Inflammation primes the murine kidney for recovery by activating AZIN1 adenosine-to-inosine editing

<!DOCTYPE html> <html lang="en" > <head > <meta charset="UTF-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge" /> <meta name="HandheldFriendly" content="True" /> <meta name="MobileOptimized" content="320" /> <meta name="viewport" content="width=device-width, initial-scale=1.0" /> <link rel="stylesheet" href="/static/assets/style-70b9163a.css" /> <script type="module" crossorigin="" src="/static/assets/base_style-ec2bc71e.js"></script> <link rel="stylesheet" href="/static/assets/style-ef962842.css" /> <link rel="stylesheet" href="/static/assets/style-3ade8b5c.css" /> <script type="module" crossorigin="" src="/static/assets/article_style-d757a0dd.js"></script> <style> @media screen and (min-width: 64em) { div.pmc-wm { background: repeat-y; background-image: url("data:image/svg+xml,%3Csvg xmlns='http://www.w3.org/2000/svg' width='20' height='350' xmlns:xlink='http://www.w3.org/1999/xlink'%3E%3Cdefs%3E%3Cfilter x='-.02' y='0' width='1.05' height='1' id='c'%3E%3CfeFlood flood-color='%23FFF'/%3E%3CfeComposite in='SourceGraphic'/%3E%3C/filter%3E%3Ctext id='b' font-family='Helvetica' font-size='11pt' style='opacity:1;fill:%23005ea2;stroke:none;text-anchor:middle' x='175' y='14'%3E%3C/text%3E%3Cpath id='a' style='fill:%23005ea2' d='M0 8h350v3H0z'/%3E%3C/defs%3E%3Cuse xlink:href='%23a' transform='rotate(90 10 10)'/%3E%3Cuse xlink:href='%23b' transform='rotate(90 10 10)' filter='url(%23c)'/%3E%3C/svg%3E"); padding-left: 3rem; } } </style> <link rel="apple-touch-icon" sizes="180x180" href="/static/img/favicons/apple-touch-icon.png" /> <link rel="icon" type="image/png" sizes="48x48" href="/static/img/favicons/favicon-48x48.png" /> <link rel="icon" type="image/png" sizes="32x32" href="/static/img/favicons/favicon-32x32.png" /> <link rel="icon" type="image/png" sizes="16x16" href="/static/img/favicons/favicon-16x16.png" /> <link rel="manifest" href="/static/img/favicons/site.webmanifest" /> <link rel="mask-icon" href="/static/img/favicons/safari-pinned-tab.svg" color="#0071bc" /> <meta name="msapplication-config" content="/static/img/favicons/browserconfig.xml" /> <meta name="theme-color" content="#ffffff" /> <title> Inflammation primes the murine kidney for recovery by activating AZIN1 adenosine-to-inosine editing - PMC </title>  <meta name="ncbi_app" content="cloudpmc-viewer" /> <meta name="ncbi_db" content="pmc" /> <meta name="ncbi_phid" content="6E4BC8BD746B258305C8BD00106CF04F.m_1" />  <meta name="ncbi_pdid" content="article" /> <link rel="preconnect" href="https://www.google-analytics.com" /> <link rel="dns-prefetch" href="https://cdn.ncbi.nlm.nih.gov" /> <link rel="preconnect" href="https://code.jquery.com" /> <meta name="ncbi_domain" content="jcinvest"> <meta name="ncbi_type" content="fulltext"> <meta name="ncbi_pcid" content="journal"> <meta name="ncbi_feature" content="associated_data"> <link rel="canonical" href="https://pmc.ncbi.nlm.nih.gov/articles/PMC11364396/"> <meta name="robots" content="INDEX,NOFOLLOW,NOARCHIVE"> <meta name="citation_journal_title" content="The Journal of Clinical Investigation"> <meta name="citation_title" content="Inflammation primes the murine kidney for recovery by activating AZIN1 adenosine-to-inosine editing"> <meta name="citation_author" content="Segewkal Hawaze Heruye"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Jered Myslinski"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Chao Zeng"> <meta name="citation_author_institution" content="Faculty of Science and Engineering, Waseda University, Tokyo, Japan."> <meta name="citation_author" content="Amy Zollman"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Shinichi Makino"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Azuma Nanamatsu"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Quoseena Mir"> <meta name="citation_author_institution" content="Luddy School of Informatics, Computing, and Engineering, Indiana University, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Sarath Chandra Janga"> <meta name="citation_author_institution" content="Luddy School of Informatics, Computing, and Engineering, Indiana University, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Emma H Doud"> <meta name="citation_author_institution" content="Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Michael T Eadon"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Bernhard Maier"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Michiaki Hamada"> <meta name="citation_author_institution" content="Faculty of Science and Engineering, Waseda University, Tokyo, Japan."> <meta name="citation_author_institution" content="AIST–Waseda University Computational Bio Big-Data Open Innovation Laboratory, National Institute of Advanced Industrial Science and Technology, Tokyo, Japan."> <meta name="citation_author_institution" content="Graduate School of Medicine, Nippon Medical School, Tokyo, Japan."> <meta name="citation_author" content="Tuan M Tran"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author_institution" content="Richard L. Roudebush Veterans Affairs Medical Center, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Pierre C Dagher"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author" content="Takashi Hato"> <meta name="citation_author_institution" content="Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_author_institution" content="Richard L. Roudebush Veterans Affairs Medical Center, Indianapolis, Indiana, USA."> <meta name="citation_author_institution" content="Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, Indiana, USA."> <meta name="citation_publication_date" content="2024 Sep 3"> <meta name="citation_volume" content="134"> <meta name="citation_issue" content="17"> <meta name="citation_firstpage" content="e180117"> <meta name="citation_doi" content="10.1172/JCI180117"> <meta name="citation_pmid" content="38954486"> <meta name="citation_abstract_html_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC11364396/"> <meta name="citation_fulltext_html_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC11364396/"> <meta name="citation_pdf_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC11364396/pdf/jci-134-180117.pdf"> <meta name="description" content="The progression of kidney disease varies among individuals, but a general methodology to quantify disease timelines is lacking. Particularly challenging is the task of determining the potential for recovery from acute kidney injury following various ..."> <meta name="og:title" content="Inflammation primes the murine kidney for recovery by activating AZIN1 adenosine-to-inosine editing"> <meta name="og:type" content="article"> <meta name="og:site_name" content="PubMed Central (PMC)"> <meta name="og:description" content="The progression of kidney disease varies among individuals, but a general methodology to quantify disease timelines is lacking. Particularly challenging is the task of determining the potential for recovery from acute kidney injury following various ..."> <meta name="og:url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC11364396/"> <meta name="og:image" content="https://cdn.ncbi.nlm.nih.gov/pmc/cms/images/pmc-card-share.jpg?_=0"> <meta name="twitter:card" content="summary_large_image"> <meta name="twitter:site" content="@ncbi"> </head> <body > <a class="usa-skipnav " href="#main-content"> Skip to main content </a> <section class="usa-banner " aria-label="Official website of the United States government" > <div class="usa-accordion"> <header class="usa-banner__header"> <div class="usa-banner__inner"> <div class="grid-col-auto"> <img aria-hidden="true" class="usa-banner__header-flag" src="/static/img/us_flag.svg" alt="" /> </div> <div class="grid-col-fill tablet:grid-col-auto" aria-hidden="true"> <p class="usa-banner__header-text"> An official website of the United States government </p> <span class="usa-banner__header-action">Here's how you know</span> </div> <button type="button" class="usa-accordion__button usa-banner__button " aria-expanded="false" aria-controls="gov-banner-default" data-testid="storybook-django-banner" > <span class="usa-banner__button-text">Here's how you know</span> </button> </div> </header> <div class="usa-banner__content usa-accordion__content" id="gov-banner-default" hidden> <div class="grid-row grid-gap-lg"> <div class="usa-banner__guidance tablet:grid-col-6"> <img class="usa-banner__icon usa-media-block__img" src="/static/img/icon-dot-gov.svg" alt="" aria-hidden="true" /> <div class="usa-media-block__body"> <p> <strong>Official websites use .gov</strong> <br /> A <strong>.gov</strong> website belongs to an official government organization in the United States. </p> </div> </div> <div class="usa-banner__guidance tablet:grid-col-6"> <img class="usa-banner__icon usa-media-block__img" src="/static/img/icon-https.svg" alt="" aria-hidden="true" /> <div class="usa-media-block__body"> <p> <strong>Secure .gov websites use HTTPS</strong> <br /> A <strong>lock</strong> ( <span class="icon-lock"> <svg xmlns="http://www.w3.org/2000/svg" width="52" height="64" viewBox="0 0 52 64" class="usa-banner__lock-image" role="graphics-symbol" aria-labelledby="banner-lock-description" focusable="false"> <title id="banner-lock-title">Lock</title> <desc id="banner-lock-description"> Locked padlock icon </desc> <path fill="#000000" fill-rule="evenodd" d="M26 0c10.493 0 19 8.507 19 19v9h3a4 4 0 0 1 4 4v28a4 4 0 0 1-4 4H4a4 4 0 0 1-4-4V32a4 4 0 0 1 4-4h3v-9C7 8.507 15.507 0 26 0zm0 8c-5.979 0-10.843 4.77-10.996 10.712L15 19v9h22v-9c0-6.075-4.925-11-11-11z" /> </svg> </span>) or <strong>https://</strong> means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. </p> </div> </div> </div> </div> </div> </section> <div class="usa-overlay"> </div> <header class="usa-header usa-header--extended usa-header--wide" data-testid="header" data-header > <div class="ncbi-header"> <div class="ncbi-header__container"> <a class="ncbi-header__logo-container" href="/"> <img alt=" PMC home page " class="ncbi-header__logo-image" src="/static/img/ncbi-logos/nih-nlm-ncbi--white.svg" /> </a>  <button type="button" class="usa-menu-btn ncbi-header__hamburger-button " aria-label="Show menu" data-testid="navMenuButton" > <svg aria-hidden="true" class="ncbi-hamburger-icon" fill="none" focusable="false" height="21" viewBox="0 0 31 21" width="31" xmlns="http://www.w3.org/2000/svg"> <path clip-rule="evenodd" d="M0.125 20.75H30.875V17.3333H0.125V20.75ZM0.125 12.2083H30.875V8.79167H0.125V12.2083ZM0.125 0.25V3.66667H30.875V0.25H0.125Z" fill="#F1F1F1" fill-rule="evenodd" /> </svg> </button>  <div class="ncbi-header__desktop-buttons">  <button type="button" class="usa-button usa-button--unstyled ncbi-header__desktop-button " aria-expanded="false" aria-controls="search-field-desktop-navigation" aria-label="Show search overlay" data-testid="toggleSearchPanelButton" data-toggle-search-panel-button > <svg class="usa-icon " role="graphics-symbol" aria-hidden="true" > <use xlink:href="/static/img/sprite.svg#search" /> </svg> Search </button>  <div class="ncbi-header__login-dropdown"> <button type="button" class="usa-button usa-button--unstyled ncbi-header__desktop-button ncbi-header__login-dropdown-button " aria-expanded="false" aria-controls="login-dropdown-menu" aria-label="Show login menu" data-testid="toggleLoginMenuDropdown" data-desktop-login-button > <svg class="usa-icon " role="graphics-symbol" aria-hidden="true" > <use xlink:href="/static/img/sprite.svg#person" /> </svg> <span data-login-dropdown-text>Log in</span>  <svg class="usa-icon ncbi-header__login-dropdown-icon ncbi-header__login-dropdown-icon--expand-less ncbi-header__login-dropdown-icon--hidden" role="graphics-symbol" aria-hidden="true" data-login-dropdown-up-arrow> <use xlink:href="/static/img/sprite.svg#expand_less" /> </svg>  <svg class="usa-icon ncbi-header__login-dropdown-icon ncbi-header__login-dropdown-icon--expand-more ncbi-header__login-dropdown-icon--hidden" role="graphics-symbol" aria-hidden="true" data-login-dropdown-down-arrow> <use xlink:href="/static/img/sprite.svg#expand_more" /> </svg> </button>  <ul class="usa-nav__submenu ncbi-header__login-dropdown-menu" id="login-dropdown-menu" data-desktop-login-menu-dropdown hidden> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/myncbi/" class="usa-link " > Dashboard </a> </li> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/myncbi/collections/bibliography/" class="usa-link " > Publications </a> </li> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/account/settings/" class="usa-link " > Account settings </a> </li> <li class="usa-nav__submenu-item"> <button type="button" class="usa-button usa-button--outline ncbi-header__login-dropdown-logout-button " data-testid="desktopLogoutButton" data-desktop-logout-button > Log out </button> </li> </ul> </div> </div> </div> </div>  <div class="ncbi-search-panel ncbi--show-only-at-desktop" data-testid="searchPanel" data-header-search-panel hidden> <div class="ncbi-search-panel__container"> <form action="https://www.ncbi.nlm.nih.gov/search/all/" aria-describedby="search-field-desktop-navigation-help-text" autocomplete="off" class="usa-search usa-search--big ncbi-search-panel__form" data-testid="form" method="GET" role="search"> <label class="usa-sr-only" data-testid="label" for="search-field-desktop-navigation"> Search… </label> <input class="usa-input" data-testid="textInput" id="search-field-desktop-navigation" name="term" placeholder="Search NCBI" type="search" value="" /> <button type="submit" class="usa-button " data-testid="button" > <span class="usa-search__submit-text"> Search NCBI </span> </button> </form> </div> </div> <nav aria-label="Primary navigation" class="usa-nav"> <p class="usa-sr-only" id="primary-navigation-sr-only-title"> Primary site navigation </p>  <button type="button" class="usa-nav__close ncbi-nav__close-button " aria-label="Close navigation menu" data-testid="navCloseButton" > <img src="/static/img/usa-icons/close.svg" alt="Close" /> </button>  <form class="usa-search usa-search--small ncbi--hide-at-desktop margin-top-6" role="search"> <label class="usa-sr-only" for="search-field"> Search </label> <input class="usa-input" id="search-field-mobile-navigation" type="search" placeholder="Search NCBI" name="search" /> <button type="submit" class="usa-button " >  <img src="data:image/svg+xml;base64,PHN2ZyB4bWxucz0iaHR0cDovL3d3dy53My5vcmcvMjAwMC9zdmciIGhlaWdodD0iMjQiIHZpZXdCb3g9IjAgMCAyNCAyNCIgd2lkdGg9IjI0Ij48cGF0aCBkPSJNMCAwaDI0djI0SDB6IiBmaWxsPSJub25lIi8+PHBhdGggZmlsbD0iI2ZmZiIgZD0iTTE1LjUgMTRoLS43OWwtLjI4LS4yN0E2LjQ3MSA2LjQ3MSAwIDAgMCAxNiA5LjUgNi41IDYuNSAwIDEgMCA5LjUgMTZjMS42MSAwIDMuMDktLjU5IDQuMjMtMS41N2wuMjcuMjh2Ljc5bDUgNC45OUwyMC40OSAxOWwtNC45OS01em0tNiAwQzcuMDEgMTQgNSAxMS45OSA1IDkuNVM3LjAxIDUgOS41IDUgMTQgNy4wMSAxNCA5LjUgMTEuOTkgMTQgOS41IDE0eiIvPjwvc3ZnPg==" class="usa-search__submit-icon" alt="Search" /> </button> </form>   <div class="ncbi-nav__mobile-login-menu ncbi--hide-at-desktop" data-mobile-login-menu hidden> <p class="ncbi-nav__mobile-login-menu-status"> Logged in as: <strong class="ncbi-nav__mobile-login-menu-email" data-mobile-login-email-text></strong> </p> <ul class="usa-nav__primary usa-accordion"> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/myncbi/" class="usa-link " > Dashboard </a> </li> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/myncbi/collections/bibliography/" class="usa-link " > Publications </a> </li> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/account/settings/" class="usa-link " > Account settings </a> </li> </ul> </div> <button type="button" class="usa-button ncbi-nav__mobile-login-button ncbi--hide-at-desktop " data-testid="mobileLoginButton" data-mobile-login-button > Log in </button> </nav> </header> <section class="pmc-header pmc-header--basic" aria-label="PMC Header with search box"> <div class="pmc-nav-container"> <div class="pmc-header__bar"> <div class="pmc-header__logo"> <a href="/" title="Home" aria-label="PMC Home"></a> </div> <button type="button" class="usa-button usa-button--unstyled pmc-header__search__button" aria-label="Open search" data-ga-category="search" data-ga-action="PMC" data-ga-label="pmc_search_panel_mobile" > <svg class="usa-icon width-4 height-4 pmc-icon__open" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#search"></use> </svg> <svg class="usa-icon width-4 height-4 pmc-icon__close" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#close"></use> </svg> </button> </div> <div class="pmc-header__search"> <form class="usa-search usa-search--extra usa-search--article-right-column pmc-header__search__form" autocomplete="off" role="search"> <label class="usa-sr-only" for="pmc-search">Search PMC Full-Text Archive</label> <span class="autoComplete_wrapper flex-1"> <input class="usa-input width-full maxw-none" required="required" placeholder="Search PMC Full-Text Archive" id="pmc-search" type="search" name="term" data-autocomplete-url="/search/autocomplete/"/> </span> <button class="usa-button" type="submit" formaction="https://www.ncbi.nlm.nih.gov/pmc/" data-ga-category="search" data-ga-action="PMC" data-ga-label="PMC_search_button" > <span class="usa-search__submit-text">Search in PMC</span> <img src="/static/img/usa-icons-bg/search--white.svg" class="usa-search__submit-icon" alt="Search" /> </button> </form> <ul class="pmc-header__search__menu"> <li> <a class="usa-link" href="https://www.ncbi.nlm.nih.gov/pmc/advanced/" data-ga-action="featured_link" data-ga-label="advanced_search"> Advanced Search </a> </li> <li> <a class="usa-link" href="/journals/" data-ga-action="featured_link" data-ga-label="journal list"> Journal List </a> </li> <li> <a class="usa-link" href="/about/userguide/" data-ga-action="featured_link" data-ga-label="user guide"> User Guide </a> </li> </ul> </div> </div> </section> <div class="usa-section padding-top-0 desktop:padding-top-6 pmc-article-section" data-article-db="pmc" data-article-id="11364396"> <div class="grid-container pmc-actions-bar" aria-label="Actions bar" role="complementary"> <div class="grid-row"> <div class="grid-col-fill display-flex"> <div class="display-flex"> <ul class="usa-list usa-list--unstyled usa-list--horizontal"> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex mob"> <button type="button" class="usa-button pmc-sidenav__container__open usa-button--unstyled width-auto display-flex" aria-label="Open resources" data-extra-class="is-visible-resources" data-ga-category="resources_accordion" data-ga-action="click" data-ga-label="mobile_icon" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#more_vert"></use> </svg> </button> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex mob"> <a href="https://doi.org/10.1172/JCI180117" class="usa-link display-flex" role="button" target="_blank" rel="noreferrer noopener" aria-label="View on publisher site" data-ga-category="actions" data-ga-action="click" data-ga-label="publisher_link_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#launch"></use> </svg> </a> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <a href="pdf/jci-134-180117.pdf" class="usa-link display-flex" role="button" aria-label="Download PDF" data-ga-category="actions" data-ga-action="click" data-ga-label="pdf_download_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> </a> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <button class="usa-button usa-button--unstyled collections-dialog-trigger collections-button display-flex collections-button-empty" aria-label="Save article in MyNCBI collections." data-ga-category="actions" data-ga-action="click" data-ga-label="collections_button_mobile" data-collections-open-dialog-enabled="false" data-collections-open-dialog-url="https://account.ncbi.nlm.nih.gov/?back_url=https%3A%2F%2Fpmc.ncbi.nlm.nih.gov%2Farticles%2FPMC11364396%2F%23open-collections-dialog" data-in-collections="false" > <svg class="usa-icon width-4 height-4 usa-icon--bookmark-full" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-full.svg#icon"></use> </svg> <svg class="usa-icon width-4 height-4 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-empty.svg#icon"></use> </svg> </button> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <button role="button" class="usa-button usa-button--unstyled citation-dialog-trigger display-flex" aria-label="Open dialog with citation text in different styles" data-ga-category="actions" data-ga-action="open" data-ga-label="cite_mobile" data-all-citations-url="/resources/citations/11364396/" data-citation-style="nlm" data-download-format-link="/resources/citations/11364396/export/" > <svg class="usa-icon width-4 height-4 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#format_quote"></use> </svg> </button> </li> <li class="pmc-permalink display-flex"> <button type="button" class="usa-button usa-button--unstyled display-flex" aria-label="Show article permalink" aria-expanded="false" aria-haspopup="true" data-ga-category="actions" data-ga-action="open" data-ga-label="permalink_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#share"></use> </svg> </button> <div class="pmc-permalink__dropdown" hidden> <div class="pmc-permalink__dropdown__container"> <h2 class="usa-modal__heading margin-top-0 margin-bottom-2">PERMALINK</h2> <div class="pmc-permalink__dropdown__content"> <input type="text" class="usa-input" value="https://pmc.ncbi.nlm.nih.gov/articles/PMC11364396/" aria-label="Article permalink"> <button class="usa-button display-inline-flex pmc-permalink__dropdown__copy__btn margin-right-0" title="Copy article permalink" data-ga-category="save_share" data-ga-action="link" data-ga-label="copy_link"> <svg class="usa-icon" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span class="margin-left-1">Copy</span> </button> </div> </div> </div> </li> </ul> </div> <button type="button" class="usa-button pmc-sidenav__container__open usa-button--unstyled width-auto display-flex" aria-label="Open article navigation" data-extra-class="is-visible-in-page" data-ga-category="actions" data-ga-action="open" data-ga-label="article_nav_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#list"></use> </svg> </button> </div> </div> </div> <div class="grid-container desktop:padding-left-6"> <div id="article-container" class="grid-row grid-gap"> <div class="grid-col-12 desktop:grid-col-8 order-2 pmc-layout__content"> <div class="grid-container padding-left-0 padding-right-0"> <div class="grid-row desktop:margin-left-neg-6"> <div class="grid-col-12"> <div class="pmc-layout__disclaimer" role="complementary" aria-label="Disclaimer note"> As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health.<br/> Learn more: <a class="usa-link" data-ga-category="Link click" data-ga-action="Disclaimer" data-ga-label="New disclaimer box" href="/about/disclaimer/">PMC Disclaimer</a> | <a class="usa-link" data-ga-category="Link click" data-ga-action="PMC Copyright Notice" data-ga-label="New disclaimer box" href="/about/copyright/"> PMC Copyright Notice </a> </div> </div> </div> <div class="grid-row pmc-wm desktop:margin-left-neg-6">  <main id="main-content" class="usa-layout-docs__main usa-layout-docs grid-col-12 pmc-layout pmc-prose padding-0" > <section class="pmc-journal-banner text-center line-height-none" aria-label="Journal banner"><img src="https://cdn.ncbi.nlm.nih.gov/pmc/banners/logo-jcinvest.png" alt="The Journal of Clinical Investigation logo" usemap="#pmc-banner-imagemap" width="500" height="75"><map name="pmc-banner-imagemap"><area alt="Link to The Journal of Clinical Investigation" title="Link to The Journal of Clinical Investigation" shape="default" href="http://www.jci.org/" target="_blank" rel="noopener noreferrer"></map></section><article lang="en"><section aria-label="Article citation and metadata"><section class="pmc-layout__citation font-secondary font-xs"><div> <div class="display-inline-block"><button type="button" class="cursor-pointer text-no-underline bg-transparent border-0 padding-0 text-left margin-0 text-normal text-primary" aria-controls="journal_context_menu">J Clin Invest</button></div>. 