimony-informative. Four haplotypes were identified based on nucleotide substitutions, and the mean of intraspecific divergence was calculated to be 0.3%. Phylogenetic trees were constructed using Maximum Likelihood, Minimum Evolution, Neighbor-joining, and Unweighed Pair Group Method of Arithmetic Averages (UPGMA) and Myzus persicae (Sulzer) and Myzus borealis Ossiannilson were included as outgroups. The population of M. cerasi from Isparta diverged from the rest of the groups and formed a clade (Haplotype B) with Myzus borealis. The rest of the haplotype diversity includes Haplotype A and Haplotype C with individuals characterized as Myzus cerasi pruniavium and Haplotype D with Myzus cerasi cerasi. M. cerasi diverge into two subspecies and it must be reevaluated whether this pest is monophagous or oligophagous in terms of plant type dependence. The obligated endosymbiont Buchnera aphidicola was also found during this research, but no facultative symbionts could be found. It is expected further studies will be required for a complete barcoding and diversity of bacterial endosymbionts present. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=bacterial%20endosymbionts" title="bacterial endosymbionts">bacterial endosymbionts</a>, <a href="https://publications.waset.org/abstracts/search?q=barcoding" title=" barcoding"> barcoding</a>, <a href="https://publications.waset.org/abstracts/search?q=black%20cherry%20aphid" title=" black cherry aphid"> black cherry aphid</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide%20diversity" title=" nucleotide diversity"> nucleotide diversity</a> </p> <a href="https://publications.waset.org/abstracts/96291/nucleotide-diversity-and-bacterial-endosymbionts-of-the-black-cherry-aphid-myzus-cerasi-fabricus-1775-hemiptera-aphididae-from-turkey" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/96291.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">173</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1159</span> The Role of MAOA Gene in the Etiology of Autism Spectrum Disorder in Males</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Jana%20Kiskov%C3%A1">Jana Kisková</a>, <a href="https://publications.waset.org/abstracts/search?q=Dana%20Gabrikov%C3%A1"> Dana Gabriková</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Monoamine oxidase A gene (MAOA) is suggested to be a candidate gene implicated in many neuropsychiatric disorders, including autism spectrum disorder (ASD). This meta-analytic review evaluates the relationship between ASD and MAOA markers such as 30 bp variable number tandem repeats in the promoter region (uVNTR) and single nucleotide polymorphisms (SNPs) by using findings from recently published studies. It seems that in Caucasian males, the risk of developing ASD increase with the presence of 4-repeat allele in the promoter region of MAOA gene whereas no differences were found between autistic patients and controls in Egyptian, West Bengal and Korean population. Some studies point to the importance specific haplotype groups of SNPs and interaction of MAOA with others genes (e.g. FOXP2 or SRY). The results of existing studies are insufficient and further research is needed. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=autism%20spectrum%20disorder" title="autism spectrum disorder">autism spectrum disorder</a>, <a href="https://publications.waset.org/abstracts/search?q=MAOA" title=" MAOA"> MAOA</a>, <a href="https://publications.waset.org/abstracts/search?q=uVNTR" title=" uVNTR"> uVNTR</a>, <a href="https://publications.waset.org/abstracts/search?q=single%20nucleotide%20polymorphism" title=" single nucleotide polymorphism"> single nucleotide polymorphism</a> </p> <a href="https://publications.waset.org/abstracts/14965/the-role-of-maoa-gene-in-the-etiology-of-autism-spectrum-disorder-in-males" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/14965.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">384</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1158</span> Computational Investigation on Structural and Functional Impact of Oncogenes and Tumor Suppressor Genes on Cancer</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Abdoulie%20K.