2024 Sep 3;134(17):e180117. doi: <a href="https://doi.org/10.1172/JCI180117" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">10.1172/JCI180117</a> </div> <nav id="journal_context_menu" hidden="hidden"><ul class="menu-list font-family-ui" role="menu"> <li role="presentation"><a href="https://www.ncbi.nlm.nih.gov/pmc/?term=%22J%20Clin%20Invest%22%5Bjour%5D" class="usa-link" role="menuitem">Search in PMC</a></li> <li role="presentation"><a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22J%20Clin%20Invest%22%5Bjour%5D" lang="en" class="usa-link" role="menuitem">Search in PubMed</a></li> <li role="presentation"><a href="https://www.ncbi.nlm.nih.gov/nlmcatalog?term=%22J%20Clin%20Invest%22%5BTitle%20Abbreviation%5D" class="usa-link" role="menuitem">View in NLM Catalog</a></li> <li role="presentation"><a href="?term=%22J%20Clin%20Invest%22%5Bjour%5D" class="usa-link" role="menuitem" data-add-to-search="true">Add to search</a></li> </ul></nav></section><section class="front-matter"><div class="ameta p font-secondary font-xs"> <hgroup><h1>Inflammation primes the murine kidney for recovery by activating AZIN1 adenosine-to-inosine editing</h1></hgroup><div class="cg p"> <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Heruye%20SH%22%5BAuthor%5D" class="usa-link" aria-describedby="id1"><span class="name western">Segewkal Hawaze Heruye</span></a><div hidden="hidden" id="id1"> <h3><span class="name western">Segewkal Hawaze Heruye</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Heruye%20SH%22%5BAuthor%5D" class="usa-link"><span class="name western">Segewkal Hawaze Heruye</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Myslinski%20J%22%5BAuthor%5D" class="usa-link" aria-describedby="id2"><span class="name western">Jered Myslinski</span></a><div hidden="hidden" id="id2"> <h3><span class="name western">Jered Myslinski</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Myslinski%20J%22%5BAuthor%5D" class="usa-link"><span class="name western">Jered Myslinski</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Zeng%20C%22%5BAuthor%5D" class="usa-link" aria-describedby="id3"><span class="name western">Chao Zeng</span></a><div hidden="hidden" id="id3"> <h3><span class="name western">Chao Zeng</span></h3> <div class="p"> <sup>2</sup>Faculty of Science and Engineering, Waseda University, Tokyo, Japan.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Zeng%20C%22%5BAuthor%5D" class="usa-link"><span class="name western">Chao Zeng</span></a> </div> </div> <sup>2</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Zollman%20A%22%5BAuthor%5D" class="usa-link" aria-describedby="id4"><span class="name western">Amy Zollman</span></a><div hidden="hidden" id="id4"> <h3><span class="name western">Amy Zollman</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Zollman%20A%22%5BAuthor%5D" class="usa-link"><span class="name western">Amy Zollman</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Makino%20S%22%5BAuthor%5D" class="usa-link" aria-describedby="id5"><span class="name western">Shinichi Makino</span></a><div hidden="hidden" id="id5"> <h3><span class="name western">Shinichi Makino</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Makino%20S%22%5BAuthor%5D" class="usa-link"><span class="name western">Shinichi Makino</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Nanamatsu%20A%22%5BAuthor%5D" class="usa-link" aria-describedby="id6"><span class="name western">Azuma Nanamatsu</span></a><div hidden="hidden" id="id6"> <h3><span class="name western">Azuma Nanamatsu</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Nanamatsu%20A%22%5BAuthor%5D" class="usa-link"><span class="name western">Azuma Nanamatsu</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Mir%20Q%22%5BAuthor%5D" class="usa-link" aria-describedby="id7"><span class="name western">Quoseena Mir</span></a><div hidden="hidden" id="id7"> <h3><span class="name western">Quoseena Mir</span></h3> <div class="p"> <sup>3</sup>Luddy School of Informatics, Computing, and Engineering, Indiana University, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Mir%20Q%22%5BAuthor%5D" class="usa-link"><span class="name western">Quoseena Mir</span></a> </div> </div> <sup>3</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Janga%20SC%22%5BAuthor%5D" class="usa-link" aria-describedby="id8"><span class="name western">Sarath Chandra Janga</span></a><div hidden="hidden" id="id8"> <h3><span class="name western">Sarath Chandra Janga</span></h3> <div class="p"> <sup>3</sup>Luddy School of Informatics, Computing, and Engineering, Indiana University, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Janga%20SC%22%5BAuthor%5D" class="usa-link"><span class="name western">Sarath Chandra Janga</span></a> </div> </div> <sup>3</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Doud%20EH%22%5BAuthor%5D" class="usa-link" aria-describedby="id9"><span class="name western">Emma H Doud</span></a><div hidden="hidden" id="id9"> <h3><span class="name western">Emma H Doud</span></h3> <div class="p"> <sup>4</sup>Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Doud%20EH%22%5BAuthor%5D" class="usa-link"><span class="name western">Emma H Doud</span></a> </div> </div> <sup>4</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Eadon%20MT%22%5BAuthor%5D" class="usa-link" aria-describedby="id10"><span class="name western">Michael T Eadon</span></a><div hidden="hidden" id="id10"> <h3><span class="name western">Michael T Eadon</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Eadon%20MT%22%5BAuthor%5D" class="usa-link"><span class="name western">Michael T Eadon</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Maier%20B%22%5BAuthor%5D" class="usa-link" aria-describedby="id11"><span class="name western">Bernhard Maier</span></a><div hidden="hidden" id="id11"> <h3><span class="name western">Bernhard Maier</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Maier%20B%22%5BAuthor%5D" class="usa-link"><span class="name western">Bernhard Maier</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Hamada%20M%22%5BAuthor%5D" class="usa-link" aria-describedby="id12"><span class="name western">Michiaki Hamada</span></a><div hidden="hidden" id="id12"> <h3><span class="name western">Michiaki Hamada</span></h3> <div class="p"> <sup>2</sup>Faculty of Science and Engineering, Waseda University, Tokyo, Japan.</div> <div class="p"> <sup>5</sup>AIST–Waseda University Computational Bio Big-Data Open Innovation Laboratory, National Institute of Advanced Industrial Science and Technology, Tokyo, Japan.</div> <div class="p"> <sup>6</sup>Graduate School of Medicine, Nippon Medical School, Tokyo, Japan.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Hamada%20M%22%5BAuthor%5D" class="usa-link"><span class="name western">Michiaki Hamada</span></a> </div> </div> <sup>2,</sup><sup>5,</sup><sup>6</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Tran%20TM%22%5BAuthor%5D" class="usa-link" aria-describedby="id13"><span class="name western">Tuan M Tran</span></a><div hidden="hidden" id="id13"> <h3><span class="name western">Tuan M Tran</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p"> <sup>7</sup>Richard L. Roudebush Veterans Affairs Medical Center, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Tran%20TM%22%5BAuthor%5D" class="usa-link"><span class="name western">Tuan M Tran</span></a> </div> </div> <sup>1,</sup><sup>7</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Dagher%20PC%22%5BAuthor%5D" class="usa-link" aria-describedby="id14"><span class="name western">Pierre C Dagher</span></a><div hidden="hidden" id="id14"> <h3><span class="name western">Pierre C Dagher</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Dagher%20PC%22%5BAuthor%5D" class="usa-link"><span class="name western">Pierre C Dagher</span></a> </div> </div> <sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Hato%20T%22%5BAuthor%5D" class="usa-link" aria-describedby="id15"><span class="name western">Takashi Hato</span></a><div hidden="hidden" id="id15"> <h3><span class="name western">Takashi Hato</span></h3> <div class="p"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p"> <sup>7</sup>Richard L. Roudebush Veterans Affairs Medical Center, Indianapolis, Indiana, USA.</div> <div class="p"> <sup>8</sup>Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Hato%20T%22%5BAuthor%5D" class="usa-link"><span class="name western">Takashi Hato</span></a> </div> </div> <sup>1,</sup><sup>7,</sup><sup>8,</sup><sup>✉</sup> </div> <ul class="d-buttons inline-list"> <li><button class="d-button" aria-controls="aip_a" aria-expanded="false">Author information</button></li> <li><button class="d-button" aria-controls="anp_a" aria-expanded="false">Article notes</button></li> <li><button class="d-button" aria-controls="clp_a" aria-expanded="false">Copyright and License information</button></li> </ul> <div class="d-panels font-secondary-light"> <div id="aip_a" class="d-panel p" style="display: none"> <div class="p" id="A1"> <sup>1</sup>Department of Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div id="A2"> <sup>2</sup>Faculty of Science and Engineering, Waseda University, Tokyo, Japan.</div> <div id="A3"> <sup>3</sup>Luddy School of Informatics, Computing, and Engineering, Indiana University, Indianapolis, Indiana, USA.</div> <div id="A4"> <sup>4</sup>Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div id="A5"> <sup>5</sup>AIST–Waseda University Computational Bio Big-Data Open Innovation Laboratory, National Institute of Advanced Industrial Science and Technology, Tokyo, Japan.</div> <div id="A6"> <sup>6</sup>Graduate School of Medicine, Nippon Medical School, Tokyo, Japan.</div> <div id="A7"> <sup>7</sup>Richard L. Roudebush Veterans Affairs Medical Center, Indianapolis, Indiana, USA.</div> <div id="A8"> <sup>8</sup>Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, Indiana, USA.</div> <div class="author-notes p"> <div class="fn" id="corresp1"> <sup>✉</sup><p class="display-inline">Address correspondence to: Takashi Hato, Department of Medicine, Indiana University School of Medicine, 950 W. Walnut Street R2-202A, Indianapolis, Indiana 46202, USA. Phone: 317.278.4286; Email: <span>thato@iu.edu</span>.</p> </div> <div class="fn" id="_fncrsp93pmc__"> <sup>✉</sup><p class="display-inline">Corresponding author.</p> </div> </div> </div> <div id="anp_a" class="d-panel p" style="display: none"><div class="notes p"><section id="historyarticle-meta1" class="history"><p>Received 2024 Feb 7; Accepted 2024 Jun 25; Collection date 2024 Sep 3.</p></section></div></div> <div id="clp_a" class="d-panel p" style="display: none"> <div>© 2024 Heruye et al.</div> <p>This work is licensed under the Creative Commons Attribution 4.0 International License. To view a copy of this license, visit <a href="https://creativecommons.org/licenses/by/4.0/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">http://creativecommons.org/licenses/by/4.0/</a>.</p> <div class="p"><a href="/about/copyright/" class="usa-link">PMC Copyright notice</a></div> </div> </div> <div>PMCID: PMC11364396 PMID: <a href="https://pubmed.ncbi.nlm.nih.gov/38954486/" class="usa-link">38954486</a> </div> <div class="ra xbox p" role="complementary" aria-label="Related or updated information about this article"><div> <strong>Previous version available:</strong> This article is based on a previously available preprint posted on bioRxiv on November 9, 2023: "<a href="/articles/PMC10659426/" class="usa-link">Inflammation primes the kidney for recovery by activating AZIN1 A-to-I editing</a>".</div></div> </div></section></section><section aria-label="Article content"><section class="body main-article-body"><section class="abstract" id="abstract1"><h2>Abstract</h2> <p>The progression of kidney disease varies among individuals, but a general methodology to quantify disease timelines is lacking. Particularly challenging is the task of determining the potential for recovery from acute kidney injury following various insults. Here, we report that quantitation of post-transcriptional adenosine-to-inosine (A-to-I) RNA editing offers a distinct genome-wide signature, enabling the delineation of disease trajectories in the kidney. A well-defined murine model of endotoxemia permitted the identification of the origin and extent of A-to-I editing, along with temporally discrete signatures of double-stranded RNA stress and adenosine deaminase isoform switching. We found that A-to-I editing of antizyme inhibitor 1 (AZIN1), a positive regulator of polyamine biosynthesis, serves as a particularly useful temporal landmark during endotoxemia. Our data indicate that AZIN1 A-to-I editing, triggered by preceding inflammation, primes the kidney and activates endogenous recovery mechanisms. By comparing genetically modified human cell lines and mice locked in either A-to-I–edited or uneditable states, we uncovered that AZIN1 A-to-I editing not only enhances polyamine biosynthesis but also engages glycolysis and nicotinamide biosynthesis to drive the recovery phenotype. Our findings implicate that quantifying AZIN1 A-to-I editing could potentially identify individuals who have transitioned to an endogenous recovery phase. This phase would reflect their past inflammation and indicate their potential for future recovery.</p> <section id="kwd-group1" class="kwd-group"><p><strong>Keywords:</strong> Nephrology</p></section><section id="kwd-group2" class="kwd-group"><p><strong>Keywords:</strong> Bioinformatics, Cell stress, Polyamines</p></section></section><section class="abstract" id="abstract2"><hr class="headless"> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=11364396_jci-134-180117-g122.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9b9/11364396/335a96a01498/jci-134-180117-g122.jpg" loading="lazy" height="269" width="740" alt="graphic file with name jci-134-180117-g122.jpg"></a></p></section><section class="abstract" id="abstract3"><hr class="headless"> <p>Adenosine-to-inosine editing of antizyme inhibitor 1 (AZIN1) promotes recovery from acute kidney injury by enhancing metabolic flexibility.</p></section><section id="sec1"><h2 class="pmc_sec_title">Introduction</h2> <p>The polyamines — namely putrescine, spermidine, and spermine — are involved in a variety of fundamental biological processes, such as transcription, translation, cell growth, differentiation, DNA repair, and aging (<a href="#B1" class="usa-link" aria-describedby="B1">1</a>–<a href="#B3" class="usa-link" aria-describedby="B3">3</a>). Polyamines are fully protonated at physiological pH, and a substantial fraction of polyamines are associated with ribosomes (~15%) and RNA (~80%) (<a href="#B4" class="usa-link" aria-describedby="B4">4</a>). These nucleotide-bound polyamines facilitate global protein synthesis through their direct interaction with the translation machinery (<a href="#B5" class="usa-link" aria-describedby="B5">5</a>, <a href="#B6" class="usa-link" aria-describedby="B6">6</a>). The critical role of polyamines in protein synthesis is further supported by the fact that cancer cells frequently exploit the polyamine pathway to enhance their growth (<a href="#B7" class="usa-link" aria-describedby="B7">7</a>). Conversely, polyamines are also essential for the activation of immune cells (<a href="#B8" class="usa-link" aria-describedby="B8">8</a>, <a href="#B9" class="usa-link" aria-describedby="B9">9</a>), blurring the boundaries between therapeutic advantages and disadvantages in a variety of settings.</p> <p>The regulation of polyamine bioavailability is determined by a multitude of mechanisms, including gut absorption, de novo synthesis, and the salvage pathways. In addition, polyamines significantly influence their own pathway through various post-transcriptional mechanisms (<a href="#B1" class="usa-link" aria-describedby="B1">1</a>). These mechanisms include ribosomal frameshifting (ornithine decarboxylase antizyme 1), ribosomal occupancy of upstream open reading frames (spermine synthase and spermidine/spermine <em>N</em><sup>1</sup>-acetyltransferase 1), stop codon readthrough (adenosylmethionine decarboxylase 1), and posttranslational modification of eukaryotic translation initiation factor 5A (hypusination), as well as post-transcriptional mRNA editing of antizyme inhibitor 1 (<em>AZIN1</em>) from adenosine to inosine (A-to-I). This A-to-I editing results in a non-synonymous amino acid mutation, as inosines are translated as guanosines (<a href="#B10" class="usa-link" aria-describedby="B10">10</a>). The presence of these intricate regulatory mechanisms within this pathway underscores the crucial importance of controlling polyamine levels in response to various environmental stresses.</p> <p>The kidney is an organ with exceptionally high metabolic demands (<a href="#B11" class="usa-link" aria-describedby="B11">11</a>), making it susceptible to various stressors such as diabetes and sepsis, which can disrupt polyamine homeostasis. Indeed, a recent study has highlighted that altered polyamine metabolism is a unifying feature across more than 10 different kidney injury models in mice, as well as in the post–kidney transplantation context in humans (<a href="#B12" class="usa-link" aria-describedby="B12">12</a>, <a href="#B13" class="usa-link" aria-describedby="B13">13</a>). Although the importance of polyamines in kidney biology is indisputable, their exact role under stress conditions remains unclear. The supplementation of polyamines and the modulation of the polyamine pathway have yielded diverse outcomes in multiple models of kidney injury, ranging from providing protection to exacerbating tissue damage (<a href="#B14" class="usa-link" aria-describedby="B14">14</a>–<a href="#B21" class="usa-link" aria-describedby="B21">21</a>). These varying results underscore the need for a more systematic examination of the roles of polyamines across specific disease timelines and trajectories.</p> <p>Defining timelines and stages of any kidney disease is highly challenging. Because of variations in disease progression among patients, a uniform physical timescale cannot be universally applied. We reasoned that the precisely controlled, stepwise reactions embedded in the polyamine pathway could serve as the basis for constructing a molecular clock. This path of investigation has led to our present findings, which demonstrate that <em>AZIN1</em> A-to-I editing is strikingly prevalent and occurs at specific points along disease timelines in both mouse models and humans. As such, <em>AZIN1</em> A-to-I editing can serve as a molecular clock to stage various forms of kidney disease.</p> <p>AZIN1 is a key regulatory enzyme that controls the initial entry point into the polyamine pathway by augmenting the activity of ornithine decarboxylase 1 (<a href="#B22" class="usa-link" aria-describedby="B22">22</a>). The A-to-I editing of <em>AZIN1</em> confers a gain-of-function phenotype, thereby further increasing polyamine biosynthesis. Such gain-of-function <em>AZIN1</em> A-to-I editing has been described in several forms of cancer, contributing to aggressive tumor behavior (<a href="#B23" class="usa-link" aria-describedby="B23">23</a>–<a href="#B26" class="usa-link" aria-describedby="B26">26</a>). The role of <em>AZIN1</em> editing is also implicated in hematopoietic stem cell differentiation (<a href="#B27" class="usa-link" aria-describedby="B27">27</a>). More recently, transient <em>AZIN1</em> editing has been reported in cases of COVID-19 infection (<a href="#B28" class="usa-link" aria-describedby="B28">28</a>). However, the clinical implications of <em>AZIN1</em> editing in non-cancerous kidney diseases remain unclear.</p> <p>By combining a series of sequencing and genetic approaches, we found that <em>AZIN1</em> edited state confers an advantage over the unedited state by upregulating the polyamine pathway and co-opting glycolysis and nicotinamide biosynthesis, culminating in a metabolically robust phenotype. Using an extensively characterized murine model of endotoxemia, we also provide a genome-wide, time-anchored map of A-to-I editing, serving as a novel framework for the development of molecular staging in kidney disease.</p></section><section id="sec2"><h2 class="pmc_sec_title">Results</h2> <section id="sec3"><h3 class="pmc_sec_title">AZIN1 A-to-I editing is widespread in non-cancerous conditions.</h3> <p>Using a model of endotoxin preconditioning, we have previously identified that increased polyamine levels are a key feature of the robust protective phenotype against severe sepsis (<a href="#B14" class="usa-link" aria-describedby="B14">14</a>). Increases in polyamine levels are also reported by others during the recovery phase of ischemia/reperfusion injury (<a href="#B29" class="usa-link" aria-describedby="B29">29</a>). Conversely, inhibiting a branch of the polyamine pathway can also lead to tissue protection against multiple models of kidney diseases (e.g., inhibition of ornithine decarboxylase or eukaryotic translation initiation factor 5A hypusination) (<a href="#B15" class="usa-link" aria-describedby="B15">15</a>, <a href="#B16" class="usa-link" aria-describedby="B16">16</a>, <a href="#B30" class="usa-link" aria-describedby="B30">30</a>–<a href="#B32" class="usa-link" aria-describedby="B32">32</a>). These contrasting findings suggest that the role of polyamines is context dependent, such as the severity of tissue injury or timing of intervention. To understand the role of polyamines broadly in various stress conditions, here we first interrogated a large clinical data set in which stranded RNA sequencing (RNA-Seq) was performed on whole blood collected from children before and after they contracted malaria (<a href="#B33" class="usa-link" aria-describedby="B33">33</a>). Through prospective surveillance, the patients were categorized into (a) early fever (infection with concurrent fever), (b) delayed fever (infection with a delay of 2–14 days until development of fever), and (c) immune (infection without progression to fever). We found that <em>AZIN1</em> A-to-I editing at chromosome 8:102829408 (hg38), a known A-to-I editing site (<a href="#B34" class="usa-link" aria-describedby="B34">34</a>), was highly prevalent in this cohort, albeit at different time points among the 3 groups (<a href="#F1" class="usa-link">Figure 1, A and B</a>, and <a href="#sd" class="usa-link">Supplemental Figure 1</a>, A–C; supplemental material available online with this article; <a href="https://doi.org/10.1172/JCI180117DS1" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://doi.org/10.1172/JCI180117DS1</a>). Notably, children in the early fever group had low levels of <em>AZIN1</em> A-to-I editing at baseline but showed an increase in editing after malaria infection. In contrast, children in the delayed and immune groups exhibited surprisingly high levels of A-to-I editing at baseline that were sustained over time. This raises the possibility that <em>AZIN1</em> A-to-I editing early in the course of malaria infection could have a beneficial role in controlling disease progression.</p> <figure class="fig xbox font-sm" id="F1"><h4 class="obj_head">Figure 1. AZIN1 A-to-I editing status in non-cancerous diseases in humans.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=11364396_jci-134-180117-g111.