%20Ceesay">Abdoulie K. Ceesay</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Within the sequence of the whole genome, it is known that 99.9% of the human genome is similar, whilst our difference lies in just 0.1%. Among these minor dissimilarities, the most common type of genetic variations that occurs in a population is SNP, which arises due to nucleotide substitution in a protein sequence that leads to protein destabilization, alteration in dynamics, and other physio-chemical properties’ distortions. While causing variations, they are equally responsible for our difference in the way we respond to a treatment or a disease, including various cancer types. There are two types of SNPs; synonymous single nucleotide polymorphism (sSNP) and non-synonymous single nucleotide polymorphism (nsSNP). sSNP occur in the gene coding region without causing a change in the encoded amino acid, while nsSNP is deleterious due to its replacement of a nucleotide residue in the gene sequence that results in a change in the encoded amino acid. Predicting the effects of cancer related nsSNPs on protein stability, function, and dynamics is important due to the significance of phenotype-genotype association of cancer. In this thesis, Data of 5 oncogenes (ONGs) (AKT1, ALK, ERBB2, KRAS, BRAF) and 5 tumor suppressor genes (TSGs) (ESR1, CASP8, TET2, PALB2, PTEN) were retrieved from ClinVar. Five common in silico tools; Polyphen, Provean, Mutation Assessor, Suspect, and FATHMM, were used to predict and categorize nsSNPs as deleterious, benign, or neutral. To understand the impact of each variation on the phenotype, Maestro, PremPS, Cupsat, and mCSM-NA in silico structural prediction tools were used. This study comprises of in-depth analysis of 10 cancer gene variants downloaded from Clinvar. Various analysis of the genes was conducted to derive a meaningful conclusion from the data. Research done indicated that pathogenic variants are more common among ONGs. Our research also shows that pathogenic and destabilizing variants are more common among ONGs than TSGs. Moreover, our data indicated that ALK(409) and BRAF(86) has higher benign count among ONGs; whilst among TSGs, PALB2(1308) and PTEN(318) genes have higher benign counts. Looking at the individual cancer genes predisposition or frequencies of causing cancer according to our research data, KRAS(76%), BRAF(55%), and ERBB2(36%) among ONGs; and PTEN(29%) and ESR1(17%) among TSGs have higher tendencies of causing cancer. Obtained results can shed light to the future research in order to pave new frontiers in cancer therapies. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=tumor%20suppressor%20genes%20%28TSGs%29" title="tumor suppressor genes (TSGs)">tumor suppressor genes (TSGs)</a>, <a href="https://publications.waset.org/abstracts/search?q=oncogenes%20%28ONGs%29" title=" oncogenes (ONGs)"> oncogenes (ONGs)</a>, <a href="https://publications.waset.org/abstracts/search?q=non%20synonymous%20single%20nucleotide%20polymorphism%20%28nsSNP%29" title=" non synonymous single nucleotide polymorphism (nsSNP)"> non synonymous single nucleotide polymorphism (nsSNP)</a>, <a href="https://publications.waset.org/abstracts/search?q=single%20nucleotide%20polymorphism%20%28SNP%29" title=" single nucleotide polymorphism (SNP)"> single nucleotide polymorphism (SNP)</a> </p> <a href="https://publications.waset.org/abstracts/159590/computational-investigation-on-structural-and-functional-impact-of-oncogenes-and-tumor-suppressor-genes-on-cancer" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/159590.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">86</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1157</span> Functional Analysis of Thyroid Peroxidase (TPO) Gene Mutations Detected in Patients with Thyroid Dyshormonogenesis</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Biswabandhu%20Bankura">Biswabandhu Bankura</a>, <a href="https://publications.waset.org/abstracts/search?q=Srikanta%20Guria"> Srikanta Guria</a>, <a href="https://publications.waset.org/abstracts/search?q=Madhusudan%20Das"> Madhusudan Das</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Purpose: Thyroid peroxidase (TPO) is the key enzyme in the biosynthesis of thyroid hormones. We aimed to identify the spectrum of mutations in the TPO gene leading to hypothyroidism in the population of West Bengal to establish the genetic etiology of the disease. Methods: 200 hypothyroid patients (case) and their corresponding sex and age matched 200 normal individuals (control) were screened depending on their clinical manifestations. Genomic DNA was isolated from peripheral blood samples and TPO gene (Exon 7 to Exon 14) was amplified by PCR. The PCR products were subjected to sequencing to identify mutations. Results: Single nucleotide changes such as Glu 641 Lys, Asp 668 Asn, Thr 725 Pro, Asp 620 Asn, Ser 398 Thr, and Ala 373 Ser were found. Changes in the TPO were assayed in vitro to compare mutant and wild-type activities. Five mutants were enzymatically inactive in the guaiacol and iodide assays. This is a strong indication that the mutations are present at crucial positions of the TPO gene, resulting in inactivated TPO. Key Findings: The results of this study may help to develop a genetic screening protocol for goiter and hypothyroidism in the population of West Bengal. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=thyroid%20peroxidase" title="thyroid peroxidase">thyroid peroxidase</a>, <a href="https://publications.waset.org/abstracts/search?q=hypothyroidism" title=" hypothyroidism"> hypothyroidism</a>, <a href="https://publications.waset.org/abstracts/search?q=mutation" title=" mutation"> mutation</a>, <a href="https://publications.waset.org/abstracts/search?q=in%20vitro%20assay" title=" in vitro assay"> in vitro assay</a>, <a href="https://publications.waset.org/abstracts/search?q=transfection" title=" transfection"> transfection</a> </p> <a href="https://publications.waset.org/abstracts/20470/functional-analysis-of-thyroid-peroxidase-tpo-gene-mutations-detected-in-patients-with-thyroid-dyshormonogenesis" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/20470.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">345</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1156</span> Functional Analysis of Thyroid Peroxidase Gene Mutations Detected in Patients with Thyroid Dyshormonogenesis</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Biswabandhu%20Bankura">Biswabandhu Bankura</a>, <a href="https://publications.waset.org/abstracts/search?q=Srikanta%20Guria"> Srikanta Guria</a>, <a href="https://publications.waset.org/abstracts/search?q=Madhusudan%20Das"> Madhusudan Das</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Purpose: Thyroid peroxidase (TPO) is the key enzyme in the biosynthesis of thyroid hormones. We aimed to identify the spectrum of mutations in the TPO gene leading to hypothyroidism in the population of West Bengal to establish the genetic etiology of the disease. Methods: 200 hypothyroid patients (case) and their corresponding sex and age matched 200 normal individuals (control) were screened depending on their clinical manifestations. Genomic DNA was isolated from peripheral blood samples and TPO gene (Exon 7 to Exon 14) was amplified by PCR. The PCR products were subjected to sequencing to identify mutations. Results: Single nucleotide changes such as Glu 641 Lys, Asp 668 Asn, Thr 725 Pro, Asp 620 Asn, Ser 398 Thr, and Ala 373 Ser were found. Changes in the TPO were assayed in vitro to compare mutant and wild-type activities. Five mutants were enzymatically inactive in the guaiacol and iodide assays. This is a strong indication that the mutations are present at crucial positions of the TPO gene, resulting in inactivated TPO. Key Findings: The results of this study may help to develop a genetic screening protocol for goiter and hypothyroidism in the population of West Bengal. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=thyroid%20peroxidase" title="thyroid peroxidase">thyroid peroxidase</a>, <a href="https://publications.waset.org/abstracts/search?q=hypothyroidism" title=" hypothyroidism"> hypothyroidism</a>, <a href="https://publications.waset.org/abstracts/search?q=mutation" title=" mutation"> mutation</a>, <a href="https://publications.waset.org/abstracts/search?q=in%20vitro%20assay" title=" in vitro assay"> in vitro assay</a>, <a href="https://publications.waset.org/abstracts/search?q=transfection" title=" transfection"> transfection</a> </p> <a href="https://publications.waset.org/abstracts/19059/functional-analysis-of-thyroid-peroxidase-gene-mutations-detected-in-patients-with-thyroid-dyshormonogenesis" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/19059.