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9b9/11364396/3780465c9895/jci-134-180117-g111.jpg" loading="lazy" height="1106" width="778" alt="Figure 1"></a></p> <div class="p text-right font-secondary"><a href="figure/F1/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Distribution of <em>AZIN1</em> A-to-I editing rates (percent of edited reads over total reads) in prospectively collected blood from male children aged 6–11 years, before and after <em>Plasmodium falciparum</em> malaria infection. Individuals were classified as early fever (symptomatic and first-time infection), delayed fever (asymptomatic and first-time infection, subsequently developing malarial symptoms), and immune (infected but never developing symptoms). (<strong>B</strong>) Representative read coverage near the <em>AZIN1</em> editing site for one sample. Note that inosine is sequenced as guanosine. The human <em>AZIN1</em> gene is encoded on the minus strand, hence the T-to-C mutation, not A-to-G, in the coverage track. Light-blue-colored reads (F2R1 paired-end orientation) indicate the proper directionality of reads mapped to the minus strand. (<strong>C</strong>) Distribution of <em>AZIN1</em> A-to-I editing rates in kidney biopsies with a pathology diagnosis of diabetic kidney disease (DKD), acute kidney injury (AKI), or reference nephrectomy samples. Each column represents one sample. (<strong>D</strong>) Stacked bar chart summarizing total numbers of differentially expressed A-to-I editing sites genome-wide under the indicated conditions. For each comparison, editing sites are divided on the <em>x</em> axis based on the direction of fold change. For example, in the DKD versus reference comparison, approximately 20,000 sites are more edited in DKD, whereas approximately 10,000 sites are more edited in reference nephrectomy samples. (<strong>E</strong>) Heatmap displaying the top 500 differentially expressed A-to-I editing sites between diabetic nephropathy and reference nephrectomy samples. The differentially expressed sites are categorized based on repeat classes. (<strong>F</strong>) Comparison between AKI biopsies and reference nephrectomy samples.</p></figcaption></figure><p>Next, we interrogated stranded RNA-Seq data of human kidney biopsies obtained from our biobank and the Kidney Precision Medicine Project (<a href="#B35" class="usa-link" aria-describedby="B35">35</a>, <a href="#B36" class="usa-link" aria-describedby="B36">36</a>). We found that <em>AZIN1</em> editing is common in non-cancerous kidney tissues, including those with diabetic kidney disease, acute kidney injury (AKI), and even reference nephrectomy (<a href="#F1" class="usa-link">Figure 1C</a>). However, no difference was found in the extent of <em>AZIN1</em> editing among the 3 groups. This may be due to the fact that these biopsies were obtained at various stages in the diabetes and AKI timelines (<a href="#sd" class="usa-link">Supplemental Figure 2</a>, A–G; <a href="https://connect.posit.iu.edu/bulk_kidney_bx/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/bulk_kidney_bx/</a>). Similarly, the reference biopsies are known to sustain variable degrees of ischemic injury, thus exhibiting some AKI phenotype. In addition, some reference nephrectomy samples were derived from tissues adjacent to renal cell carcinoma, which may also influence <em>AZIN1</em> A-to-I editing status. Nevertheless, genome-wide examination did reveal significant differences among the 3 groups in A-to-I editing at tens of thousands of sites (<a href="#F1" class="usa-link">Figure 1D</a>; see Methods). Overall, diabetic kidneys showed more extensive genome-wide A-to-I editing than nephrectomies and AKI samples. Focusing on the top differentially edited sites, reference nephrectomy samples had A-to-I editing predominantly within simple repeat regions, whereas AKI and diabetic samples had A-to-I editing within short interspersed nuclear elements (SINEs, such as Alu elements; <a href="#F1" class="usa-link">Figure 1, E and F</a>). The differential editing in transposable elements such as SINEs may have profound implications for disease unfolding (<a href="#B37" class="usa-link" aria-describedby="B37">37</a>). No significant A-to-I editing was identified in mitochondrial transcripts for all conditions, implicating no breach of mitochondrial RNA into the cytoplasm (<a href="#sd" class="usa-link">Supplemental Figure 2H</a>) (<a href="#B38" class="usa-link" aria-describedby="B38">38</a>).</p></section><section id="sec4"><h3 class="pmc_sec_title">Changes in AZIN1 A-to-I editing and polyamine metabolism across AKI timelines.</h3> <p>To understand the role of <em>AZIN1</em> editing and polyamine metabolism in the kidney, we next interrogated a well-characterized animal model of endotoxemia (<a href="#B39" class="usa-link" aria-describedby="B39">39</a>–<a href="#B41" class="usa-link" aria-describedby="B41">41</a>). In this specific model, the kidney goes through precise stages, starting with classic NF-κB–mediated acute inflammation, followed by interferon responses and the integrated stress response, and culminating in metabolic and translation shutdown (<a href="#F2" class="usa-link">Figure 2, A–C</a>). Single-cell RNA-Seq revealed that <em>Azin1</em> is expressed in all cell types in the kidney (<a href="#sd" class="usa-link">Supplemental Figure 3A</a>). Furthermore, Ribo-Seq analysis (ribosome profiling) showed that <em>Azin1</em> translation remained nearly constant throughout the course of endotoxemia (<a href="#F2" class="usa-link">Figure 2D</a>). However, we found that <em>Azin1</em> A-to-I editing status varied significantly over the same time period (<a href="#F2" class="usa-link">Figure 2E</a> and <a href="#sd" class="usa-link">Supplemental Figure 3B</a>). While the extent of A-to-I editing was minimal at baseline and during the early phases of endotoxemia, it significantly increased during the later stages of sepsis in this model. In fact, we observed a consistent and robust increase in <em>Azin1</em> A-to-I editing at around 16 hours and later time points after endotoxin exposure. We have previously shown that this 16-hour time point corresponds to a critical transition phase between translation shutdown and subsequent tissue recovery (<a href="#B39" class="usa-link" aria-describedby="B39">39</a>, <a href="#B40" class="usa-link" aria-describedby="B40">40</a>). Thus, editing of <em>Azin1</em> at this precise time point may serve as a clock to stage endotoxemia. Furthermore, since <em>AZIN1</em> A-to-I editing confers a gain of function (<a href="#B23" class="usa-link" aria-describedby="B23">23</a>–<a href="#B26" class="usa-link" aria-describedby="B26">26</a>), it may also signal a change in polyamine metabolism that aids tissue healing.</p> <figure class="fig xbox font-sm" id="F2"><h4 class="obj_head">Figure 2. Azin1 A-to-I editing status in murine models of AKI.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=11364396_jci-134-180117-g112.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9b9/11364396/aed9f157985a/jci-134-180117-g112.jpg" loading="lazy" height="911" width="768" alt="Figure 2"></a></p> <div class="p text-right font-secondary"><a href="figure/F2/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Bulk RNA-Seq analysis on a murine model of endotoxemia (LPS). Gene set coregulation analysis showing sequential upregulation of pathways involved in NF-κB–mediated acute inflammation and in antiviral/interferon responses, followed by the integrated stress response, as indicated by enrichment of the Molecular Signatures Database Hallmark Gene Sets. Each dot corresponds to each animal. The colored lines in the background depict scaled expression of individual genes. ***Pairwise <em>t</em> test adjusted <em>P</em> < 0.05 compared with the preceding time point. (<strong>B</strong>) Principal component analysis showing overall gene expression changes over the course of endotoxemia in the kidney. (<strong>C</strong>) Serum creatinine levels at indicated time points after administration of LPS (4 mg/kg in C57BL/6J male mice). (<strong>D</strong>) Combined Ribo-Seq and RNA-Seq read coverage graphs for <em>Azin1</em> after LPS challenge in the kidney. Reads are mapped to Ensembl transcript <em>Azin1</em>-201. Gray-colored reads represent RNA-Seq, whereas red/green/blue-colored reads represent codon frames for ribosome-protected fragments in Ribo-Seq. The top right panel confirms the translation of A-to-I–edited <em>Azin1</em> (reanalysis of GEO <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE120877" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE120877</a>). (<strong>E</strong>) Percentage of Azin1 A-to-I editing under indicated conditions (based on stranded total RNA-Seq data). (<strong>F</strong>–<strong>H</strong>) Measurements of kidney tissue putrescine and spermidine levels by HPLC under indicated conditions. Representative HPLC chromatograms are also shown. For clarity, the traces are slightly shifted from each other on the <em>x</em> axis elution time. (<strong>I</strong> and <strong>J</strong>) Quantitation of RNA-Seq read counts (in counts per million) at the indicated time points. (<strong>K</strong>) Sanger sequencing showing timeline-specific <em>Azin1</em> A-to-I editing observed in wild-type mouse kidneys after ischemia/reperfusion injury (IRI; arrowheads). (<strong>L</strong>) Measurements of kidney tissue spermidine levels by HPLC after IRI. *<em>P</em> < 0.05 vs. 0-hour control samples, 1-way ANOVA followed by Dunnett’s test for multiple treatment comparisons. 0** indicates kidney tissues harvested 20 minutes after ischemia without reperfusion.</p></figcaption></figure><p>Indeed, quantitation of polyamines in kidney tissues revealed a notable increase in spermidine levels during the recovery phase of endotoxemia (<a href="#F2" class="usa-link">Figure 2, F–H</a>). This increase was observed despite a significant decrease in the expression of ornithine decarboxylase 1, the rate-limiting step of polyamine biosynthesis, and an increase in spermidine/spermine <em>N</em><sup>1</sup>-acetyltransferase 1, the main polyamine catabolic enzyme (<a href="#F2" class="usa-link">Figure 2, I and J</a>, and <a href="#sd" class="usa-link">Supplemental Figure 3C</a>). These findings suggest that the gain-of-function <em>Azin1</em> A-to-I editing plays a crucial role in limiting polyamine depletion at the peak of injury and expediting the restoration of tissue polyamine levels during recovery. Single-cell RNA-Seq data implicate that the source of polyamines could be cell type specific, with arginine serving as the substrate for myeloid cells, S3 proximal tubule, and the thick ascending loop of Henle, while proline serves as the substrate for other tubular segments (<a href="#sd" class="usa-link">Supplemental Figure 3</a>, D and E).</p> <p>Finally, using a murine model of renal ischemia/reperfusion injury, we further extended our analysis of <em>Azin1</em> A-to-I editing and polyamine levels. We observed overlapping editing kinetics and polyamine trajectories over the course of ischemic kidney injury compared with endotoxemia. However, the exact timelines differed between the 2 models, and the peak of <em>Azin1</em> A-to-I editing and polyamine rebound were delayed after ischemia/reperfusion injury (<a href="#F2" class="usa-link">Figure 2, K and L</a>, and <a href="#sd" class="usa-link">Supplemental Figure 4</a>, A–F).</p></section><section id="sec5"><h3 class="pmc_sec_title">AZIN1 A-to-I–uneditable cells are compromised upon nutrient deprivation and mitochondrial inhibition.</h3> <p>To elucidate the functional significance of <em>AZIN1</em> editing, we next designed 2 homozygous clonal cell lines using the CRISPR knockin strategy (<a href="#F3" class="usa-link">Figure 3A</a> and <a href="#sd" class="usa-link">Supplemental Figure 5A</a>). The first cell line contains a constitutively edited <em>AZIN1</em>, resulting in an A-to-I–locked state (AGC serine to GGC glycine). The second cell line is an A-to-I–uneditable variant in which the editing site is disrupted while preserving the codon composition (AGC serine to TCC serine). A-to-I–locked or uneditable state did not lead to changes in the abundance or stability of the AZIN1 protein (<a href="#F3" class="usa-link">Figure 3, B and C</a>). We found that A-to-I–locked cells exhibited accelerated cell growth compared with wild-type and A-to-I–uneditable cells, all of which share an otherwise identical genetic background (HEK293T; <a href="#F3" class="usa-link">Figure 3, D and E</a>, and <a href="#sd" class="usa-link">Supplemental Figure 5</a>, B and C). The level of A-to-I editing in the wild-type cells was minimal (~0%). However, the growth curve of the wild-type cells fell between those of the A-to-I–locked and uneditable cells. This suggests that transient and low-grade <em>AZIN1</em> editing is operative under normal conditions, contributing to healthy cellular growth. In support of the rapid growth rate observed in the A-to-I–edited state, multiple genes involved in cell growth and differentiation were upregulated in the A-to-I–locked cell line (e.g., <em>BMP2</em>/bone morphogenetic protein 2, <em>IGFBPL1</em>/insulin-like growth factor–binding protein like 1, <em>PGF</em>/placental growth factor; <a href="#F3" class="usa-link">Figure 3F</a> and <a href="#sd" class="usa-link">Supplemental Figure 5E</a>; <a href="https://connect.posit.iu.edu/azin1/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/azin1/</a>).</p> <figure class="fig xbox font-sm" id="F3"><h4 class="obj_head">Figure 3. Azin1 A-to-I–uneditable state hinders cell growth and limits glycolytic capacity.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=11364396_jci-134-180117-g113.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9b9/11364396/3c46148538ee/jci-134-180117-g113.jpg" loading="lazy" height="833" width="768" alt="Figure 3"></a></p> <div class="p text-right font-secondary"><a href="figure/F3/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Sanger sequencing chromatograms for wild-type (HEK293T; top), <em>AZIN1</em> A-to-I–locked (middle), and <em>AZIN1</em> A-to-I–uneditable homozygous cell lines (bottom). Homology-directed repair donor oligonucleotides used for CRISPR knockin are shown in <a href="#sd" class="usa-link">Supplemental Figure 5A</a>. (<strong>B</strong>) Western blotting for AZIN1 under indicated conditions (~70% confluence). (<strong>C</strong>) Determination of AZIN1 protein turnover under indicated conditions. Nascent protein synthesis was inhibited with 250 μg/mL cycloheximide. Arrow points to AZIN1. Bands below AZIN1 result from inhibition of proteasomal degradation with MG132. <em>n</em> = 2 biological replicates. (<strong>D</strong>) Real-time monitoring of cell growth for AZIN1 A-to-I–locked, uneditable, and wild-type cells. <em>n</em> = 3 independent experiments with <em>n</em> = 6 technical replicates for each experiment. *<em>P</em> < 0.05 at all time points for indicated conditions, except the stationary phase between AZIN1 A-to-I–locked and wild-type cells. Representative images are shown in <a href="#sd" class="usa-link">Supplemental Figure 5C</a>. (<strong>E</strong>) Polyribosome profiling of AZIN1 A-to-I–locked and uneditable cell lines. <em>n</em> = 3 independent experiments. Mean polysome/monosome ratios for A-to-I–locked and uneditable genotypes are 4.1 and 3.6, respectively. (<strong>F</strong>) Heatmap of the top 20 differentially expressed genes between AZIN1 A-to-I–locked and uneditable cell lines as determined by RNA-Seq (<a href="https://connect.posit.iu.edu/azin1/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/azin1/</a>). (<strong>G</strong>) Cell growth under indicated conditions. Representative images are shown in <a href="#sd" class="usa-link">Supplemental Figure 5D</a>. *<em>P</em> < 0.05, **<em>P</em> < 0.05 after day 1 and day 2.5 for indicated conditions, respectively. (<strong>H</strong>) Extracellular acidification rates under indicated conditions (Seahorse glycolysis stress test). <em>n</em> = 3 independent experiments with <em>n</em> = 3 technical replicates for each experiment. *<em>P</em> < 0.05 vs. AZIN1-uneditable cells at indicated time points. (<strong>I</strong>) Identification of AZIN1-interacting molecules by mass spectrometry. Top: Coomassie staining for input, flow-through, and immunoprecipitated unfractionated lysates from IgG control and transfection of FLAG-tagged AZIN1 or AZIN1 without FLAG plasmids. Middle: Western blotting for AZIN1. Cells overexpressing FLAG-tagged A-to-I–locked AZIN1 or uneditable plasmids were fractionated into cytoplasmic and nuclear compartments and immunoprecipitated using anti-FLAG antibody (cytoplasmic fraction is shown). See also <a href="#sd" class="usa-link">Supplemental Figure 5H</a>. Summary of coprecipitated proteins with AZIN1 is presented in the bottom table. <em>n</em> = 3 independent experiments. *Plasmid construct not used in this article.</p></figcaption></figure><p>As expected, the depletion of arginine exhibited a profound growth-inhibitory effect on cell proliferation, which was more notable in the uneditable cell line (<a href="#F3" class="usa-link">Figure 3G</a> and <a href="#sd" class="usa-link">Supplemental Figure 5D</a>). Conversely, the supplementation of urea, known to enhance polyamine biosynthesis (<a href="#B42" class="usa-link" aria-describedby="B42">42</a>, <a href="#B43" class="usa-link" aria-describedby="B43">43</a>), rescued cell proliferation in the uneditable cell line. This effect was not observed in the A-to-I–locked cell line, suggesting that polyamine synthesis is maximized in the A-to-I–locked state. In addition, the impact of glutamine depletion was less pronounced in the A-to-I–locked cell line (<a href="#F3" class="usa-link">Figure 3G</a>). Surprisingly, glycolysis stress test revealed marked differences in extracellular acidification rates between A-to-I–locked and uneditable cell lines. Specifically, the uneditable cell line lacked a compensatory glycolytic response upon ATP synthase inhibition (<a href="#F3" class="usa-link">Figure 3H</a> and <a href="#sd" class="usa-link">Supplemental Figure 5</a>, F and G). While the exact mechanism remains uncertain, these findings offer a new perspective on the involvement of <em>AZIN1</em> A-to-I editing in metabolic flexibility. This is especially pertinent in situations such as cancer and ischemia/reperfusion injury. In this regard, non-polyamine-related functions of A-to-I–locked AZIN1 cannot be excluded. For example, immunoprecipitation of AZIN1 identified that A-to-I–edited AZIN1 uniquely binds to the thiol-specific peroxidase peroxiredoxin 2 (<a href="#F3" class="usa-link">Figure 3I</a> and <a href="#sd" class="usa-link">Supplemental Figure 5H</a>).</p></section><section id="sec6"><h3 class="pmc_sec_title">Azin1 A-to-I editing confers resilience through the orchestration of multiple protective pathways.</h3> <p>To gain further insight into the in vivo implications of <em>Azin1</em> A-to-I editing, we next created 2 CRISPR knockin mouse models, representing both A-to-I–locked and uneditable states (<a href="#F4" class="usa-link">Figure 4A</a> and <a href="#sd" class="usa-link">Supplemental Figure 6A</a>). Mutant mice were born at the expected Mendelian ratios with no gross abnormalities (<a href="#sd" class="usa-link">Supplemental Figure 6</a>, B–F). Because Azin1 edited status had a significant effect on glycolysis, we examined its role in an ischemia/reperfusion model of kidney injury. We found that Azin1-locked mice had less severe kidney damage after ischemia/reperfusion injury as compared with the uneditable mice (<a href="#F4" class="usa-link">Figure 4, B and C</a>). In addition to the reduction in serum creatinine and tissue <em>Havcr1</em>/KIM1 levels, the less pronounced tissue damage in A-to-I–locked mice was reflected in better-preserved global translation and a faster resolution of tubular necrosis (<a href="#F4" class="usa-link">Figure 4, D and E</a>, and <a href="#sd" class="usa-link">Supplemental Figure 7A</a>). Note that no discernible difference was observed in the hypusination of eukaryotic translation initiation factor 5A between the 2 knockin models (<a href="#F4" class="usa-link">Figure 4F</a>). This suggests that the beneficial effects of <em>Azin1</em> A-to-I editing on translation are mediated through hypusination-independent polyamine pathways.</p> <figure class="fig xbox font-sm" id="F4"><h4 class="obj_head">Figure 4. Azin1 A-to-I–locked mice exhibit faster tissue recovery following ischemic injury compared with uneditable mice.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=11364396_jci-134-180117-g114.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9b9/11364396/8d14f99a9b22/jci-134-180117-g114.jpg" loading="lazy" height="552" width="782" alt="Figure 4"></a></p> <div class="p text-right font-secondary"><a href="figure/F4/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Sanger sequencing chromatograms for wild-type (top), Azin1 A-to-I–uneditable (middle), and Azin1 A-to-I–locked homozygous mice (bottom). The CRISPR knockin strategy is depicted in <a href="#sd" class="usa-link">Supplemental Figure 6A</a>. (<strong>B</strong>) Serum creatinine levels 24 and 72 hours after a 20-minute bilateral IRI. (<strong>C</strong>) Kidney tissue Havcr1/kidney injury marker-1 (KIM1) levels as determined by RNA-Seq (counts per million). (<strong>D</strong>) Polyribosome profiling of kidneys from Azin1 A-to-I–locked and uneditable mice 24 hours after IRI. Two representative biological replicates are shown for each genotype. Mean polysome/monosome ratios for A-to-I–locked and uneditable genotypes are 3.3 and 2.8, respectively. (<strong>E</strong>) Hematoxylin and eosin staining 72 hours after IRI. Original magnification, ×40. (<strong>F</strong>) Western blotting for hypusine in the kidney after IRI.</p></figcaption></figure><p>Metabolomics analysis yielded surprisingly few differentially expressed metabolites at baseline in these 2 mouse models (<a href="#F5" class="usa-link">Figure 5A</a>). Specifically, only enterolactone sulfate and chiro-inositol were elevated in the kidneys of A-to-I–locked mice compared with A-to-I–uneditable mice. While the function of enterolactone sulfate remains unclear (weakly estrogenic; ref. <a href="#B44" class="usa-link" aria-describedby="B44">44</a>), chiro-inositol is a well-characterized metabolite known to facilitate the conversion of pyruvate to acetyl-CoA through the dephosphorylation of pyruvate dehydrogenase (<a href="#B45" class="usa-link" aria-describedby="B45">45</a>, <a href="#B46" class="usa-link" aria-describedby="B46">46</a>). The endogenous synthesis of chiro-inositol is catalyzed by insulin-dependent epimerases (<a href="#B47" class="usa-link" aria-describedby="B47">47</a>), and the dephosphorylation of pyruvate dehydrogenase is central to providing metabolic flexibility (<a href="#B48" class="usa-link" aria-describedby="B48">48</a>). Remarkably, RNA-Seq revealed insulin-degrading enzyme (<em>Ide</em>) (<a href="#B49" class="usa-link" aria-describedby="B49">49</a>, <a href="#B50" class="usa-link" aria-describedby="B50">50</a>) as the sole differentially expressed gene in these 2 mouse models under basal conditions (<a href="#F5" class="usa-link">Figure 5B</a> and <a href="#sd" class="usa-link">Supplemental Figure 8</a>, A and B; <a href="https://connect.posit.iu.edu/azin1_mouse_kidney/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/azin1_mouse_kidney/</a>). The expression of insulin-degrading enzyme was significantly downregulated in A-to-I–locked mice, promoting insulin signaling in the A-to-I–locked state. Thus, the heightened chiro-inositol level, facilitated by the downregulation of insulin-degrading enzyme, could explain the resilience of the A-to-I–locked state against mitochondrial insults such as ischemia/reperfusion injury and direct ATP synthase inhibition as shown above (<a href="#F3" class="usa-link">Figure 3H</a>). An inverse correlation was also observed in the human reference kidney biopsies between the degree of <em>AZIN1</em> A-to-I editing and the levels of insulin-degrading enzyme (<a href="#sd" class="usa-link">Supplemental Figure 8C</a>). Insulin-degrading enzyme is also known to degrade amyloid β (<a href="#B50" class="usa-link" aria-describedby="B50">50</a>, <a href="#B51" class="usa-link" aria-describedby="B51">51</a>). No amyloid β deposits were observed in our mouse models (<a href="#sd" class="usa-link">Supplemental Figure 8D</a>).