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">334</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1155</span> CRISPR-DT: Designing gRNAs for the CRISPR-Cpf1 System with Improved Target Efficiency and Specificity</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Houxiang%20Zhu">Houxiang Zhu</a>, <a href="https://publications.waset.org/abstracts/search?q=Chun%20Liang"> Chun Liang</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The CRISPR-Cpf1 system has been successfully applied in genome editing. However, target efficiency of the CRISPR-Cpf1 system varies among different gRNA sequences. The published CRISPR-Cpf1 gRNA data was reanalyzed. Many sequences and structural features of gRNAs (e.g., the position-specific nucleotide composition, position-nonspecific nucleotide composition, GC content, minimum free energy, and melting temperature) correlated with target efficiency were found. Using machine learning technology, a support vector machine (SVM) model was created to predict target efficiency for any given gRNAs. The first web service application, CRISPR-DT (CRISPR DNA Targeting), has been developed to help users design optimal gRNAs for the CRISPR-Cpf1 system by considering both target efficiency and specificity. CRISPR-DT will empower researchers in genome editing. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=CRISPR-Cpf1" title="CRISPR-Cpf1">CRISPR-Cpf1</a>, <a href="https://publications.waset.org/abstracts/search?q=genome%20editing" title=" genome editing"> genome editing</a>, <a href="https://publications.waset.org/abstracts/search?q=target%20efficiency" title=" target efficiency"> target efficiency</a>, <a href="https://publications.waset.org/abstracts/search?q=target%20specificity" title=" target specificity"> target specificity</a> </p> <a href="https://publications.waset.org/abstracts/93235/crispr-dt-designing-grnas-for-the-crispr-cpf1-system-with-improved-target-efficiency-and-specificity" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/93235.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">262</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1154</span> Association of Single Nucleotide Polymorphisms in Leptin and Leptin Receptors with Oral Cancer</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Chiung-Man%20Tsai">Chiung-Man Tsai</a>, <a href="https://publications.waset.org/abstracts/search?q=Chia-Jui%20Weng"> Chia-Jui Weng</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Leptin (LEP) and leptin receptor (LEPR) both play a crucial role in the mediation of physiological reactions and carcinogenesis and may serve as a candidate biomarker of oral cancer. The present case-control study aimed to examine the effects of single nucleotide polymorphisms (SNPs) of LEP -2548 G/A (rs7799039), LEPR K109R (rs1137100), and LEPR Q223R (rs1137101) with or without interacting to environmental carcinogens on the risk for oral squamous cell carcinoma (OSCC). The SNPs of three genetic allele, from 567 patients with oral cancer and 560 healthy controls in Taiwan were analyzed. All of The three genetic polymorphisms exhibited insignificant (P > .05) effects on the risk to have oral cancer. However, the patients with polymorphic allele of LEP -2548 have a significant low risk for the development of clinical stage (A/G, AOR = 0.670, 95% CI = 0.454–0.988, P < .05; A/G+G/G, AOR = 0.676, 95% CI = 0.467–0.978, P < .05) compared to patients with ancestral homozygous A/A genotype. Additionally, an interesting result was found that the impact of LEP -2548 G/A SNP on oral carcinogenesis in subjects without tobacco consumption (A/G, AOR=2.078, 95% CI: 1.161-3.720, p=0.014; A/G+G/G, AOR=2.002, 95% CI: 1.143-3.505, p=0.015) is higher than subjects with tobacco consumption. These results suggest that the genetic polymorphism of LEP -2548 G/A (rs7799039), LEPR K109R (rs1137100), and LEPR Q223R (rs1137101) were not associated with the susceptibility of oral cancer; SNP in LEP -2548 G/A showed a poor clinicopathological development of oral cancer; Population without tobacco consumption and with polymorphic LEP -2548 G/A gene may significantly increase the risk to have oral cancer. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=carcinogen" title="carcinogen">carcinogen</a>, <a href="https://publications.waset.org/abstracts/search?q=leptin" title=" leptin"> leptin</a>, <a href="https://publications.waset.org/abstracts/search?q=leptin%20receptor" title=" leptin receptor"> leptin receptor</a>, <a href="https://publications.waset.org/abstracts/search?q=oral%20squamous%20cell%20carcinoma" title=" oral squamous cell carcinoma"> oral squamous cell carcinoma</a>, <a href="https://publications.waset.org/abstracts/search?q=single%20nucleotide%20polymorphism" title=" single nucleotide polymorphism"> single nucleotide polymorphism</a> </p> <a href="https://publications.waset.org/abstracts/105176/association-of-single-nucleotide-polymorphisms-in-leptin-and-leptin-receptors-with-oral-cancer" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/105176.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">185</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1153</span> Ultrasensitive Detection and Discrimination of Cancer-Related Single Nucleotide Polymorphisms Using Poly-Enzyme Polymer Bead Amplification</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Lorico%20D.%20S.%20Lapitan%20Jr.">Lorico D. S. Lapitan Jr.</a>, <a href="https://publications.waset.org/abstracts/search?q=Yihan%20Xu"> Yihan Xu</a>, <a href="https://publications.waset.org/abstracts/search?q=Yuan%20Guo"> Yuan Guo</a>, <a href="https://publications.waset.org/abstracts/search?q=Dejian%20Zhou"> Dejian Zhou</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The ability of ultrasensitive detection of specific genes and discrimination of single nucleotide polymorphisms is important for clinical diagnosis and biomedical research. Herein, we report the development of a new ultrasensitive approach for label-free DNA detection using magnetic nanoparticle (MNP) assisted rapid target capture/separation in combination with signal amplification using poly-enzyme tagged polymer nanobead. The sensor uses an MNP linked capture DNA and a biotin modified signal DNA to sandwich bind the target followed by ligation to provide high single-nucleotide polymorphism discrimination. Only the presence of a perfect match target DNA yields a covalent linkage between the capture and signal DNAs for subsequent conjugation of a neutravidin-modified horseradish peroxidase (HRP) enzyme through the strong biotin-nuetravidin interaction. This converts each captured DNA target into an HRP which can convert millions of copies of a non-fluorescent substrate (amplex red) to a highly fluorescent product (resorufin), for great signal amplification. The use of polymer nanobead each tagged with thousands of copies of HRPs as the signal amplifier greatly improves the signal amplification power, leading to greatly improved sensitivity. We show our biosensing approach can specifically detect an unlabeled DNA target down to 10 aM with a wide dynamic range of 5 orders of magnitude (from 0.001 fM to 100.0 fM). Furthermore, our approach has a high discrimination between a perfectly matched gene and its cancer-related single-base mismatch targets (SNPs): It can positively detect the perfect match DNA target even in the presence of 100 fold excess of co-existing SNPs. This sensing approach also works robustly in clinical relevant media (e.g. 10% human serum) and gives almost the same SNP discrimination ratio as that in clean buffers. Therefore, this ultrasensitive SNP biosensor appears to be well-suited for potential diagnostic applications of genetic diseases. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=DNA%20detection" title="DNA detection">DNA detection</a>, <a href="https://publications.waset.org/abstracts/search?q=polymer%20beads" title=" polymer beads"> polymer beads</a>, <a href="https://publications.waset.org/abstracts/search?q=signal%20amplification" title=" signal amplification"> signal amplification</a>, <a href="https://publications.waset.org/abstracts/search?q=single%20nucleotide%20polymorphisms" title=" single nucleotide polymorphisms"> single nucleotide polymorphisms</a> </p> <a href="https://publications.waset.org/abstracts/74787/ultrasensitive-detection-and-discrimination-of-cancer-related-single-nucleotide-polymorphisms-using-poly-enzyme-polymer-bead-amplification" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/74787.