</p> <figure class="fig xbox font-sm" id="F5"><h4 class="obj_head">Figure 5. Azin1 A-to-I–locked state limits kidney injury by upregulating polyamines and other protective pathways.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=11364396_jci-134-180117-g115.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9b9/11364396/9269d0f29c9a/jci-134-180117-g115.jpg" loading="lazy" height="913" width="777" alt="Figure 5"></a></p> <div class="p text-right font-secondary"><a href="figure/F5/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Volcano plot showing the top 2 differentially expressed metabolites. The <em>x</em> axis depicts the log<sub>2</sub> fold change of A-to-I locked/uneditable ratio, and the <em>y</em> axis depicts –log<sub>10</sub> adjusted <em>P</em> values. Global untargeted metabolomics, <em>n</em> = 5 for each condition. (<strong>B</strong>) RNA-Seq gene expression analysis (smear plot) comparing homozygous A-to-I–locked and uneditable mouse kidneys under basal conditions. Only Ide (insulin-degrading enzyme) met the criteria of FDR < 0.05 (<a href="https://connect.posit.iu.edu/azin1_mouse_kidney/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/azin1_mouse_kidney/</a>). (<strong>C</strong>) Heatmap displaying the top differentially expressed metabolites between Azin1-locked and uneditable mice after IRI (adjusted <em>P</em> < 0.05 for all listed metabolites). (<strong>D</strong>) Pathway enrichment analysis of differentially expressed metabolites between Azin1 A-to-I–locked and uneditable mouse kidneys after IRI. (<strong>E</strong>) Metabolite ratios (log<sub>2</sub> fold change of A-to-I locked/uneditable) mapped to the polyamine pathway and pseudocolored according to the indicated scale. Metabolites with blank circles were not resolved by the metabolomics. (<strong>F</strong>) Metabolite ratios mapped to the NAD<sup>+</sup> biosynthesis pathway. (<strong>G</strong>) RNA-Seq read counts for glycerol-3-phosphate dehydrogenase 1, cytoplasmic (Gpd1), glycerol-3-phosphate dehydrogenase 2, mitochondrial (Gpd2), and nicotinamide phosphoribosyltransferase (Nampt), 48 hours after IRI.</p></figcaption></figure><p>In contrast to basal conditions, we identified multiple differentially expressed metabolites following ischemia/reperfusion injury in these 2 mouse strains (24 hours after ischemia; <a href="#F5" class="usa-link">Figure 5, C and D</a>, and <a href="#sd" class="usa-link">Supplemental Figure 8E</a>). First, A-to-I–locked state resulted in global upregulation of metabolites involved in the polyamine pathway, including <em>S</em>-adenosylmethionine, which serves as a donor of amine groups essential for the synthesis of higher-order polyamines (spermidine and spermine; <a href="#F5" class="usa-link">Figure 5E</a>). Using HPLC and tissue staining, we confirmed that higher levels of polyamines were sustained in the A-to-I–locked state during the recovery phase of ischemic injury (48–72 hours after ischemia; <a href="#sd" class="usa-link">Supplemental Figure 9</a>, A and B). Interestingly, A-to-I–locked mice showed increased NAD<sup>+</sup> levels following ischemia/reperfusion injury (<a href="#F5" class="usa-link">Figure 5F</a>). The beneficial effects of NAD<sup>+</sup> have been extensively characterized across various animal models and human studies (<a href="#B52" class="usa-link" aria-describedby="B52">52</a>). We also found that A-to-I–locked mice had higher levels of AICAR (5-aminomidazole-4-carboxamide ribonucleotide), which originates from the pentose phosphate shunt/purine metabolism (<a href="#F5" class="usa-link">Figure 5D</a> and <a href="#sd" class="usa-link">Supplemental Figure 8E</a>). The elevated AICAR levels under ischemic stress could result from the augmented glycolytic capacity conferred by the A-to-I–locked condition. AICAR operates as a potent endogenous AMPK activator, contributing to a multitude of cellular protection mechanisms (<a href="#B53" class="usa-link" aria-describedby="B53">53</a>). Notably, RNA-Seq analysis revealed that the 2 most significantly increased transcripts in the A-to-I–locked state at 48 hours after ischemia were (a) nicotinamide phosphoribosyltransferase (<em>Nampt</em>), an enzyme involved in NAD<sup>+</sup> salvage, and (b) glycerol-3-phosphate dehydrogenase 2 (<em>Gpd2</em>), the mitochondrial glycerophosphate dehydrogenase involved in the glycerol phosphate shuttle. This shuttle system produces ATP via FADH<sub>2</sub> in the mitochondria and regenerates NAD<sup>+</sup> in the cytoplasm (<a href="#F5" class="usa-link">Figure 5G</a> and <a href="#sd" class="usa-link">Supplemental Figure 10</a>, A–D). In addition, glycerol-3-phosphate dehydrogenase 1 (<em>Gpd1</em>), the cytosolic counterpart required for coupling of the shuttle system, was among the top 20 transcripts significantly upregulated in the A-to-I–locked state. Altogether, our findings indicate that <em>Azin1</em> A-to-I editing renders cells resilient to ischemic stress by harnessing multiple protective pathways. These pathways encompass the upregulation of polyamine biosynthesis, NAD<sup>+</sup> biosynthesis, glycerol phosphate shuttle, and pentose phosphate shunt/purine metabolism. Finally, we examined the role of <em>Azin1</em> A-to-I editing in the endotoxemia model and confirmed the renoprotective effects of A-to-I–locked state (<a href="#sd" class="usa-link">Supplemental Figure 10E</a>).</p></section><section id="sec7"><h3 class="pmc_sec_title">Origin of dsRNA species.</h3> <p>A-to-I editing is catalyzed by the enzyme adenosine deaminase, RNA specific (ADAR), which specifically binds to double-stranded RNA (dsRNA) structures (<a href="#B54" class="usa-link" aria-describedby="B54">54</a>). To investigate the nature of dsRNA species involved, we examined kidneys from our murine model of endotoxemia. Immunoblotting revealed an acute increase in dsRNA levels 1 hour after endotoxin challenge (<a href="#F6" class="usa-link">Figure 6A</a>). dsRNA may arise from repetitive elements resembling virus-like structures, such as long terminal repeats (LTRs) and non-LTR retrotransposons (SINEs and LINEs) (<a href="#B55" class="usa-link" aria-describedby="B55">55</a>). PCR analysis of select repeat elements revealed an increase of MusD (type D murine LTR retrotransposons) 4 hours after endotoxin challenge in the kidney (<a href="#sd" class="usa-link">Supplemental Figure 11A</a>). However, in general, our select PCR targets did not show consistent results, suggesting that the origin of dsRNA may not be repeat class specific.</p> <figure class="fig xbox font-sm" id="F6"><h4 class="obj_head">Figure 6. Genome-wide characterization of A-to-I editing in mouse kidneys.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=11364396_jci-134-180117-g116.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9b9/11364396/85037cb97c97/jci-134-180117-g116.jpg" loading="lazy" height="982" width="764" alt="Figure 6"></a></p> <div class="p text-right font-secondary"><a href="figure/F6/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Immunoblotting of dsRNA under indicated conditions. RNase A incubation was done with high salt to specifically digest single-stranded RNA. The negative control consisted of RNase III digestion, which digests dsRNA. The positive control consisted of poly(I:C) without RNase digestion. (<strong>B</strong>) Schematic representation of dsRNA immunoprecipitation and sequencing. (<strong>C</strong>) Overlay of density plots displaying A-to-I edit percentages under indicated conditions. (<strong>D</strong>) Left: Total counts and distribution of A-to-I editing sites per sample (nuclear fraction; editing rate > 10% and reads count > 5 in at least 3 samples; see Methods for further pre-processing criteria). Middle: Distribution of A-to-I editing sites, normalized to genomic region lengths. Right: Distribution of A-to-I editing sites per repeat class. CDS, coding sequence. (<strong>E</strong>) Summary of A-to-I editing sites that exhibit differential expression compared with the 0-hour baseline. The bottom track represents hyper-editing sites. (<strong>F</strong>) Single-cell uniform manifold approximation and projection (UMAP) displaying the distribution of <em>Adar</em> expression in the mouse kidney (reanalysis of published data GEO <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE151658" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE151658</a>). PT, proximal tubule; CD-PC, collecting duct principal cell; TAL, thick ascending loop of Henle. (<strong>G</strong>–<strong>I</strong>) Quantitation of total RNA-Seq read counts (in counts per million) at the specified time points. (<strong>J</strong>) Scheme depicting the sequence of events observed in the kidney. (<strong>K</strong>) Read coverage comparison for <em>March2</em> near the transcription termination site between dsRNA enrichment (top 6 tracks) and without dsRNA enrichment (bottom 2 tracks, 0 and 28 hours after LPS; regular total RNA sequencing).</p></figcaption></figure><p>To further investigate the phenomenon of dsRNA stress (<a href="#B54" class="usa-link" aria-describedby="B54">54</a>), we next conducted immunoprecipitation of dsRNA species, followed by stranded RNA-Seq on cytoplasmic and nuclear fractions (dsRNA-Seq; <a href="#F6" class="usa-link">Figure 6B</a> and <a href="#sd" class="usa-link">Supplemental Figure 11</a>, B–F). The dsRNA-specific monoclonal antibody (J2) effectively enriched transcripts of varying lengths, ranging from approximately 40 base pairs to several thousand base pairs (<a href="#sd" class="usa-link">Supplemental Figure 11D</a>). This is in line with the antibody’s known characteristics (<a href="#B56" class="usa-link" aria-describedby="B56">56</a>). In the early course of endotoxemia, the abundance of dsRNA transcripts mapping to gene body regions correlated well with those from conventional total RNA-Seq, suggesting that the initial surge of dsRNA burden primarily consists of acute inflammatory molecules (<a href="#sd" class="usa-link">Supplemental Figure 12</a>, A–C). In comparison with conventional total RNA-Seq, dsRNA-Seq enriched mitochondrially encoded RNA transcripts at baseline and during the early stages of endotoxemia (<a href="#sd" class="usa-link">Supplemental Figure 11E</a>). This observation is consistent with the fact that (a) mitochondrial transcription is highly active in the kidney at early time points (<a href="#sd" class="usa-link">Supplemental Figure 12D</a>; mitochondrial transcription decreases at later time points), and (b) mitochondrial transcripts are prone to forming dsRNA structures owing to the bidirectional transcription of the mitochondrial genome (<a href="#sd" class="usa-link">Supplemental Figure 12E</a>) (<a href="#B38" class="usa-link" aria-describedby="B38">38</a>). Immunoprecipitation of dsRNA species also led to the enrichment of intergenic transcripts (<a href="#sd" class="usa-link">Supplemental Figure 11E</a>). A more detailed examination revealed that these intergenic dsRNAs were particularly common in regions adjacent to the gene coding regions (±10 kb from transcription start and end sites; <a href="#sd" class="usa-link">Supplemental Figure 12F</a>). These regions are prone to various mechanisms that can induce the generation of antisense reads, thereby facilitating dsRNA formation (<a href="#B57" class="usa-link" aria-describedby="B57">57</a>, <a href="#B58" class="usa-link" aria-describedby="B58">58</a>).</p> <p>In addition to antisense reads, intramolecular base pairing of single-stranded RNA (stem-loop) is another important source of dsRNA structures that can be catalyzed by ADAR. As demonstrated in <a href="#sd" class="usa-link">Supplemental Figure 12G</a>, sufficiently long complementary repeat regions are present in many genes, especially within intronic regions (912 genes for 30 bp cutoff). These repeat regions contribute to the enrichment of various gene body regions, including introns within our dsRNA-Seq data set.</p></section><section id="sec8"><h3 class="pmc_sec_title">Characterization of A-to-I editing sites.</h3> <p>Having identified dsRNA species that could be targets of ADAR, we next examined the broad distribution of A-to-I editing sites in the mouse kidney. Our data revealed millions of A-to-I editing sites distributed across the genome (see Methods). However, the majority of these editing sites had low coverage (≤5 reads), minimal editing levels (a few percent), or inconsistent editing patterns per condition. Thus, we implemented stringent filtering criteria and focused our analysis on approximately 3,000 editing sites of high confidence for the rest of this study. Importantly, our analytical pipeline employed sequential alignment procedures (<a href="#sd" class="usa-link">Supplemental Figure 11B</a>), enabling the capture of hyper-editing sites that will otherwise fail to map to a reference genome because of an excess of mismatches (<a href="#B59" class="usa-link" aria-describedby="B59">59</a>).</p> <p>Across the genome, we found that both the extent of editing per site and the number of edited sites increased during the later stages of endotoxemia (<a href="#F6" class="usa-link">Figure 6, C–E</a>, and <a href="#sd" class="usa-link">Supplemental Figure 13</a>, A–C). A comparison of the cytoplasmic and nuclear fractions revealed that A-to-I editing occurred predominantly in the nucleus. Nevertheless, although the nucleus remained the primary site of editing, a greater number of transcripts underwent editing within the cytoplasm during the late phase of endotoxemia (<a href="#F6" class="usa-link">Figure 6C</a>). This transition was preceded by an upregulation of <em>Adar</em> expression across all cell types in the kidney (<a href="#F6" class="usa-link">Figure 6, F–H</a>; the paralog of <em>Adar</em>, <em>Adarb1</em>, was downregulated). In parallel, the expression of endonuclease V, the inosine-specific endoribonuclease (<a href="#B60" class="usa-link" aria-describedby="B60">60</a>), decreased, which would also contribute to the preservation of A-to-I–edited transcripts (<a href="#F6" class="usa-link">Figure 6I</a>).</p> <p>In summary, our comprehensive time-course analysis delineated the sequence of events leading to A-to-I editing: initiation with dsRNA stress (1 hour), followed by <em>Adar</em> overexpression (4 hours), and culminating in an increase in A-to-I editing (16 hours) (<a href="#F6" class="usa-link">Figure 6J</a>). The same sequence of events was also observed after ischemia/reperfusion injury (<a href="#sd" class="usa-link">Supplemental Figure 14</a>, A–C). Representative dsRNA-Seq read coverage tracks for each endotoxemia time point are available on a genome browser at <a href="https://connect.posit.iu.edu/view_GY/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/view_GY/</a></p> <p>Over the entire endotoxemia time course, A-to-I editing was most prominent in 3′-untranslated regions (3′-UTRs) (<a href="#F6" class="usa-link">Figure 6D</a> and <a href="#sd" class="usa-link">Supplemental Figure 13A</a>). This prevalence of A-to-I editing in the 3′-UTR was also pronounced in hyper-editing sites (<a href="#sd" class="usa-link">Supplemental Figure 14</a>, D–F). As expected, editing occurred preferentially in repeat regions, especially in SINEs (<a href="#F6" class="usa-link">Figure 6D</a>, <a href="#sd" class="usa-link">Supplemental Figure 13A</a>, and <a href="#sd" class="usa-link">Supplemental Figure 14</a>, E and F). No significant temporal changes were observed in the overall proportion of edit sites per repeat class. We observed markedly different read coverage distribution between dsRNA-Seq and total RNA-Seq for certain genes. For example, <em>March2</em>, an E3 ubiquitin ligase involved in antiviral and antibacterial immune responses, showed significant transcription readthrough with respect to the canonical transcription termination site across a series of hyper-edited regions (<a href="#F6" class="usa-link">Figure 6K</a>). This phenomenon of readthrough was not readily apparent in conventional RNA-Seq data, suggesting that these heavily edited transcripts might be lowly expressed or unstable (<a href="#sd" class="usa-link">Supplemental Figure 15</a>, A and B). The enrichment of dsRNA reads in intronic regions, specifically in repeat regions, was also notable (<a href="#sd" class="usa-link">Supplemental Figure 15</a>, C and D). The high prevalence of A-to-I editing in the intronic regions indicates that editing takes place immediately on nascent transcripts prior to splicing. Given that A-to-I editing in intronic regions could potentially impact alternative splicing (<a href="#B61" class="usa-link" aria-describedby="B61">61</a>), we further scrutinized individual editing sites. Nearly all edit sites were found outside of splicing donor or acceptor regions, including the branch point adenosine (<a href="#sd" class="usa-link">Supplemental Figure 15E</a>). Pathway enrichment analysis revealed that differentially edited sites are enriched in genes related to the regulation of ribonucleoproteins/P-bodies and the unfolded protein response/endoplasmic reticulum membrane (<a href="#F7" class="usa-link">Figure 7, A and B</a>).</p> <figure class="fig xbox font-sm" id="F7"><h4 class="obj_head">Figure 7. Genome-wide characterization of A-to-I editing in mouse kidneys.</h4> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=11364396_jci-134-180117-g117.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/a9b9/11364396/4e17fd5f80ed/jci-134-180117-g117.jpg" loading="lazy" height="1017" width="764" alt="Figure 7"></a></p> <div class="p text-right font-secondary"><a href="figure/F7/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>(<strong>A</strong>) Pathway enrichment analysis based on genes that exhibit differential editing rates between baseline and 28 hours (cytoplasmic compartment). isa, inferred from sequence alignment. (<strong>B</strong>) Heatmap displaying the top 500 differentially expressed A-to-I editing sites between 0-hour baseline and 28 hours after endotoxin in the kidney. The differentially expressed (DE) sites are categorized based on repeat classes. (<strong>C</strong>) List of genes exhibiting non-synonymous A-to-I coding sequence mutation in response to an endotoxin challenge in the kidney. (<strong>D</strong>) <em>Cdk13</em> reads distribution and A-to-I editing under indicated conditions. (<strong>E</strong>) Comparison of motif enrichment between non-hyper-editing (top) and hyper-editing sites (bottom) within ±50 nucleotides centered around A-to-I editing sites. Predicted RNA secondary structure around the 3′-UTR hyper-editing site is shown at the bottom (arrow). Positional entropy is color-coded. (<strong>F</strong>) Ribo-Seq and nanopore read coverage graphs for <em>Adar</em>, clarifying <em>Adar</em> transcript isoform switches during endotoxemia.</p></figcaption></figure></section><section id="sec9"><h3 class="pmc_sec_title">A-to-I editing within coding sequence regions.</h3> <p>A-to-I editing within coding sequences was exceedingly rare. Specifically, instances of A-to-I editing that led to non-synonymous mutations were identified only in the following genes: <em>Azin1</em>, <em>Cdk13</em>, <em>Copa</em>, <em>Cyfip2</em>, <em>Cyp2a5</em>, <em>Igfbp7</em>, <em>Setd1b</em>, and <em>Srcap</em> (<a href="#F7" class="usa-link">Figure 7C</a>). Cdk13 functions as a transcriptional cyclin-dependent kinase involved in nuclear RNA surveillance. The A-to-I editing event in the <em>Cdk13</em> coding sequence occurred near the N-terminus between 2 repeat regions, resulting in a glutamine-to-arginine mutation (<a href="#F7" class="usa-link">Figure 7D</a>). This particular editing site is conserved across both mice and humans (<a href="#B34" class="usa-link" aria-describedby="B34">34</a>). We found that the rate of editing at this site was markedly elevated at baseline and increased even further after endotoxin challenge (<a href="#F7" class="usa-link">Figure 7D</a>). Notably, this editing site was recently linked to aggressive cancer phenotypes (<a href="#B62" class="usa-link" aria-describedby="B62">62</a>), analogous to the findings with <em>Azin1</em> A-to-I editing.</p> <p>In the case of <em>Azin1</em>, editing at chromosome 15:38491612 (mm10) results in a serine-to-glycine mutation. The rate of <em>Azin1</em> editing significantly increased from 0% to over 40% with the progression of endotoxemia (<a href="#sd" class="usa-link">Supplemental Figure 16</a>, A and B). When the serine-to-glycine mutation occurred, the neighboring adenosine was also edited in approximately 50% of cases, resulting in a synonymous mutation (chr15:38491613). Isolated editing of this adjacent adenosine was rare, confirming that chr15:38491612 is indeed the primary editing site. There was a complete absence of A-to-I editing 2 nucleotides away from the main editing locus. These findings underscore the remarkable precision and highly predictable nature of A-to-I editing. Because the <em>Azin1</em> editing site is located near the alternative splice site, we also conducted nanopore long-read RNA-Seq and determined that the <em>Azin1</em> editing status does not correlate with alternative splicing (<a href="#sd" class="usa-link">Supplemental Figure 16</a>, C and D).</p></section><section id="sec10"><h3 class="pmc_sec_title">Adar isoform switching in the mouse kidney.</h3> <p>While the clinical implications of A-to-I editing at individual sites remain largely unknown and some are likely inconsequential, various studies have underscored the significance of A-to-I editing in controlling the kinetics of transcripts, RNA-RNA interactions, R-loop formation, and RNA-protein interactions (<a href="#B63" class="usa-link" aria-describedby="B63">63</a>, <a href="#B64" class="usa-link" aria-describedby="B64">64</a>). Generally, A-to-I editing serves to disrupt a long stretch of complementary base pairing, thereby attenuating the binding of dsRNA sensors such as PKR and MDA5 (<a href="#B65" class="usa-link" aria-describedby="B65">65</a>). Our motif enrichment analysis revealed ADAR’s preference for editing adenosines adjacent to guanosines (5′AG3′; <a href="#F7" class="usa-link">Figure 7E</a>), consistent with prior reports (<a href="#B66" class="usa-link" aria-describedby="B66">66</a>, <a href="#B67" class="usa-link" aria-describedby="B67">67</a>). Intriguingly, when focusing on hyper-editing sites, we detected satellite A-rich regions situated approximately 30 nucleotides downstream of the primary editing site within the 3′-UTR (<a href="#F7" class="usa-link">Figure 7E</a>, bottom track). ADAR has been shown to edit recursively at a fixed interval of approximately 30 bp downstream of an editing site (<a href="#B68" class="usa-link" aria-describedby="B68">68</a>).</p> <p>Using nanopore long-read RNA-Seq and Ribo-Seq, we identified that a relatively less characterized isoform, <em>Adar</em>-201/ENSMUST00000029563, predominates in the murine kidney at baseline and up to 4 hours after endotoxin treatment (<a href="#F7" class="usa-link">Figure 7F</a>). The more widely recognized Adar isoforms are p110 (<em>Adar</em>-202/ENSMUST00000098924) and p150 (<em>Adar</em>-203/ENSMUST00000107405) (<a href="#B69" class="usa-link" aria-describedby="B69">69</a>). The constitutively expressed p110 (in other tissues) lacks a nuclear export signal, hence exerting its editing effect almost exclusively within the nucleus. In contrast, the interferon-inducible isoform p150 harbors both nuclear export and nuclear localization signals, enabling its shuttling between the cytoplasm and nucleus. Similarly, the 201 isoform possesses both nuclear export and nuclear localization signals identical to those of p150, permitting <em>Adar</em>-201 to distribute in both compartments. However, unlike the p110 and p150 isoforms, exon 7 of <em>Adar</em>-201 is truncated by 26 amino acids as a result of alternative splicing. This splicing occurs at the juncture of the critical dsRNA-binding domain R<sub>III</sub> (<a href="#B70" class="usa-link" aria-describedby="B70">70</a>). Therefore, it could potentially disrupt the editing capacity and account for the absence of significant editing by ADAR in murine kidney tissue at baseline.