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">249</span> </span> </div> </div> <ul class="pagination"> <li class="page-item disabled"><span class="page-link">&lsaquo;</span></li> <li class="page-item active"><span class="page-link">1</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=2">2</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=3">3</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=4">4</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=5">5</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=6">6</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=7">7</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=8">8</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=9">9</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=10">10</a></li> <li class="page-item disabled"><span class="page-link">...</span></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=39">39</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=40">40</a></li> <li class="page-item"><a class="page-link" href="https://publications.waset.org/abstracts/search?q=encompassing%20nucleotide%20positions%2037%20to%20340&page=2" rel="next">&rsaquo;</a></li> </ul> </div> </main> <footer> <div id="infolinks" class="pt-3 pb-2"> <div class="container"> <div style="background-color:#f5f5f5;" class="p-3"> <div class="row"> <div class="col-md-2"> <ul class="list-unstyled"> About <li><a href="https://waset.org/page/support">About Us</a></li> <li><a href="https://waset.org/page/support#legal-information">Legal</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/WASET-16th-foundational-anniversary.pdf">WASET celebrates its 16th foundational anniversary</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Account <li><a href="https://waset.org/profile">My Account</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Explore <li><a href="https://waset.org/disciplines">Disciplines</a></li> <li><a href="https://waset.org/conferences">Conferences</a></li> <li><a href="https://waset.org/conference-programs">Conference Program</a></li> <li><a href="https://waset.org/committees">Committees</a></li> <li><a href="https://publications.waset.org">Publications</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Research <li><a href="https://publications.waset.org/abstracts">Abstracts</a></li> <li><a href="https://publications.waset.org">Periodicals</a></li> <li><a href="https://publications.waset.org/archive">Archive</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Open Science <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Philosophy.pdf">Open Science Philosophy</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Award.pdf">Open Science Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Society-Open-Science-and-Open-Innovation.pdf">Open Innovation</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Postdoctoral-Fellowship-Award.pdf">Postdoctoral Fellowship Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Scholarly-Research-Review.pdf">Scholarly Research Review</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Support <li><a href="https://waset.org/page/support">Support</a></li> <li><a href="https://waset.org/profile/messages/create">Contact Us</a></li> <li><a href="https://waset.org/profile/messages/create">Report Abuse</a></li> </ul> </div> </div> </div> </div> </div> <div class="container text-center"> <hr style="margin-top:0;margin-bottom:.3rem;"> <a href="https://creativecommons.org/licenses/by/4.0/" target="_blank" class="text-muted small">Creative Commons Attribution 4.0 International License</a> <div id="copy" class="mt-2">© 2024 World Academy of Science, Engineering and Technology</div> </div> </footer> <a href="javascript:" id="return-to-top"><i class="fas fa-arrow-up"></i></a> <div class="modal" id="modal-template"> <div class="modal-dialog"> <div class="modal-content"> <div class="row m-0 mt-1"> <div class="col-md-12"> <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">×</span></button> </div> </div> <div class="modal-body"></div> </div> </div> </div> <script src="https://cdn.waset.org/static/plugins/jquery-3.3.1.min.js"></script> <script src="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/js/bootstrap.bundle.min.js"></script> <script src="https://cdn.waset.org/static/js/site.js?v=150220211556"></script> <script> jQuery(document).ready(function() { /*jQuery.get("https://publications.waset.org/xhr/user-menu", function (response) { jQuery('#mainNavMenu').append(response); });*/ jQuery.get({ url: "https://publications.waset.org/xhr/user-menu", cache: false }).then(function(response){ jQuery('#mainNavMenu').append(response); }); }); </script> </body> </html>