</p> <p>In summary, our comprehensive analysis of the endotoxemia model provided a timeline-specific landscape of A-to-I editing, represented by an array of previously undescribed and established editing loci. The phenomenon of A-to-I editing is highly reproducible and quantitative, offering potential for the development of more accurate diagnostic and staging strategies for kidney disease.</p></section></section><section id="sec11"><h2 class="pmc_sec_title">Discussion</h2> <p>The fast and variable progression of AKI poses a major challenge in implementing a stage-specific therapy at the bedside. We have previously identified that translation shutdown is a hallmark of late-phase septic AKI (<a href="#B39" class="usa-link" aria-describedby="B39">39</a>, <a href="#B41" class="usa-link" aria-describedby="B41">41</a>). While transient inhibition of protein synthesis could be cytoprotective as it attenuates energy consumption and upregulates the integrated stress response, persistent inhibition of protein synthesis is detrimental. Importantly, in a reversible model of AKI, this late phase is also a crucial transition period in which tissue recovery begins (<a href="#B40" class="usa-link" aria-describedby="B40">40</a>). How the tissue, under severe stress, reboots and attains a recovery phenotype is unclear.</p> <p>In this study, we demonstrate that <em>Azin1</em> A-to-I editing plays a key role in promoting tissue recovery after AKI. Leading up to this robust <em>Azin1</em> editing is a series of stress responses the kidney goes through. These include NF-κB–mediated acute inflammation, interferon responses, and the integrated stress response, all culminating in metabolic shutdown (<a href="#B39" class="usa-link" aria-describedby="B39">39</a>–<a href="#B41" class="usa-link" aria-describedby="B41">41</a>, <a href="#B71" class="usa-link" aria-describedby="B71">71</a>). Thus, <em>Azin1</em> A-to-I editing represents a landmark outcome following prolonged cellular stress. We found that the lack of <em>AZIN1</em> editing renders cells susceptible to nutrient deprivation and attenuates glycolytic reserve, thereby restricting cell proliferation. Conversely, <em>Azin1</em> A-to-I editing confers better fitness by coupling increased polyamine bioavailability to the activation of cytoprotective molecules such as NAD<sup>+</sup> and AICAR. The phenotypic impact of <em>Azin1</em> A-to-I editing in vivo is subtle under basal conditions but becomes apparent during stress. This indicates that <em>Azin1</em> A-to-I editing itself is not a driver of metabolic rewiring but assists this process during emergency. Collectively, these findings suggest a general model in which <em>Azin1</em> A-to-I editing serves as a rational autoregulatory system, safeguarding against sustained metabolic shutdown and providing a cue for tissue recovery.</p> <p>Our study also provides a comprehensive map of A-to-I editing in the kidney using a model of endotoxemia. This model is highly reproducible and has been extensively characterized (<a href="#B14" class="usa-link" aria-describedby="B14">14</a>, <a href="#B39" class="usa-link" aria-describedby="B39">39</a>, <a href="#B40" class="usa-link" aria-describedby="B40">40</a>, <a href="#B72" class="usa-link" aria-describedby="B72">72</a>–<a href="#B74" class="usa-link" aria-describedby="B74">74</a>). This model was also independently benchmarked by Zhou et al. against a range of kidney injury models (<a href="#B75" class="usa-link" aria-describedby="B75">75</a>), further confirming the distinct stage transition from injury to recovery captured by this model. Our genome-wide interrogation of A-to-I editing revealed that A-to-I editing was enriched in genes involved in crucial stress response pathways including P-bodies and the unfolded protein response during the recovery phase of kidney injury (e.g., <em>Limd1</em>, <em>Celf1</em>, <em>Pum2</em>, <em>Apobec3</em>, <em>Sppl2a</em>, <em>Dnajb12</em>, and <em>Xbp1</em>). Given the biological relevance, these editing sites might have evolved to diversify their transcript repertoires or to evade the recognition by dsRNA sensors under stress conditions. The latter mechanism has been clearly demonstrated for A-to-I editing in the kidney disease risk gene <em>APOL1</em> by Riella et al. (<a href="#B76" class="usa-link" aria-describedby="B76">76</a>).</p> <p>Infections and various environmental factors frequently act as triggers and exacerbate the progression of kidney disease. The resulting outcomes exhibit significant variability. The present study portrays a timeline-specific role for A-to-I editing in the kidney during periods of stress. This structured transcriptional variation is quantitative and tied to an individual’s unique past. While not all the editing sites are necessarily pertinent or carry biological significance, it is our hope that further clarification of these attributes will enhance the accuracy of disease diagnosis and provide a molecular clock to guide therapy.</p> <section id="sec12"><h3 class="pmc_sec_title">Limitations of the study.</h3> <p>The underlying mechanisms involved in the metabolic flexibility conferred by <em>AZIN1</em> A-to-I editing require further investigation. Polyamines are involved in a wide variety of cellular processes, such as DNA/RNA stabilization and protein synthesis. The versatile nature of polyamines makes it challenging to pinpoint precisely where and how they induce metabolic reprogramming. Edited <em>AZIN1</em> may also have polyamine-independent roles. Additionally, the role of <em>AZIN1</em> editing may vary depending on the type of injury (e.g., sterile inflammation vs. viral or bacterial infection) and the affected tissues. Finally, translating this work to human diseases and controlling <em>AZIN1</em> A-to-I editing remain challenging. In this regard, the development of clinical trials using ADAR-based RNA editing technology is highly exciting (<a href="#B77" class="usa-link" aria-describedby="B77">77</a>, <a href="#B78" class="usa-link" aria-describedby="B78">78</a>).</p></section></section><section id="sec13"><h2 class="pmc_sec_title">Methods</h2> <p>Further information can be found in <a href="#sd" class="usa-link">Supplemental Methods</a>.</p> <section id="sec14"><h3 class="pmc_sec_title">Sex as a biological variable.</h3> <p>Our human study examined male and female subjects, and similar findings are reported for both sexes. However, in the animal study, only male mice were used, owing to known differences in susceptibility to renal ischemia injury. Nevertheless, the findings in mice are expected to be relevant for both sexes.</p></section><section id="sec15"><h3 class="pmc_sec_title">Malaria cohort.</h3> <p>RNA-Seq FASTQ files were obtained from Gene Expression Omnibus (GEO) <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE52166" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE52166</a> (stranded total RNA-Seq with 2 × 100 bp paired-end configuration). The study details have been outlined previously (<a href="#B33" class="usa-link" aria-describedby="B33">33</a>). This longitudinal cohort study consisted of biweekly active malaria surveillance and passive surveillance through self-referral over a 3-year period. RNA-Seq and PCR were conducted on whole blood samples obtained from subjects before and after <em>Plasmodium falciparum</em> infection as determined through the prospective surveillance program.</p></section><section id="sec16"><h3 class="pmc_sec_title">Human kidney biopsy.</h3> <p>This study complied with all related ethical regulations. Human sample experiments followed relevant guidelines and regulations. Bulk RNA-Seq data files were obtained from 2 sources: the Biopsy Biobank Cohort of Indiana (<a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE139061" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE139061</a>) and the Kidney Precision Medicine Project Atlas (<a href="https://atlas.kpmp.org/repository" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://atlas.kpmp.org/repository</a>; accessed January 25, 2023) (<a href="#B35" class="usa-link" aria-describedby="B35">35</a>, <a href="#B36" class="usa-link" aria-describedby="B36">36</a>, <a href="#B79" class="usa-link" aria-describedby="B79">79</a>, <a href="#B80" class="usa-link" aria-describedby="B80">80</a>). These bulk kidney tissues were processed from an OCT block using the SMARTer Stranded Total RNA-Seq Kit v2 (Takara). Sequencing was performed in a 2 × 75 bp paired-end configuration using a NovaSeq platform (Illumina).</p></section><section id="sec17"><h3 class="pmc_sec_title">Generation of AZIN1 A-to-I–locked and A-to-I–uneditable homozygous clonal cell lines.</h3> <p>We designed single-guide RNAs and single-stranded oligo DNA nucleotides (ssODNs; homology-directed repair donor oligonucleotides), and generated knockin HEK293T cell lines using the CRISPR/Cas9 system. A target knockin and protospacer adjacent motif block (PAM synonymous mutation; GTG/valine to TGC/valine) were introduced in the vicinity of the double-strand break (±10 bp) using the asymmetric donor DNA strategy (36 bp | cut | 91 bp for the nontarget strand).</p> <p>The sgRNA (+PAM) used for both A-to-I–locked and uneditable genome editing was 5′TGATGAGCTTGATCAAATTG(TGG)3′.</p> <p>The ssODN (antisense strand) for A-to-I–locked state (AGC/serine to GGC/glycine) was 5′GCAGATGGTTCATGGAAAGAATCTGCTCCCATGTTATCAAAGATAAGCCAATCTCCCACATTCAGCTCAGGAAGAAGACAGCc TTCgACAATTTGATCAAGCTCATCACAGGATGGACCCCAAAGGC3′.</p> <p>The ssODN (antisense strand) for A-to-I–uneditable state (AGC/serine to TCC/serine) was 5′GCAGATGGTTCATGGAAAGAATCTGCTCCCATGTTATCAAAGATAAGCCAATCTCCCACATTCAGCTCAGGAAGAAGACAGga TTCgACAATTTGATCAAGCTCATCACAGGATGGACCCCAAAGGC3′.</p> <p>Cells were cultured in 10 cm plates to 70% confluence before nucleofection. Approximately 150 × 10<sup>3</sup> cells (5 μL) were mixed with 1.49 μL of ssODN (100 μM) and Cas9 complex consisting of 18 μL SF 4D-Nucleofector X solution plus supplement 1 (Lonza V4XC-2012), 6 μL of sgRNA (30 pmol/μL), and 1 μL of Cas9 2NLS nuclease, <em>Streptococcus</em> <em>pyogenes</em> (20 pmol/μL; Synthego). Nucleofection was done using Amaxa 4D-Nucleofector X (CM-130 program, Lonza). Cells were seeded in 15 cm plates at various concentrations. Clonal isolation was done manually. DNA extraction was done using Quick DNA Miniprep kit (Zymo Research D3025). PCR was done using Q5 High-Fidelity DNA polymerase (New England Biolabs) and Monarch PCR Cleanup Kit (New England Biolabs T1030). PCR primers used were: 5′ACTCACAAATTCAATACCTGCGT3′ (forward) and 5′TGCCTTAAAATAAAATCACCTTACCA3′ (reverse).</p> <p>PCR products were electrophoresed in 2% agarose gel (TopVision Agarose Tablets, Thermo Fisher Scientific R2801), and bands were excised and extracted using QIAQuick Gel Extraction kit (Qiagen 28706). Sanger sequencing was done at GeneWiz. Software used for design and analysis of mutant cell lines included CRISPRdirect, SnapGene, Primer3Plus, New England Biolabs Tm calculator, and Synthego ICE. Successful homozygous mutant cell lines were chosen for downstream experiments.</p></section><section id="sec18"><h3 class="pmc_sec_title">Generation of Azin1 A-to-I–locked and A-to-I–uneditable mouse models.</h3> <p>Similar to the human cell lines, we designed the following sgRNA and ssODNs to generate A-to-I–locked and A-to-I–uneditable mouse models.</p> <p>The sgRNA (+PAM) used for both A-to-I–locked and uneditable genome editing was 5′TGATGAGCTTGATCAAATTG(TGG)3′.</p> <p>The ssODN (antisense strand) for A-to-I–locked state (AGC/serine to GGC/glycine) was 5′GCAGATGGTTCGTGGAAAGAATCTGCTCCCATGTTATCAAAGATAAGCCAATCTCCCACATTCAGCTCAGGAAGAAGACAGCc TTCaACAATTTGATCAAGCTCATCACAGGATGGACCCCAAAGGC3′.</p> <p>The ssODN (antisense strand) for A-to-I–uneditable state (AGC/serine to TCC/serine) was 5′GCAGATGGTTCGTGGAAAGAATCTGCTCCCATGTTATCAAAGATAAGCCAATCTCCCACATTCAGCTCAGGAAGAAGACAGga TTCaACAATTTGATCAAGCTCATCACAGGATGGACCCCAAAGGC3′.</p> <p>Embryo manipulation and generation of founder mice on C57BL/6J background were performed by The Jackson Laboratory Mouse Model Generation Services. N1 sperms (heterozygous) have been cryopreserved at The Jackson Laboratory (stock 414244 for Azin1 A-to-I–locked and stock 413737 for Azin1 A-to-I–uneditable mice). PCR primers used for genotyping were 5′TGAGACTTATGCCTGATCGTTG3′ (forward) and 5′GGTTCGTGGAAAGAATCTGC3′ (reverse). PCR primers used for cDNA Sanger sequencing were 5′ACAAGGAAGATGAGCCTCTG3′ (forward) and 5′AGCTGGCCTCTGAAAATCAT3′ (reverse).</p></section><section id="sec19"><h3 class="pmc_sec_title">Animal models of kidney injury.</h3> <p>Azin1 A-to-I–locked and uneditable mice were housed at Indiana University School of Medicine under a 12-hour light/12-hour dark cycle at 25°C. For studies that did not require the knockin mice, C57BL/6J mice were obtained from The Jackson Laboratory. All mice were 8–12 weeks of age and weighed 24–32 g. Animals were subjected to a single-dose, 4 mg/kg endotoxin (LPS) tail vein i.v. injection in a volume of 300 μL (<em>E</em>. <em>coli</em> serotype 0111:B4, MilliporeSigma). Untreated mice were given an equivalent volume of sterile normal saline as a vehicle. Ischemia/reperfusion injury was performed under isoflurane anesthesia. Before surgery, mice were given extended-release buprenorphine at a dose of 3.25 mg/kg. The mice were subjected to a 20-minute bilateral renal pedicle clamp followed by reperfusion. A heating pad was used to ensure that their rectal temperature remained above 36°C throughout the surgical procedure. No antibiotics or fluid resuscitation were administered.</p></section><section id="sec20"><h3 class="pmc_sec_title">Cells.</h3> <p>HEK293T cells, AZIN1 A-to-I–locked cells, and uneditable homozygous clonal cells were cultured in DMEM (4.5 g/L glucose, <span class="font-variant-small-caps">l</span>-glutamine, and Na pyruvate; Corning 10-013-CV) with 10% FBS (Midwest Scientific USDAFBS) and 100 U/mL penicillin and 100 μg/mL streptomycin (Thermo Fisher Scientific). All cell types were cultured at 37°C with 5% CO<sub>2</sub>. Hypoxia experiments were done after addition of 250 μL of 1 M HEPES buffer to 10 mL of DMEM in each 10 cm dish. After the filling of the hypoxia chamber with nitrogen, cells were incubated for 3 hours. </p></section><section id="sec21"><h3 class="pmc_sec_title">dsRNA immunoprecipitation.</h3> <p>We adopted and made modifications to existing protocols (<a href="#B38" class="usa-link" aria-describedby="B38">38</a>, <a href="#B81" class="usa-link" aria-describedby="B81">81</a>). Mouse kidneys were harvested and immediately minced on an ice-cold dish. One-third of the minced tissue was transferred to 1.2 mL of fractionation/lysis buffer, which consisted of 10 mM Tris (pH 7.0), 10 mM NaCl, 5 mM MgCl<sub>2</sub>, 0.5% IGEPAL CA-630 (MilliporeSigma I8896), 0.5% Triton X-100, DNase I (10 U/mL; Zymo E1011A), and Superase-In (2 μL per 1 mL; Thermo Fisher Scientific). The lysate was centrifuged at 3,000<em>g</em> for 3 minutes at 4°C. The supernatant was further centrifuged at 21,000<em>g</em> for 5 minutes. The resulting supernatant represents the cytoplasmic fraction. The pellet obtained from the initial centrifugation was resuspended in 1 mL of the fractionation/lysis buffer and homogenized using a Minilys tissue homogenizer (Bertin Instruments) at the highest speed for 45 seconds. After homogenization, the lysate was centrifuged at 21,000<em>g</em> for 5 minutes. This supernatant serves as the nuclear fraction. Each fraction was then incubated with anti-dsRNA monoclonal antibody J2 (SCICONS/Jena Bioscience RNT-SCI-10010200; IgG2a κ light chain) at a concentration of 10 μg per 600 μL of lysate for 2 hours at 4°C. Mouse IgG2a κ (clone eBM2a; eBioscience 14-4724-82) was used as an isotype control. Protein G Dynabeads (Invitrogen 10003D) were washed in the immunoprecipitation buffer described below and then incubated with the sample-antibody mix for 1 hour at 4°C. The dsRNA-antibody-Dynabeads complex was washed on a magnetic rack using 500 μL washed 4 times with immunoprecipitation buffer consisting of 50 mM Tris (pH 7.4), 100 mM NaCl, 3 mM MgCl<sub>2</sub>, IGEPAL 0.5%. RNA was extracted from Dynabeads using 1 mL TRIzol and 200 μL chloroform per sample. After the second round of TRIzol chloroform RNA purification, RNA precipitation was done using ice-cold isopropanol, sodium acetate, and GlycoBlue (Thermo Fisher) n ice for 1 hour. The RNA was resuspended in 7 μL of water. The RNA yields were approximately 6 ng/μL to 16 ng/μL for J2 antibody immunoprecipitation (lower in the nuclear fraction), while the isotype control yielded less than 300 pg/μL.</p></section><section id="sec22"><h3 class="pmc_sec_title">A-to-I editing analysis.</h3> <p>The entire data processing scripts are available through GitHub: <a href="https://github.com/hato-lab/A-to-I-edit" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://github.com/hato-lab/A-to-I-edit</a> FASTQ files were initially aligned to the reference genomes: GRCm38 primary assembly and Gencode vM25 GTF files for mouse and GRCh38 and v41 GTF files for human, using the STAR aligner (v2.7.9a). To capture hyper-edited reads (<a href="#B59" class="usa-link" aria-describedby="B59">59</a>), we generated pseudo-genome references where all “A” bases were substituted with “G” (<a href="#sd" class="usa-link">Supplemental Figure 11B</a>). The unaligned reads from the initial alignment were realigned to the pseudo-genome reference using the STAR aligner with the same parameters (hyper-edited reads).</p> <p>A-to-I editing sites were first detected using reditools2 extract_coverage.sh and parallel_reditools.py (<a href="#B82" class="usa-link" aria-describedby="B82">82</a>). The resulting A-to-I editing sites underwent additional filtering based on the following criteria: for a given editing site, there must be at least 3 samples with edited reads greater than 5 and an editing rate greater than 0.1 but less than 0.9 in order to reduce the inclusion of low editing loci and potential genomic mutations, respectively. The reading depth of the remaining sites (total counts) was obtained using the Samtools (<a href="#B83" class="usa-link" aria-describedby="B83">83</a>) depth command with the -b option (v1.9). Each A-to-I editing site was annotated using biomaRt (<a href="#B84" class="usa-link" aria-describedby="B84">84</a>) and a repeat class file obtained from the UCSC Genome Browser. Fisher’s exact test was used to compare edit ratio group comparisons. <em>P</em> values for each comparison were adjusted using the false discovery rate method. Sites with false discovery rate–adjusted <em>P</em> values less than 0.05 were considered significant for each comparison. ANNOVAR (<a href="#B85" class="usa-link" aria-describedby="B85">85</a>) was used to identify coding sequence mutations, and motif enrichment analysis was done using kpLogo (<a href="#B86" class="usa-link" aria-describedby="B86">86</a>). Complementary repeat region analysis was done using Biostrings:findPalindromes in R. RNAfold was used for the prediction of RNA minimum free energy secondary structures (<a href="#B87" class="usa-link" aria-describedby="B87">87</a>).</p></section><section id="sec23"><h3 class="pmc_sec_title">Metabolomics.</h3> <p>Untargeted global metabolomic analysis was performed at Metabolon Inc. Snap-frozen mouse kidney tissues were processed following the Metabolon standard extraction method (60% methanol) and Metabolon’s ultra-performance liquid chromatography–tandem mass spectrometry pipeline. HPLC measurements were conducted in our laboratory using an Agilent 1100 series system equipped with a UV detector set at 254 nm, a fluorescence detector set at 335/510 nm, and a MilliporeSigma SUPELCOSIL LC-18-T column (15 cm × 4.6 mm with a particle size of 3 μm). For measurements of polyamines and polyamine precursors, tissues were homogenized using prechilled 10% HClO<sub>4</sub>. After centrifugation, 200 μL of each supernatant was slowly neutralized with 400 μL of NaHCO<sub>3</sub> (8–9 g/100 mL at room temperature) (<a href="#B88" class="usa-link" aria-describedby="B88">88</a>, <a href="#B89" class="usa-link" aria-describedby="B89">89</a>). Dansylation of polyamines/amino acids was done by addition of 800 μL of dansyl chloride in acetone (5 mg/mL), incubated at 70°C for 5 minutes. The reaction was terminated by addition of 200 μL of <span class="font-variant-small-caps">l</span>-proline (100 mg/mL water) and incubated in the dark for 30 minutes at room temperature. Dansylated amino acids were extracted by addition of 100 μL of toluene, vortexed for 1 minute. After centrifugation, the organic phase (supernatant) was transferred to a new vial and concentrated for 10 minutes at 60°C (SpeedVac Concentrator SPD1010). The extract was dissolved in 300 μL of acetonitrile and filtered (0.45 μm PTFE MicroSpin filter, Chrom Tech). Buffer A was composed of acetonitrile/water (50/50 vol/vol), and buffer B was 100% acetonitrile. Our gradient elution program consisted of 0% B at 0 minutes, 0% to 15% linear gradient from 1 minute to 16 minutes, 50% to 80% from 16 minutes to 26 minutes, 26 to 28 minutes isocratic, 80% to 100% linear gradient from 28 minutes to 34 minutes.</p></section><section id="sec24"><h3 class="pmc_sec_title">Statistics.</h3> <p>Data were analyzed for statistical significance and visualized with R software 4.1.0. Error bars show SD. For multiple comparisons, 1-way ANOVA followed by pairwise <em>t</em> tests was performed using the Benjamini and Hochberg method to adjust <em>P</em> values. All analyses were 2-sided, and <em>P</em> values less than 0.05 were considered significant.</p></section><section id="sec25"><h3 class="pmc_sec_title">Study approval.</h3> <p>All animal protocols were approved by the Indiana University Institutional Animal Care and Use Committee and conformed to the NIH <em>Guide for the Care and Use of Laboratory Animals</em> (National Academies Press, 2011). Work with human subjects was approved by the Institutional Review Board of Indiana University School of Medicine (IRB 190657223). Tissues from the Biopsy Biobank Cohort of Indiana were acquired under waiver of informed consent. The Kidney Precision Medicine Project participants gave written informed consent.</p></section><section id="sec26"><h3 class="pmc_sec_title">Data availability.</h3> <p>RNA-Seq data were deposited in the NCBI’s GEO database:</p> <p>Human kidney biopsy RNA sequencing data are available at <a href="https://connect.posit.iu.edu/bulk_kidney_bx/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/bulk_kidney_bx/</a></p> <p>For dsRNA IP sequencing (LPS time course), see <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE244941" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE244941</a>. Representative read coverage tracks for the cytoplasmic fraction are available on a genome browser at <a href="https://connect.posit.iu.edu/view_GY/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/view_GY/</a></p> <p>For bulk kidney total RNA-Seq data for wild-type mice after LPS challenge (LPS time course), see <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE247727" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE247727</a>.</p> <p>For bulk kidney total RNA-Seq data for wild-type mice after ischemia/reperfusion injury (IRI) (IRI time course), see GSE267650 (reviewer token: mdynmimctbahrcn). Data are available at <a href="https://connect.posit.iu.edu/IRI_timecourse_WT/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/IRI_timecourse_WT/</a></p> <p>For bulk kidney total RNA-Seq data for Azin1-locked and uneditable mice (IRI time course), see <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE253286" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE253286</a> for baseline and 24 hours and GSE267650 for 48 and 72 hours (reviewer token: mdynmimctbahrcn). Azin1 mouse kidney RNA-Seq data for baseline and 24 hours after IRI are available at <a href="https://connect.posit.iu.edu/azin1_mouse_kidney/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/azin1_mouse_kidney/</a></p> <p>For mouse kidney nanopore PCR-free direct cDNA sequencing (LPS time course), see GSE244942 (reviewer token: otinkqkqdjypbav).</p> <p>AZIN1 cell line RNA-Seq data are available at <a href="https://connect.posit.iu.edu/azin1/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/azin1/</a></p> <p>Proteomics data are deposited in ProteomeXchange (accession MSV000093887; ID: MSV000093887_reviewer; password: Azin).</p> <p>Reanalysis of Ribo-Seq and single-cell RNA-Seq was performed using <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE120877" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE120877</a> and <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE151658" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE151658</a>. A <a href="#sd" class="usa-link">Supporting Data Values</a> file is provided as supplemental material.</p></section><section id="sec27"><h3 class="pmc_sec_title">Code availability.</h3> <p>Scripts are available through GitHub: <a href="https://github.com/hato-lab/A-to-I-edit" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://github.com/hato-lab/A-to-I-edit</a></p></section></section><section id="sec28"><h2 class="pmc_sec_title">Author contributions</h2> <p>TH designed and coordinated the study. SH, CZ, AZ, SM, AN, QM, SCJ, EHD, BM, MH, and TH performed experiments. SH, JM, and TH performed data analyses. SH, PCD, and TH interpreted data. MTE and TMT provided clinical data and human kidney biopsy samples. PCD and TH wrote the manuscript.</p></section><section id="sd"><h2 class="pmc_sec_title">Supplementary Material</h2> <section class="sm xbox font-sm" id="SD1"><div class="caption p"><span>Supplemental data</span></div> <div class="media p" id="d67e1435"><div class="caption"> <a href="/articles/instance/11364396/bin/jci-134-180117-s118.pdf" data-ga-action="click_feat_suppl" class="usa-link">jci-134-180117-s118.pdf</a><sup> (88.9MB, pdf) </sup> </div></div></section><section class="sm xbox font-sm" id="SD2"><div class="caption p"><span>Unedited blot and gel images</span></div> <div class="media p" id="d67e1439"><div class="caption"> <a href="/articles/instance/11364396/bin/jci-134-180117-s119.pdf" data-ga-action="click_feat_suppl" class="usa-link">jci-134-180117-s119.pdf</a><sup> (7.1MB, pdf) </sup> </div></div></section><section class="sm xbox font-sm" id="SD3"><div class="caption p"><span>Supporting data values</span></div> <div class="media p" id="d67e1443"><div class="caption"> <a href="/articles/instance/11364396/bin/jci-134-180117-s120.xlsx" data-ga-action="click_feat_suppl" class="usa-link">jci-134-180117-s120.xlsx</a><sup> (232.2KB, xlsx) </sup> </div></div></section></section><section id="ack1" class="ack"><h2 class="pmc_sec_title">Acknowledgments</h2> <p>We thank Katherine Kelly at Indiana University for assisting with histopathology assessment and Lihe Chen and Mark Knepper at the NIH/National Heart, Lung, and Blood Institute for assisting with IGV web server setup. We also thank Amber Mosley, Whitney Smith-Kinnamari, Chunna Guo, and Mandy Bittner at the Indiana University School of Medicine Proteomics Core; Yunlong Liu, Hongyu Gao, Fang Fang, and Xialing Xuei at the Center for Medical Genomics; and former lab members Thomas W. McCarthy and Kevin Ni. Measurement of serum creatinine concentration was performed by John Moore, Yang Yan, et al. at the University of Alabama at Birmingham/UCSD O’Brien Center Core for Acute Kidney Injury Research (NIH P30DK079337) using isotope dilution liquid chromatography–mass spectrometry. This work was supported by NIH grants R01-AI148282 and Veterans Affairs Merit BX002901 to TH, R01-DK107623 to PCD, and U01DK114923 to PCD and MTE.</p></section><section id="notes1"><section id="sec30"><h3 class="pmc_sec_title">Version 1. 07/02/2024</h3> <p>In-Press Preview</p></section><section id="sec31"><h3 class="pmc_sec_title">Version 2. 09/03/2024</h3> <p>Electronic publication</p></section></section><section id="fn-group1" class="fn-group"><h2 class="pmc_sec_title">Footnotes</h2> <div class="fn-group p font-secondary-light font-sm"> <div class="fn p" id="fn1"><p><strong>Conflict of interest:</strong> The authors have declared that no conflict of interest exists.</p></div> <div class="fn p" id="fn2"><p><strong>Copyright:</strong> © 2024, Heruye et al. This is an open access article published under the terms of the Creative Commons Attribution 4.0 International License.</p></div> <div class="fn p" id="fn3"><p><strong>Reference information:</strong><em> J Clin Invest</em>. 2024;134(17):e180117. https://doi.org/10.1172/JCI180117.</p></div> </div></section><section id="_ci93_" lang="en" class="contrib-info"><h2 class="pmc_sec_title">Contributor Information</h2> <p>Segewkal Hawaze Heruye, Email: sheruye@iu.edu.</p> <p>Jered Myslinski, Email: jmyslins@iu.edu.</p> <p>Chao Zeng, Email: chao.zeng@aoni.waseda.jp.</p> <p>Amy Zollman, Email: alzollma@iu.edu.</p> <p>Shinichi Makino, Email: smakino@iu.edu.</p> <p>Azuma Nanamatsu, Email: ananamat@iu.edu.</p> <p>Quoseena Mir, Email: mirq@iu.edu.</p> <p>Sarath Chandra Janga, Email: scjanga@iupui.edu.</p> <p>Emma H. Doud, Email: edoud@iu.edu.</p> <p>Michael T. Eadon, Email: meadon@iupui.edu.</p> <p>Bernhard Maier, Email: bfmaier@iupui.edu.</p> <p>Michiaki Hamada, Email: mhamada@waseda.jp.</p> <p>Tuan M. Tran, Email: tuantran@iu.edu.</p> <p>Pierre C. Dagher, Email: pdaghe2@iupui.edu.</p> <p>Takashi Hato, Email: thato@iu.edu.</p></section><section id="ref-list1" class="ref-list"><h2 class="pmc_sec_title">References</h2> <section id="ref-list1_sec2"><ul class="ref-list font-sm" style="list-style-type:none"> <li id="B1"> <span class="label">1.</span><cite>Miller-Fleming L, et al. Remaining mysteries of molecular biology: the role of polyamines in the cell. J Mol Biol. 2015;427(21):3389–3406. doi: 10.1016/j.jmb.2015.06.020.</cite> [<a href="https://doi.org/10.1016/j.jmb.2015.06.020" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/26156863/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Mol%20Biol&title=Remaining%20mysteries%20of%20molecular%20biology:%20the%20role%20of%20polyamines%20in%20the%20cell&author=L%20Miller-Fleming&volume=427&issue=21&publication_year=2015&pages=3389-3406&pmid=26156863&doi=10.1016/j.jmb.2015.06.020&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B2"> <span class="label">2.</span><cite>Madeo F, et al. Spermidine in health and disease. Science. 2018;359(6374):eaan2788. doi: 10.1126/science.aan2788.</cite> [<a href="https://doi.org/10.1126/science.aan2788" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/29371440/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Science&title=Spermidine%20in%20health%20and%20disease&author=F%20Madeo&volume=359&issue=6374&publication_year=2018&pages=eaan2788&pmid=29371440&doi=10.1126/science.aan2788&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B3"> <span class="label">3.</span><cite>Pegg AE. Functions of polyamines in mammals. J Biol Chem. 2016;291(29):14904–14912. doi: 10.1074/jbc.R116.731661.</cite> [<a href="https://doi.org/10.1074/jbc.R116.731661" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4946908/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/27268251/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Biol%20Chem&title=Functions%20of%20polyamines%20in%20mammals&author=AE%20Pegg&volume=291&issue=29&publication_year=2016&pages=14904-14912&pmid=27268251&doi=10.1074/jbc.R116.731661&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B4"> <span class="label">4.</span><cite>Igarashi K, Kashiwagi K. Modulation of cellular function by polyamines. Int J Biochem Cell Biol. 2010;42(1):39–51. doi: 10.1016/j.biocel.2009.07.009.</cite> [<a href="https://doi.org/10.1016/j.biocel.2009.07.009" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19643201/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Int%20J%20Biochem%20Cell%20Biol&title=Modulation%20of%20cellular%20function%20by%20polyamines&author=K%20Igarashi&author=K%20Kashiwagi&volume=42&issue=1&publication_year=2010&pages=39-51&pmid=19643201&doi=10.1016/j.biocel.2009.07.009&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B5"> <span class="label">5.</span><cite>Lightfoot HL, Hall J. Endogenous polyamine function—the RNA perspective. Nucleic Acids Res. 2014;42(18):11275–11290. doi: 10.1093/nar/gku837.</cite> [<a href="https://doi.org/10.1093/nar/gku837" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4191411/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/25232095/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nucleic%20Acids%20Res&title=Endogenous%20polyamine%20function%E2%80%94the%20RNA%20perspective&author=HL%20Lightfoot&author=J%20Hall&volume=42&issue=18&publication_year=2014&pages=11275-11290&pmid=25232095&doi=10.1093/nar/gku837&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B6"> <span class="label">6.</span><cite>Mandal S, et al. Depletion of cellular polyamines, spermidine and spermine, causes a total arrest in translation and growth in mammalian cells. Proc Natl Acad Sci U S A. 2013;110(6):2169–2174. doi: 10.1073/pnas.1219002110.</cite> [<a href="https://doi.org/10.1073/pnas.1219002110" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3568356/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23345430/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Proc%20Natl%20Acad%20Sci%20U%20S%20A&title=Depletion%20of%20cellular%20polyamines,%20spermidine%20and%20spermine,%20causes%20a%20total%20arrest%20in%20translation%20and%20growth%20in%20mammalian%20cells&author=S%20Mandal&volume=110&issue=6&publication_year=2013&pages=2169-2174&pmid=23345430&doi=10.1073/pnas.1219002110&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B7"> <span class="label">7.</span><cite>Casero RA., Jr Polyamine metabolism and cancer: treatments, challenges and opportunities. Nat Rev Cancer. 2018;18(11):681–695. doi: 10.1038/s41568-018-0050-3.</cite> [<a href="https://doi.org/10.1038/s41568-018-0050-3" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6487480/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30181570/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Rev%20Cancer&title=Polyamine%20metabolism%20and%20cancer:%20treatments,%20challenges%20and%20opportunities&author=RA%20Casero&volume=18&issue=11&publication_year=2018&pages=681-695&pmid=30181570&doi=10.1038/s41568-018-0050-3&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B8"> <span class="label">8.</span><cite>Al-Habsi M, et al. Spermidine activates mitochondrial trifunctional protein and improves antitumor immunity in mice. Science. 2022;378(6618):eabj3510. doi: 10.1126/science.abj3510.</cite> [<a href="https://doi.org/10.1126/science.abj3510" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/36302005/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Science&title=Spermidine%20activates%20mitochondrial%20trifunctional%20protein%20and%20improves%20antitumor%20immunity%20in%20mice&author=M%20Al-Habsi&volume=378&issue=6618&publication_year=2022&pages=eabj3510&pmid=36302005&doi=10.1126/science.abj3510&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B9"> <span class="label">9.</span><cite>Puleston DJ, et al. Polyamine metabolism is a central determinant of helper T cell lineage fidelity. Cell. 2021;184(16):4186–4202. doi: 10.1016/j.cell.2021.06.007.</cite> [<a href="https://doi.org/10.1016/j.cell.2021.06.007" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC8358979/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/34216540/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cell&title=Polyamine%20metabolism%20is%20a%20central%20determinant%20of%20helper%20T%20cell%20lineage%20fidelity&author=DJ%20Puleston&volume=184&issue=16&publication_year=2021&pages=4186-4202&pmid=34216540&doi=10.1016/j.cell.2021.06.007&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B10"> <span class="label">10.</span><cite>Slotkin W, Nishikura K. Adenosine-to-inosine RNA editing and human disease. Genome Med. 2013;5(11):105. doi: 10.1186/gm508.</cite> [<a href="https://doi.org/10.1186/gm508" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3979043/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/24289319/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Genome%20Med&title=Adenosine-to-inosine%20RNA%20editing%20and%20human%20disease&author=W%20Slotkin&author=K%20Nishikura&volume=5&issue=11&publication_year=2013&pages=105&pmid=24289319&doi=10.1186/gm508&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B11"> <span class="label">11.</span><cite>Tian Z, Liang M. Renal metabolism and hypertension. Nat Commun. 2021;12(1):963. doi: 10.1038/s41467-021-21301-5.</cite> [<a href="https://doi.org/10.1038/s41467-021-21301-5" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7878744/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33574248/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Commun&title=Renal%20metabolism%20and%20hypertension&author=Z%20Tian&author=M%20Liang&volume=12&issue=1&publication_year=2021&pages=963&pmid=33574248&doi=10.1038/s41467-021-21301-5&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B12"> <span class="label">12.</span><cite>Sieckmann T, et al. Strikingly conserved gene expression changes of polyamine regulating enzymes among various forms of acute and chronic kidney injury. Kidney Int. 2023;104(1):90–107. doi: 10.1016/j.kint.2023.04.005.</cite> [<a href="https://doi.org/10.1016/j.kint.2023.04.005" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/37121432/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Kidney%20Int&title=Strikingly%20conserved%20gene%20expression%20changes%20of%20polyamine%20regulating%20enzymes%20among%20various%20forms%20of%20acute%20and%20chronic%20kidney%20injury&author=T%20Sieckmann&volume=104&issue=1&publication_year=2023&pages=90-107&pmid=37121432&doi=10.1016/j.kint.2023.04.005&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B13"> <span class="label">13.</span><cite>Evans RG. Maybe the various forms of kidney disease are not so mechanistically different? Kidney Int. 2023;104(1):31–33. doi: 10.1016/j.kint.2023.04.014.</cite> [<a href="https://doi.org/10.1016/j.kint.2023.04.014" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/37349058/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Kidney%20Int&title=Maybe%20the%20various%20forms%20of%20kidney%20disease%20are%20not%20so%20mechanistically%20different?&author=RG%20Evans&volume=104&issue=1&publication_year=2023&pages=31-33&pmid=37349058&doi=10.1016/j.kint.2023.04.014&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B14"> <span class="label">14.</span><cite>Hato T, et al. Endotoxin preconditioning reprograms s1 tubules and macrophages to protect the kidney. J Am Soc Nephrol. 2018;29(1):104–117. doi: 10.1681/ASN.2017060624.</cite> [<a href="https://doi.org/10.1681/ASN.2017060624" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5748923/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/29018138/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Am%20Soc%20Nephrol&title=Endotoxin%20preconditioning%20reprograms%20s1%20tubules%20and%20macrophages%20to%20protect%20the%20kidney&author=T%20Hato&volume=29&issue=1&publication_year=2018&pages=104-117&pmid=29018138&doi=10.1681/ASN.2017060624&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B15"> <span class="label">15.</span><cite>Melis N, et al. Targeting eIF5A hypusination prevents anoxic cell death through mitochondrial silencing and improves kidney transplant outcome. J Am Soc Nephrol. 2017;28(3):811–822. doi: 10.1681/ASN.2016010012.</cite> [<a href="https://doi.org/10.1681/ASN.2016010012" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5328152/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/27612998/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Am%20Soc%20Nephrol&title=Targeting%20eIF5A%20hypusination%20prevents%20anoxic%20cell%20death%20through%20mitochondrial%20silencing%20and%20improves%20kidney%20transplant%20outcome&author=N%20Melis&volume=28&issue=3&publication_year=2017&pages=811-822&pmid=27612998&doi=10.1681/ASN.2016010012&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B16"> <span class="label">16.</span><cite>Giraud S, et al. The inhibition of eIF5A hypusination by GC7, a preconditioning protocol to prevent brain death-induced renal injuries in a preclinical porcine kidney transplantation model. Am J Transplant. 2020;20(12):3326–3340. doi: 10.1111/ajt.15994.</cite> [<a href="https://doi.org/10.1111/ajt.15994" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32400964/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Am%20J%20Transplant&title=The%20inhibition%20of%20eIF5A%20hypusination%20by%20GC7,%20a%20preconditioning%20protocol%20to%20prevent%20brain%20death-induced%20renal%20injuries%20in%20a%20preclinical%20porcine%20kidney%20transplantation%20model&author=S%20Giraud&volume=20&issue=12&publication_year=2020&pages=3326-3340&pmid=32400964&doi=10.1111/ajt.15994&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B17"> <span class="label">17.</span><cite>Zahedi K, et al. The role of spermidine/spermine N1-acetyltransferase in endotoxin-induced acute kidney injury. Am J Physiol Cell Physiol. 2010;299(1):C164–C174. doi: 10.1152/ajpcell.00512.2009.</cite> [<a href="https://doi.org/10.1152/ajpcell.00512.2009" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2904252/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/20392931/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Am%20J%20Physiol%20Cell%20Physiol&title=The%20role%20of%20spermidine/spermine%20N1-acetyltransferase%20in%20endotoxin-induced%20acute%20kidney%20injury&author=K%20Zahedi&volume=299&issue=1&publication_year=2010&pages=C164-C174&pmid=20392931&doi=10.1152/ajpcell.00512.2009&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B18"> <span class="label">18.</span><cite>Zahedi K, et al. Polyamine catabolism in acute kidney injury. Int J Mol Sci. 2019;20(19):4790. doi: 10.3390/ijms20194790.</cite> [<a href="https://doi.org/10.3390/ijms20194790" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6801762/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/31561575/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Int%20J%20Mol%20Sci&title=Polyamine%20catabolism%20in%20acute%20kidney%20injury&author=K%20Zahedi&volume=20&issue=19&publication_year=2019&pages=4790&pmid=31561575&doi=10.3390/ijms20194790&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B19"> <span class="label">19.</span><cite>Zhu S, et al. Spermine protects mice against lethal sepsis partly by attenuating surrogate inflammatory markers. Mol Med. 2009;15(7–8):275–282. doi: 10.2119/molmed.2009.00062.</cite> [<a href="https://doi.org/10.2119/molmed.2009.00062" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2707519/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19593412/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Mol%20Med&title=Spermine%20protects%20mice%20against%20lethal%20sepsis%20partly%20by%20attenuating%20surrogate%20inflammatory%20markers&author=S%20Zhu&volume=15&issue=7%E2%80%938&publication_year=2009&pages=275-282&pmid=19593412&doi=10.2119/molmed.2009.00062&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B20"> <span class="label">20.</span><cite>Liang W, et al. A reciprocal regulation of spermidine and autophagy in podocytes maintains the filtration barrier. Kidney Int. 2020;98(6):1434–1448. doi: 10.1016/j.kint.2020.06.016.</cite> [<a href="https://doi.org/10.1016/j.kint.2020.06.016" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32603735/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Kidney%20Int&title=A%20reciprocal%20regulation%20of%20spermidine%20and%20autophagy%20in%20podocytes%20maintains%20the%20filtration%20barrier&author=W%20Liang&volume=98&issue=6&publication_year=2020&pages=1434-1448&pmid=32603735&doi=10.1016/j.kint.2020.06.016&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B21"> <span class="label">21.</span><cite>Li X, et al. Spermidine protects against acute kidney injury by modulating macrophage NLRP3 inflammasome activation and mitochondrial respiration in an eIF5A hypusination-related pathway. Mol Med. 2022;28(1):103. doi: 10.1186/s10020-022-00533-1.</cite> [<a href="https://doi.org/10.1186/s10020-022-00533-1" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC9441050/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/36058905/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Mol%20Med&title=Spermidine%20protects%20against%20acute%20kidney%20injury%20by%20modulating%20macrophage%20NLRP3%20inflammasome%20activation%20and%20mitochondrial%20respiration%20in%20an%20eIF5A%20hypusination-related%20pathway&author=X%20Li&volume=28&issue=1&publication_year=2022&pages=103&pmid=36058905&doi=10.1186/s10020-022-00533-1&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B22"> <span class="label">22.</span><cite>Kahana C. The antizyme family for regulating polyamines. J Biol Chem. 2018;293(48):18730–18735. doi: 10.1074/jbc.TM118.003339.</cite> [<a href="https://doi.org/10.1074/jbc.TM118.003339" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6290168/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30355739/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Biol%20Chem&title=The%20antizyme%20family%20for%20regulating%20polyamines&author=C%20Kahana&volume=293&issue=48&publication_year=2018&pages=18730-18735&pmid=30355739&doi=10.1074/jbc.TM118.003339&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B23"> <span class="label">23.</span><cite>Chen L, et al. Recoding RNA editing of AZIN1 predisposes to hepatocellular carcinoma. Nat Med. 2013;19(2):209–216. doi: 10.1038/nm.3043.</cite> [<a href="https://doi.org/10.1038/nm.3043" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3783260/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23291631/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Med&title=Recoding%20RNA%20editing%20of%20AZIN1%20predisposes%20to%20hepatocellular%20carcinoma&author=L%20Chen&volume=19&issue=2&publication_year=2013&pages=209-216&pmid=23291631&doi=10.1038/nm.3043&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B24"> <span class="label">24.</span><cite>Shigeyasu K, et al. AZIN1 RNA editing confers cancer stemness and enhances oncogenic potential in colorectal cancer. JCI Insight. 2018;3(12):e99976. doi: 10.1172/jci.insight.99976.</cite> [<a href="https://doi.org/10.1172/jci.insight.99976" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6124399/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/29925690/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=JCI%20Insight&title=AZIN1%20RNA%20editing%20confers%20cancer%20stemness%20and%20enhances%20oncogenic%20potential%20in%20colorectal%20cancer&author=K%20Shigeyasu&volume=3&issue=12&publication_year=2018&pages=e99976&pmid=29925690&doi=10.1172/jci.insight.99976&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B25"> <span class="label">25.</span><cite>Ghalali A, et al. AZIN1 RNA editing alters protein interactions, leading to nuclear translocation and worse outcomes in prostate cancer. Exp Mol Med. 2022;54(10):1713–1726. doi: 10.1038/s12276-022-00845-6.</cite> [<a href="https://doi.org/10.1038/s12276-022-00845-6" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC9636422/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/36202978/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Exp%20Mol%20Med&title=AZIN1%20RNA%20editing%20alters%20protein%20interactions,%20leading%20to%20nuclear%20translocation%20and%20worse%20outcomes%20in%20prostate%20cancer&author=A%20Ghalali&volume=54&issue=10&publication_year=2022&pages=1713-1726&pmid=36202978&doi=10.1038/s12276-022-00845-6&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B26"> <span class="label">26.</span><cite>Qin YR, et al. Adenosine-to-inosine RNA editing mediated by ADARs in esophageal squamous cell carcinoma. Cancer Res. 2014;74(3):840–851. doi: 10.1158/0008-5472.CAN-13-2545.</cite> [<a href="https://doi.org/10.1158/0008-5472.CAN-13-2545" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/24302582/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cancer%20Res&title=Adenosine-to-inosine%20RNA%20editing%20mediated%20by%20ADARs%20in%20esophageal%20squamous%20cell%20carcinoma&author=YR%20Qin&volume=74&issue=3&publication_year=2014&pages=840-851&pmid=24302582&doi=10.1158/0008-5472.CAN-13-2545&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B27"> <span class="label">27.</span><cite>Wang F, et al. A comprehensive RNA editome reveals that edited Azin1 partners with DDX1 to enable hematopoietic stem cell differentiation. Blood. 2021;138(20):1939–1952. doi: 10.1182/blood.2021011314.</cite> [<a href="https://doi.org/10.1182/blood.2021011314" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC8602937/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/34388251/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Blood&title=A%20comprehensive%20RNA%20editome%20reveals%20that%20edited%20Azin1%20partners%20with%20DDX1%20to%20enable%20hematopoietic%20stem%20cell%20differentiation&author=F%20Wang&volume=138&issue=20&publication_year=2021&pages=1939-1952&pmid=34388251&doi=10.1182/blood.2021011314&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B28"> <span class="label">28.</span><cite>Merdler-Rabinowicz R, et al. Elevated A-to-I RNA editing in COVID-19 infected individuals. NAR Genom Bioinform. 2023;5(4):lqad092. doi: 10.1093/nargab/lqad092.</cite> [<a href="https://doi.org/10.1093/nargab/lqad092" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC10583280/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/37859800/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=NAR%20Genom%20Bioinform&title=Elevated%20A-to-I%20RNA%20editing%20in%20COVID-19%20infected%20individuals&author=R%20Merdler-Rabinowicz&volume=5&issue=4&publication_year=2023&pages=lqad092&pmid=37859800&doi=10.1093/nargab/lqad092&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B29"> <span class="label">29.</span><cite>Fox BM, et al. Metabolomics assessment reveals oxidative stress and altered energy production in the heart after ischemic acute kidney injury in mice. Kidney Int. 2019;95(3):590–610. doi: 10.1016/j.kint.2018.10.020.</cite> [<a href="https://doi.org/10.1016/j.kint.2018.10.020" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6564679/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30709662/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Kidney%20Int&title=Metabolomics%20assessment%20reveals%20oxidative%20stress%20and%20altered%20energy%20production%20in%20the%20heart%20after%20ischemic%20acute%20kidney%20injury%20in%20mice&author=BM%20Fox&volume=95&issue=3&publication_year=2019&pages=590-610&pmid=30709662&doi=10.1016/j.kint.2018.10.020&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B30"> <span class="label">30.</span><cite>Cougnon M, et al. Inhibition of eIF5A hypusination reprogrammes metabolism and glucose handling in mouse kidney. Cell Death Dis. 2021;12(4):283. doi: 10.1038/s41419-021-03577-z.</cite> [<a href="https://doi.org/10.1038/s41419-021-03577-z" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7969969/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33731685/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cell%20Death%20Dis&title=Inhibition%20of%20eIF5A%20hypusination%20reprogrammes%20metabolism%20and%20glucose%20handling%20in%20mouse%20kidney&author=M%20Cougnon&volume=12&issue=4&publication_year=2021&pages=283&pmid=33731685&doi=10.1038/s41419-021-03577-z&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B31"> <span class="label">31.</span><cite>Gunnia UB, et al. Successful treatment of lupus nephritis in MRL-lpr/lpr mice by inhibiting ornithine decarboxylase. Kidney Int. 1991;39(5):882–890. doi: 10.1038/ki.1991.111.</cite> [<a href="https://doi.org/10.1038/ki.1991.111" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/2067204/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Kidney%20Int&title=Successful%20treatment%20of%20lupus%20nephritis%20in%20MRL-lpr/lpr%20mice%20by%20inhibiting%20ornithine%20decarboxylase&author=UB%20Gunnia&volume=39&issue=5&publication_year=1991&pages=882-890&pmid=2067204&doi=10.1038/ki.1991.111&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B32"> <span class="label">32.</span><cite>Thomson SC, et al. Ornithine decarboxylase, kidney size, and the tubular hypothesis of glomerular hyperfiltration in experimental diabetes. J Clin Invest. 2001;107(2):217–224. doi: 10.1172/JCI10963.</cite> [<a href="https://doi.org/10.1172/JCI10963" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC199175/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/11160138/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Clin%20Invest&title=Ornithine%20decarboxylase,%20kidney%20size,%20and%20the%20tubular%20hypothesis%20of%20glomerular%20hyperfiltration%20in%20experimental%20diabetes&author=SC%20Thomson&volume=107&issue=2&publication_year=2001&pages=217-224&pmid=11160138&doi=10.1172/JCI10963&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B33"> <span class="label">33.</span><cite>Tran TM, et al. A molecular signature in blood reveals a role for p53 in regulating malaria-induced inflammation. Immunity. 2019;51(4):750–765. doi: 10.1016/j.immuni.2019.08.009.</cite> [<a href="https://doi.org/10.1016/j.immuni.2019.08.009" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7163400/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/31492649/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Immunity&title=A%20molecular%20signature%20in%20blood%20reveals%20a%20role%20for%20p53%20in%20regulating%20malaria-induced%20inflammation&author=TM%20Tran&volume=51&issue=4&publication_year=2019&pages=750-765&pmid=31492649&doi=10.1016/j.immuni.2019.08.009&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B34"> <span class="label">34.</span><cite>Picardi E, et al. REDIportal: a comprehensive database of A-to-I RNA editing events in humans. Nucleic Acids Res. 2017;45(d1):D750–D757. doi: 10.1093/nar/gkw767.</cite> [<a href="https://doi.org/10.1093/nar/gkw767" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5210607/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/27587585/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nucleic%20Acids%20Res&title=REDIportal:%20a%20comprehensive%20database%20of%20A-to-I%20RNA%20editing%20events%20in%20humans&author=E%20Picardi&volume=45&issue=d1&publication_year=2017&pages=D750-D757&pmid=27587585&doi=10.1093/nar/gkw767&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B35"> <span class="label">35.</span><cite>Lake BB, et al. An atlas of healthy and injured cell states and niches in the human kidney. Nature. 2023;619(7970):585–594. doi: 10.1038/s41586-023-05769-3.</cite> [<a href="https://doi.org/10.1038/s41586-023-05769-3" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC10356613/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/37468583/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nature&title=An%20atlas%20of%20healthy%20and%20injured%20cell%20states%20and%20niches%20in%20the%20human%20kidney&author=BB%20Lake&volume=619&issue=7970&publication_year=2023&pages=585-594&pmid=37468583&doi=10.1038/s41586-023-05769-3&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B36"> <span class="label">36.</span><cite>Hansen J, et al. A reference tissue atlas for the human kidney. Sci Adv. 2022;8(23):eabn4965. doi: 10.1126/sciadv.abn4965.</cite> [<a href="https://doi.org/10.1126/sciadv.abn4965" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC9176741/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/35675394/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Sci%20Adv&title=A%20reference%20tissue%20atlas%20for%20the%20human%20kidney&author=J%20Hansen&volume=8&issue=23&publication_year=2022&pages=eabn4965&pmid=35675394&doi=10.1126/sciadv.abn4965&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B37"> <span class="label">37.</span><cite>Hale BG. Antiviral immunity triggered by infection-induced host transposable elements. Curr Opin Virol. 2022;52:211–216. doi: 10.1016/j.coviro.2021.12.006.</cite> [<a href="https://doi.org/10.1016/j.coviro.2021.12.006" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/34959082/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Curr%20Opin%20Virol&title=Antiviral%20immunity%20triggered%20by%20infection-induced%20host%20transposable%20elements&author=BG%20Hale&volume=52&publication_year=2022&pages=211-216&pmid=34959082&doi=10.1016/j.coviro.2021.12.006&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B38"> <span class="label">38.</span><cite>Dhir A, et al. Mitochondrial double-stranded RNA triggers antiviral signalling in humans. Nature. 2018;560(7717):238–242. doi: 10.1038/s41586-018-0363-0.</cite> [<a href="https://doi.org/10.1038/s41586-018-0363-0" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6570621/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30046113/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nature&title=Mitochondrial%20double-stranded%20RNA%20triggers%20antiviral%20signalling%20in%20humans&author=A%20Dhir&volume=560&issue=7717&publication_year=2018&pages=238-242&pmid=30046113&doi=10.1038/s41586-018-0363-0&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B39"> <span class="label">39.</span><cite>Hato T, et al. Bacterial sepsis triggers an antiviral response that causes translation shutdown. J Clin Invest. 2019;129(1):296–309. doi: 10.1172/JCI123284.</cite> [<a href="https://doi.org/10.1172/JCI123284" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6307966/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30507610/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Clin%20Invest&title=Bacterial%20sepsis%20triggers%20an%20antiviral%20response%20that%20causes%20translation%20shutdown&author=T%20Hato&volume=129&issue=1&publication_year=2019&pages=296-309&pmid=30507610&doi=10.1172/JCI123284&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B40"> <span class="label">40.</span><cite>Janosevic D, et al. The orchestrated cellular and molecular responses of the kidney to endotoxin define a precise sepsis timeline. Elife. 2021;10:e62270. doi: 10.7554/eLife.62270.</cite> [<a href="https://doi.org/10.7554/eLife.62270" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7810465/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33448928/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Elife&title=The%20orchestrated%20cellular%20and%20molecular%20responses%20of%20the%20kidney%20to%20endotoxin%20define%20a%20precise%20sepsis%20timeline&author=D%20Janosevic&volume=10&publication_year=2021&pages=e62270&pmid=33448928&doi=10.7554/eLife.62270&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B41"> <span class="label">41.</span><cite>Kidwell A, et al. Translation rescue by targeting Ppp1r15a through its upstream open reading frame in sepsis-induced acute kidney injury in a murine model. J Am Soc Nephrol. 2023;34(2):220–240. doi: 10.1681/ASN.2022060644.</cite> [<a href="https://doi.org/10.1681/ASN.2022060644" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC10103092/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/36283811/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Am%20Soc%20Nephrol&title=Translation%20rescue%20by%20targeting%20Ppp1r15a%20through%20its%20upstream%20open%20reading%20frame%20in%20sepsis-induced%20acute%20kidney%20injury%20in%20a%20murine%20model&author=A%20Kidwell&volume=34&issue=2&publication_year=2023&pages=220-240&pmid=36283811&doi=10.1681/ASN.2022060644&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B42"> <span class="label">42.</span><cite>Li L, et al. p53 regulation of ammonia metabolism through urea cycle controls polyamine biosynthesis. Nature. 2019;567(7747):253–256. doi: 10.1038/s41586-019-0996-7.</cite> [<a href="https://doi.org/10.1038/s41586-019-0996-7" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30842655/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nature&title=p53%20regulation%20of%20ammonia%20metabolism%20through%20urea%20cycle%20controls%20polyamine%20biosynthesis&author=L%20Li&volume=567&issue=7747&publication_year=2019&pages=253-256&pmid=30842655&doi=10.1038/s41586-019-0996-7&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B43"> <span class="label">43.</span><cite>Chen H, et al. Urea cycle activation triggered by host-microbiota maladaptation driving colorectal tumorigenesis. Cell Metab. 2023;35(4):651–666. doi: 10.1016/j.cmet.2023.03.003.</cite> [<a href="https://doi.org/10.1016/j.cmet.2023.03.003" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/36963394/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cell%20Metab&title=Urea%20cycle%20activation%20triggered%20by%20host-microbiota%20maladaptation%20driving%20colorectal%20tumorigenesis&author=H%20Chen&volume=35&issue=4&publication_year=2023&pages=651-666&pmid=36963394&doi=10.1016/j.cmet.2023.03.003&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B44"> <span class="label">44.</span><cite>Penttinen P, et al. Diet-derived polyphenol metabolite enterolactone is a tissue-specific estrogen receptor activator. Endocrinology. 2007;148(10):4875–4886. doi: 10.1210/en.2007-0289.</cite> [<a href="https://doi.org/10.1210/en.2007-0289" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/17628008/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Endocrinology&title=Diet-derived%20polyphenol%20metabolite%20enterolactone%20is%20a%20tissue-specific%20estrogen%20receptor%20activator&author=P%20Penttinen&volume=148&issue=10&publication_year=2007&pages=4875-4886&pmid=17628008&doi=10.1210/en.2007-0289&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B45"> <span class="label">45.</span><cite>Asplin I, et al. chiro-inositol deficiency and insulin resistance: a comparison of the chiro-inositol- and the myo-inositol-containing insulin mediators isolated from urine, hemodialysate, and muscle of control and type II diabetic subjects. Proc Natl Acad Sci U S A. 1993;90(13):5924–5928. doi: 10.1073/pnas.90.13.5924.</cite> [<a href="https://doi.org/10.1073/pnas.90.13.5924" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC46839/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/8392181/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Proc%20Natl%20Acad%20Sci%20U%20S%20A&title=chiro-inositol%20deficiency%20and%20insulin%20resistance:%20a%20comparison%20of%20the%20chiro-inositol-%20and%20the%20myo-inositol-containing%20insulin%20mediators%20isolated%20from%20urine,%20hemodialysate,%20and%20muscle%20of%20control%20and%20type%20II%20diabetic%20subjects&author=I%20Asplin&volume=90&issue=13&publication_year=1993&pages=5924-5928&pmid=8392181&doi=10.1073/pnas.90.13.5924&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B46"> <span class="label">46.</span><cite>McLean P, et al. Reciprocal control of pyruvate dehydrogenase kinase and phosphatase by inositol phosphoglycans. Dynamic state set by “push-pull” system. J Biol Chem. 2008;283(48):33428–33436. doi: 10.1074/jbc.M801781200.</cite> [<a href="https://doi.org/10.1074/jbc.M801781200" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2662268/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/18768479/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Biol%20Chem&title=Reciprocal%20control%20of%20pyruvate%20dehydrogenase%20kinase%20and%20phosphatase%20by%20inositol%20phosphoglycans.%20Dynamic%20state%20set%20by%20%E2%80%9Cpush-pull%E2%80%9D%20system&author=P%20McLean&volume=283&issue=48&publication_year=2008&pages=33428-33436&pmid=18768479&doi=10.1074/jbc.M801781200&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B47"> <span class="label">47.</span><cite>Kiani AK, et al. From Myo-inositol to D-chiro-inositol molecular pathways. Eur Rev Med Pharmacol Sci. 2021;25(5):2390–2402. doi: 10.26355/eurrev_202103_25279.</cite> [<a href="https://doi.org/10.26355/eurrev_202103_25279" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33755975/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Eur%20Rev%20Med%20Pharmacol%20Sci&title=From%20Myo-inositol%20to%20D-chiro-inositol%20molecular%20pathways&author=AK%20Kiani&volume=25&issue=5&publication_year=2021&pages=2390-2402&pmid=33755975&doi=10.26355/eurrev_202103_25279&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B48"> <span class="label">48.</span><cite>Jeon JH, et al. Loss of metabolic flexibility as a result of overexpression of pyruvate dehydrogenase kinases in muscle, liver and the immune system: therapeutic targets in metabolic diseases. J Diabetes Investig. 2021;12(1):21–31. doi: 10.1111/jdi.13345.</cite> [<a href="https://doi.org/10.1111/jdi.13345" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7779278/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32628351/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Diabetes%20Investig&title=Loss%20of%20metabolic%20flexibility%20as%20a%20result%20of%20overexpression%20of%20pyruvate%20dehydrogenase%20kinases%20in%20muscle,%20liver%20and%20the%20immune%20system:%20therapeutic%20targets%20in%20metabolic%20diseases&author=JH%20Jeon&volume=12&issue=1&publication_year=2021&pages=21-31&pmid=32628351&doi=10.1111/jdi.13345&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B49"> <span class="label">49.</span><cite>Maianti JP, et al. Anti-diabetic activity of insulin-degrading enzyme inhibitors mediated by multiple hormones. Nature. 2014;511(7507):94–98. doi: 10.1038/nature13297.</cite> [<a href="https://doi.org/10.1038/nature13297" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4142213/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/24847884/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nature&title=Anti-diabetic%20activity%20of%20insulin-degrading%20enzyme%20inhibitors%20mediated%20by%20multiple%20hormones&author=JP%20Maianti&volume=511&issue=7507&publication_year=2014&pages=94-98&pmid=24847884&doi=10.1038/nature13297&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B50"> <span class="label">50.</span><cite>Gonzalez-Casimiro CM, et al. Modulation of insulin sensitivity by insulin-degrading enzyme. Biomedicines. 2021;9(1):86. doi: 10.3390/biomedicines9010086.</cite> [<a href="https://doi.org/10.3390/biomedicines9010086" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7830943/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33477364/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Biomedicines&title=Modulation%20of%20insulin%20sensitivity%20by%20insulin-degrading%20enzyme&author=CM%20Gonzalez-Casimiro&volume=9&issue=1&publication_year=2021&pages=86&pmid=33477364&doi=10.3390/biomedicines9010086&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B51"> <span class="label">51.</span><cite>Lesire L, et al. Insulin-degrading enzyme, an under-estimated potential target to treat cancer? Cells. 2022;11(7):1228. doi: 10.3390/cells11071228.</cite> [<a href="https://doi.org/10.3390/cells11071228" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC8998118/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/35406791/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cells&title=Insulin-degrading%20enzyme,%20an%20under-estimated%20potential%20target%20to%20treat%20cancer?&author=L%20Lesire&volume=11&issue=7&publication_year=2022&pages=1228&pmid=35406791&doi=10.3390/cells11071228&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B52"> <span class="label">52.</span><cite>Ralto KM, et al. NAD+ homeostasis in renal health and disease. Nat Rev Nephrol. 2020;16(2):99–111. doi: 10.1038/s41581-019-0216-6.</cite> [<a href="https://doi.org/10.1038/s41581-019-0216-6" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7223841/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/31673160/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Rev%20Nephrol&title=NAD+%20homeostasis%20in%20renal%20health%20and%20disease&author=KM%20Ralto&volume=16&issue=2&publication_year=2020&pages=99-111&pmid=31673160&doi=10.1038/s41581-019-0216-6&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B53"> <span class="label">53.</span><cite>Steinberg GR, Hardie DG. New insights into activation and function of the AMPK. Nat Rev Mol Cell Biol. 2023;24(4):255–272. doi: 10.1038/s41580-022-00547-x.</cite> [<a href="https://doi.org/10.1038/s41580-022-00547-x" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/36316383/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Rev%20Mol%20Cell%20Biol&title=New%20insights%20into%20activation%20and%20function%20of%20the%20AMPK&author=GR%20Steinberg&author=DG%20Hardie&volume=24&issue=4&publication_year=2023&pages=255-272&pmid=36316383&doi=10.1038/s41580-022-00547-x&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B54"> <span class="label">54.</span><cite>Reich DP, Bass BL. Mapping the dsRNA world. Cold Spring Harb Perspect Biol. 2019;11(3):a035352. doi: 10.1101/cshperspect.a035352.</cite> [<a href="https://doi.org/10.1101/cshperspect.a035352" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6396333/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/30824577/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cold%20Spring%20Harb%20Perspect%20Biol&title=Mapping%20the%20dsRNA%20world&author=DP%20Reich&author=BL%20Bass&volume=11&issue=3&publication_year=2019&pages=a035352&pmid=30824577&doi=10.1101/cshperspect.a035352&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B55"> <span class="label">55.</span><cite>Bannert N, Kurth R. Retroelements and the human genome: new perspectives on an old relation. Proc Natl Acad Sci U S A. 2004;101(suppl 2):14572–14579. doi: 10.1073/pnas.0404838101.</cite> [<a href="https://doi.org/10.1073/pnas.0404838101" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC521986/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/15310846/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Proc%20Natl%20Acad%20Sci%20U%20S%20A&title=Retroelements%20and%20the%20human%20genome:%20new%20perspectives%20on%20an%20old%20relation&author=N%20Bannert&author=R%20Kurth&volume=101&issue=suppl%202&publication_year=2004&pages=14572-14579&pmid=15310846&doi=10.1073/pnas.0404838101&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B56"> <span class="label">56.</span><cite>Schonborn J, et al. Monoclonal antibodies to double-stranded RNA as probes of RNA structure in crude nucleic acid extracts. Nucleic Acids Res. 1991;19(11):2993–3000. doi: 10.1093/nar/19.11.2993.</cite> [<a href="https://doi.org/10.1093/nar/19.11.2993" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC328262/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/2057357/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nucleic%20Acids%20Res&title=Monoclonal%20antibodies%20to%20double-stranded%20RNA%20as%20probes%20of%20RNA%20structure%20in%20crude%20nucleic%20acid%20extracts&author=J%20Schonborn&volume=19&issue=11&publication_year=1991&pages=2993-3000&pmid=2057357&doi=10.1093/nar/19.11.2993&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B57"> <span class="label">57.</span><cite>Tan-Wong SM, et al. R-loops promote antisense transcription across the mammalian genome. Mol Cell. 2019;76(4):600–616. doi: 10.1016/j.molcel.2019.10.002.</cite> [<a href="https://doi.org/10.1016/j.molcel.2019.10.002" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC6868509/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/31679819/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Mol%20Cell&title=R-loops%20promote%20antisense%20transcription%20across%20the%20mammalian%20genome&author=SM%20Tan-Wong&volume=76&issue=4&publication_year=2019&pages=600-616&pmid=31679819&doi=10.1016/j.molcel.2019.10.002&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B58"> <span class="label">58.</span><cite>Conley AB, et al. Human cis natural antisense transcripts initiated by transposable elements. Trends Genet. 2008;24(2):53–56. doi: 10.1016/j.tig.2007.11.008.</cite> [<a href="https://doi.org/10.1016/j.tig.2007.11.008" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/18192066/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Trends%20Genet&title=Human%20cis%20natural%20antisense%20transcripts%20initiated%20by%20transposable%20elements&author=AB%20Conley&volume=24&issue=2&publication_year=2008&pages=53-56&pmid=18192066&doi=10.1016/j.tig.2007.11.008&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B59"> <span class="label">59.</span><cite>Porath HT, et al. A genome-wide map of hyper-edited RNA reveals numerous new sites. Nat Commun. 2014;5:4726. doi: 10.1038/ncomms5726.</cite> [<a href="https://doi.org/10.1038/ncomms5726" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4365171/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/25158696/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Commun&title=A%20genome-wide%20map%20of%20hyper-edited%20RNA%20reveals%20numerous%20new%20sites&author=HT%20Porath&volume=5&publication_year=2014&pages=4726&pmid=25158696&doi=10.1038/ncomms5726&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B60"> <span class="label">60.</span><cite>Morita Y, et al. Human endonuclease V is a ribonuclease specific for inosine-containing RNA. Nat Commun. 2013;4:2273. doi: 10.1038/ncomms3273.</cite> [<a href="https://doi.org/10.1038/ncomms3273" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3741642/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/23912718/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Commun&title=Human%20endonuclease%20V%20is%20a%20ribonuclease%20specific%20for%20inosine-containing%20RNA&author=Y%20Morita&volume=4&publication_year=2013&pages=2273&pmid=23912718&doi=10.1038/ncomms3273&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B61"> <span class="label">61.</span><cite>Hsiao YE, et al. RNA editing in nascent RNA affects pre-mRNA splicing. Genome Res. 2018;28(6):812–823. doi: 10.1101/gr.231209.117.</cite> [<a href="https://doi.org/10.1101/gr.231209.117" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5991522/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/29724793/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Genome%20Res&title=RNA%20editing%20in%20nascent%20RNA%20affects%20pre-mRNA%20splicing&author=YE%20Hsiao&volume=28&issue=6&publication_year=2018&pages=812-823&pmid=29724793&doi=10.1101/gr.231209.117&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B62"> <span class="label">62.</span><cite>Ramirez-Moya J, et al. An ADAR1-dependent RNA editing event in the cyclin-dependent kinase CDK13 promotes thyroid cancer hallmarks. Mol Cancer. 2021;20(1):115. doi: 10.1186/s12943-021-01401-y.</cite> [<a href="https://doi.org/10.1186/s12943-021-01401-y" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC8424981/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/34496885/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Mol%20Cancer&title=An%20ADAR1-dependent%20RNA%20editing%20event%20in%20the%20cyclin-dependent%20kinase%20CDK13%20promotes%20thyroid%20cancer%20hallmarks&author=J%20Ramirez-Moya&volume=20&issue=1&publication_year=2021&pages=115&pmid=34496885&doi=10.1186/s12943-021-01401-y&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B63"> <span class="label">63.</span><cite>Nishikura K. A-to-I editing of coding and non-coding RNAs by ADARs. Nat Rev Mol Cell Biol. 2016;17(2):83–96. doi: 10.1038/nrm.2015.4.</cite> [<a href="https://doi.org/10.1038/nrm.2015.4" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4824625/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/26648264/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Rev%20Mol%20Cell%20Biol&title=A-to-I%20editing%20of%20coding%20and%20non-coding%20RNAs%20by%20ADARs&author=K%20Nishikura&volume=17&issue=2&publication_year=2016&pages=83-96&pmid=26648264&doi=10.1038/nrm.2015.4&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B64"> <span class="label">64.</span><cite>Shiromoto Y, et al. ADAR1 RNA editing enzyme regulates R-loop formation and genome stability at telomeres in cancer cells. Nat Commun. 2021;12(1):1654. doi: 10.1038/s41467-021-21921-x.</cite> [<a href="https://doi.org/10.1038/s41467-021-21921-x" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7955049/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33712600/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Commun&title=ADAR1%20RNA%20editing%20enzyme%20regulates%20R-loop%20formation%20and%20genome%20stability%20at%20telomeres%20in%20cancer%20cells&author=Y%20Shiromoto&volume=12&issue=1&publication_year=2021&pages=1654&pmid=33712600&doi=10.1038/s41467-021-21921-x&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B65"> <span class="label">65.</span><cite>Chung H, et al. Human ADAR1 prevents endogenous RNA from triggering translational shutdown. Cell. 2018;172(4):811–824. doi: 10.1016/j.cell.2017.12.038.</cite> [<a href="https://doi.org/10.1016/j.cell.2017.12.038" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5831367/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/29395325/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cell&title=Human%20ADAR1%20prevents%20endogenous%20RNA%20from%20triggering%20translational%20shutdown&author=H%20Chung&volume=172&issue=4&publication_year=2018&pages=811-824&pmid=29395325&doi=10.1016/j.cell.2017.12.038&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B66"> <span class="label">66.</span><cite>Li JB, et al. Genome-wide identification of human RNA editing sites by parallel DNA capturing and sequencing. Science. 2009;324(5931):1210–1213. doi: 10.1126/science.1170995.</cite> [<a href="https://doi.org/10.1126/science.1170995" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19478186/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Science&title=Genome-wide%20identification%20of%20human%20RNA%20editing%20sites%20by%20parallel%20DNA%20capturing%20and%20sequencing&author=JB%20Li&volume=324&issue=5931&publication_year=2009&pages=1210-1213&pmid=19478186&doi=10.1126/science.1170995&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B67"> <span class="label">67.</span><cite>Eggington JM, et al. Predicting sites of ADAR editing in double-stranded RNA. Nat Commun. 2011;2:319. doi: 10.1038/ncomms1324.</cite> [<a href="https://doi.org/10.1038/ncomms1324" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3113232/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21587236/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Commun&title=Predicting%20sites%20of%20ADAR%20editing%20in%20double-stranded%20RNA&author=JM%20Eggington&volume=2&publication_year=2011&pages=319&pmid=21587236&doi=10.1038/ncomms1324&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B68"> <span class="label">68.</span><cite>Uzonyi A, et al. Deciphering the principles of the RNA editing code via large-scale systematic probing. Mol Cell. 2021;81(11):2374–2387. doi: 10.1016/j.molcel.2021.03.024.</cite> [<a href="https://doi.org/10.1016/j.molcel.2021.03.024" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33905683/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Mol%20Cell&title=Deciphering%20the%20principles%20of%20the%20RNA%20editing%20code%20via%20large-scale%20systematic%20probing&author=A%20Uzonyi&volume=81&issue=11&publication_year=2021&pages=2374-2387&pmid=33905683&doi=10.1016/j.molcel.2021.03.024&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B69"> <span class="label">69.</span><cite>Sun T, et al. Decoupling expression and editing preferences of ADAR1 p150 and p110 isoforms. Proc Natl Acad Sci U S A. 2021;118(12):e2021757118. doi: 10.1073/pnas.2021757118.</cite> [<a href="https://doi.org/10.1073/pnas.2021757118" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC8000508/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33723056/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Proc%20Natl%20Acad%20Sci%20U%20S%20A&title=Decoupling%20expression%20and%20editing%20preferences%20of%20ADAR1%20p150%20and%20p110%20isoforms&author=T%20Sun&volume=118&issue=12&publication_year=2021&pages=e2021757118&pmid=33723056&doi=10.1073/pnas.2021757118&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B70"> <span class="label">70.</span><cite>George CX, et al. Adenosine deaminases acting on RNA, RNA editing, and interferon action. J Interferon Cytokine Res. 2011;31(1):99–117. doi: 10.1089/jir.2010.0097.</cite> [<a href="https://doi.org/10.1089/jir.2010.0097" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3034097/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21182352/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Interferon%20Cytokine%20Res&title=Adenosine%20deaminases%20acting%20on%20RNA,%20RNA%20editing,%20and%20interferon%20action&author=CX%20George&volume=31&issue=1&publication_year=2011&pages=99-117&pmid=21182352&doi=10.1089/jir.2010.0097&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B71"> <span class="label">71.</span><cite>Melo Ferreira R, et al. Integration of spatial and single cell transcriptomics localizes epithelial-immune cross-talk in kidney injury. JCI Insight. 2021;6(12):e147703. doi: 10.1172/jci.insight.147703.</cite> [<a href="https://doi.org/10.1172/jci.insight.147703" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC8262485/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/34003797/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=JCI%20Insight&title=Integration%20of%20spatial%20and%20single%20cell%20transcriptomics%20localizes%20epithelial-immune%20cross-talk%20in%20kidney%20injury&author=R%20Melo%20Ferreira&volume=6&issue=12&publication_year=2021&pages=e147703&pmid=34003797&doi=10.1172/jci.insight.147703&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B72"> <span class="label">72.</span><cite>Kalakeche R, et al. Endotoxin uptake by S1 proximal tubular segment causes oxidative stress in the downstream S2 segment. J Am Soc Nephrol. 2011;22(8):1505–1516. doi: 10.1681/ASN.2011020203.</cite> [<a href="https://doi.org/10.1681/ASN.2011020203" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC3148705/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/21784899/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Am%20Soc%20Nephrol&title=Endotoxin%20uptake%20by%20S1%20proximal%20tubular%20segment%20causes%20oxidative%20stress%20in%20the%20downstream%20S2%20segment&author=R%20Kalakeche&volume=22&issue=8&publication_year=2011&pages=1505-1516&pmid=21784899&doi=10.1681/ASN.2011020203&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B73"> <span class="label">73.</span><cite>Hato T, et al. The macrophage mediates the renoprotective effects of endotoxin preconditioning. J Am Soc Nephrol. 2015;26(6):1347–1362. doi: 10.1681/ASN.2014060561.</cite> [<a href="https://doi.org/10.1681/ASN.2014060561" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4446880/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/25398784/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Am%20Soc%20Nephrol&title=The%20macrophage%20mediates%20the%20renoprotective%20effects%20of%20endotoxin%20preconditioning&author=T%20Hato&volume=26&issue=6&publication_year=2015&pages=1347-1362&pmid=25398784&doi=10.1681/ASN.2014060561&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B74"> <span class="label">74.</span><cite>Hato T, et al. Two-photon intravital fluorescence lifetime imaging of the kidney reveals cell-type specific metabolic signatures. J Am Soc Nephrol. 2017;28(8):2420–2430. doi: 10.1681/ASN.2016101153.</cite> [<a href="https://doi.org/10.1681/ASN.2016101153" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5533239/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/28250053/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Am%20Soc%20Nephrol&title=Two-photon%20intravital%20fluorescence%20lifetime%20imaging%20of%20the%20kidney%20reveals%20cell-type%20specific%20metabolic%20signatures&author=T%20Hato&volume=28&issue=8&publication_year=2017&pages=2420-2430&pmid=28250053&doi=10.1681/ASN.2016101153&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B75"> <span class="label">75.</span><cite>Zhou J, et al. Unified mouse and human kidney single-cell expression atlas reveal commonalities and differences in disease states. J Am Soc Nephrol. 2023;34(11):1843–1862. doi: 10.1681/ASN.0000000000000217.</cite> [<a href="https://doi.org/10.1681/ASN.0000000000000217" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC10631616/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/37639336/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J%20Am%20Soc%20Nephrol&title=Unified%20mouse%20and%20human%20kidney%20single-cell%20expression%20atlas%20reveal%20commonalities%20and%20differences%20in%20disease%20states&author=J%20Zhou&volume=34&issue=11&publication_year=2023&pages=1843-1862&pmid=37639336&doi=10.1681/ASN.0000000000000217&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B76"> <span class="label">76.</span><cite>Riella CV, et al. ADAR regulates APOL1 via A-to-I RNA editing by inhibition of MDA5 activation in a paradoxical biological circuit. Proc Natl Acad Sci U S A. 2022;119(44):e2210150119. doi: 10.1073/pnas.2210150119.</cite> [<a href="https://doi.org/10.1073/pnas.2210150119" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC9636950/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/36282916/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Proc%20Natl%20Acad%20Sci%20U%20S%20A&title=ADAR%20regulates%20APOL1%20via%20A-to-I%20RNA%20editing%20by%20inhibition%20of%20MDA5%20activation%20in%20a%20paradoxical%20biological%20circuit&author=CV%20Riella&volume=119&issue=44&publication_year=2022&pages=e2210150119&pmid=36282916&doi=10.1073/pnas.2210150119&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B77"> <span class="label">77.</span><cite>Lenharo M. Move over, CRISPR: RNA-editing therapies pick up steam. Nature. 2024;626(8001):933–934. doi: 10.1038/d41586-024-00275-6.</cite> [<a href="https://doi.org/10.1038/d41586-024-00275-6" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/38366220/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nature&title=Move%20over,%20CRISPR:%20RNA-editing%20therapies%20pick%20up%20steam&author=M%20Lenharo&volume=626&issue=8001&publication_year=2024&pages=933-934&pmid=38366220&doi=10.1038/d41586-024-00275-6&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B78"> <span class="label">78.</span><cite>Booth BJ, et al. RNA editing: expanding the potential of RNA therapeutics. Mol Ther. 2023;31(6):1533–1549. doi: 10.1016/j.ymthe.2023.01.005.</cite> [<a href="https://doi.org/10.1016/j.ymthe.2023.01.005" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC9824937/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/36620962/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Mol%20Ther&title=RNA%20editing:%20expanding%20the%20potential%20of%20RNA%20therapeutics&author=BJ%20Booth&volume=31&issue=6&publication_year=2023&pages=1533-1549&pmid=36620962&doi=10.1016/j.ymthe.2023.01.005&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B79"> <span class="label">79.</span><cite>Eadon MT, et al. Kidney histopathology and prediction of kidney failure: a retrospective cohort study. Am J Kidney Dis. 2020;76(3):350–360. doi: 10.1053/j.ajkd.2019.12.014.</cite> [<a href="https://doi.org/10.1053/j.ajkd.2019.12.014" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7483298/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32336487/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Am%20J%20Kidney%20Dis&title=Kidney%20histopathology%20and%20prediction%20of%20kidney%20failure:%20a%20retrospective%20cohort%20study&author=MT%20Eadon&volume=76&issue=3&publication_year=2020&pages=350-360&pmid=32336487&doi=10.1053/j.ajkd.2019.12.014&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B80"> <span class="label">80.</span><cite>Barwinska D, et al. Molecular characterization of the human kidney interstitium in health and disease. Sci Adv. 2021;7(7):eabd3359. doi: 10.1126/sciadv.abd3359.</cite> [<a href="https://doi.org/10.1126/sciadv.abd3359" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7875540/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33568476/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Sci%20Adv&title=Molecular%20characterization%20of%20the%20human%20kidney%20interstitium%20in%20health%20and%20disease&author=D%20Barwinska&volume=7&issue=7&publication_year=2021&pages=eabd3359&pmid=33568476&doi=10.1126/sciadv.abd3359&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B81"> <span class="label">81.</span><cite>Gao Y, et al. Transcriptome-wide quantification of double-stranded RNAs in live mouse tissues by dsRIP-Seq. STAR Protoc. 2021;2(1):100366. doi: 10.1016/j.xpro.2021.100366.</cite> [<a href="https://doi.org/10.1016/j.xpro.2021.100366" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7982789/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33778776/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=STAR%20Protoc&title=Transcriptome-wide%20quantification%20of%20double-stranded%20RNAs%20in%20live%20mouse%20tissues%20by%20dsRIP-Seq&author=Y%20Gao&volume=2&issue=1&publication_year=2021&pages=100366&pmid=33778776&doi=10.1016/j.xpro.2021.100366&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B82"> <span class="label">82.</span><cite>Lo Giudice C, et al. Investigating RNA editing in deep transcriptome datasets with REDItools and REDIportal. Nat Protoc. 2020;15(3):1098–1131. doi: 10.1038/s41596-019-0279-7.</cite> [<a href="https://doi.org/10.1038/s41596-019-0279-7" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/31996844/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nat%20Protoc&title=Investigating%20RNA%20editing%20in%20deep%20transcriptome%20datasets%20with%20REDItools%20and%20REDIportal&author=C%20Lo%20Giudice&volume=15&issue=3&publication_year=2020&pages=1098-1131&pmid=31996844&doi=10.1038/s41596-019-0279-7&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B83"> <span class="label">83.</span><cite>Danecek P, et al. Twelve years of SAMtools and BCFtools. Gigascience. 2021;10(2):giab008. doi: 10.1093/gigascience/giab008.</cite> [<a href="https://doi.org/10.1093/gigascience/giab008" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7931819/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33590861/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Gigascience&title=Twelve%20years%20of%20SAMtools%20and%20BCFtools&author=P%20Danecek&volume=10&issue=2&publication_year=2021&pages=giab008&pmid=33590861&doi=10.1093/gigascience/giab008&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B84"> <span class="label">84.</span><cite>Smedley D, et al. BioMart--biological queries made easy. BMC Genomics. 2009;10:22. doi: 10.1186/1471-2164-10-22.</cite> [<a href="https://doi.org/10.1186/1471-2164-10-22" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2649164/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/19144180/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=BMC%20Genomics&title=BioMart--biological%20queries%20made%20easy&author=D%20Smedley&volume=10&publication_year=2009&pages=22&pmid=19144180&doi=10.1186/1471-2164-10-22&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B85"> <span class="label">85.</span><cite>Wang K, et al. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010;38(16):e164. doi: 10.1093/nar/gkq603.</cite> [<a href="https://doi.org/10.1093/nar/gkq603" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2938201/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/20601685/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nucleic%20Acids%20Res&title=ANNOVAR:%20functional%20annotation%20of%20genetic%20variants%20from%20high-throughput%20sequencing%20data&author=K%20Wang&volume=38&issue=16&publication_year=2010&pages=e164&pmid=20601685&doi=10.1093/nar/gkq603&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B86"> <span class="label">86.</span><cite>Wu X, Bartel DP. kpLogo: positional k-mer analysis reveals hidden specificity in biological sequences. Nucleic Acids Res. 2017;45(w1):W534–W538. doi: 10.1093/nar/gkx323.</cite> [<a href="https://doi.org/10.1093/nar/gkx323" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC5570168/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/28460012/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nucleic%20Acids%20Res&title=kpLogo:%20positional%20k-mer%20analysis%20reveals%20hidden%20specificity%20in%20biological%20sequences&author=X%20Wu&author=DP%20Bartel&volume=45&issue=w1&publication_year=2017&pages=W534-W538&pmid=28460012&doi=10.1093/nar/gkx323&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B87"> <span class="label">87.</span><cite>Gruber AR, et al. The Vienna RNA websuite. Nucleic Acids Res. 2008;36:W70–W74. doi: 10.1093/nar/gkn188.</cite> [<a href="https://doi.org/10.1093/nar/gkn188" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC2447809/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/18424795/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Nucleic%20Acids%20Res&title=The%20Vienna%20RNA%20websuite&author=AR%20Gruber&volume=36&publication_year=2008&pages=W70-W74&pmid=18424795&doi=10.1093/nar/gkn188&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B88"> <span class="label">88.</span><cite>de Figueiredo TC, et al. HPLC-UV method validation for the identification and quantification of bioactive amines in commercial eggs. Talanta. 2015;142:240–245. doi: 10.1016/j.talanta.2015.04.056.</cite> [<a href="https://doi.org/10.1016/j.talanta.2015.04.056" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/26003718/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Talanta&title=HPLC-UV%20method%20validation%20for%20the%20identification%20and%20quantification%20of%20bioactive%20amines%20in%20commercial%20eggs&author=TC%20de%20Figueiredo&volume=142&publication_year=2015&pages=240-245&pmid=26003718&doi=10.1016/j.talanta.2015.04.056&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="B89"> <span class="label">89.</span><cite>Zwighaft Z, et al. Circadian clock control by polyamine levels through a mechanism that declines with age. Cell Metab. 2015;22(5):874–885. doi: 10.1016/j.cmet.2015.09.011.</cite> [<a href="https://doi.org/10.1016/j.cmet.2015.09.011" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/26456331/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Cell%20Metab&title=Circadian%20clock%20control%20by%20polyamine%20levels%20through%20a%20mechanism%20that%20declines%20with%20age&author=Z%20Zwighaft&volume=22&issue=5&publication_year=2015&pages=874-885&pmid=26456331&doi=10.1016/j.cmet.2015.09.011&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> </ul></section></section><section id="_ad93_" lang="en" class="associated-data"><h2 class="pmc_sec_title">Associated Data</h2> <p class="font-secondary"><em>This section collects any data citations, data availability statements, or supplementary materials included in this article.</em></p> <section id="_adsm93_" lang="en" class="supplementary-materials"><h3 class="pmc_sec_title">Supplementary Materials</h3> <section class="sm xbox font-sm" id="db_ds_supplementary-material1_reqid_"><div class="caption p"><span>Supplemental data</span></div> <div class="media p"><div class="caption"> <a href="/articles/instance/11364396/bin/jci-134-180117-s118.pdf" data-ga-action="click_feat_suppl" class="usa-link">jci-134-180117-s118.pdf</a><sup> (88.9MB, pdf) </sup> </div></div></section><section class="sm xbox font-sm" id="db_ds_supplementary-material2_reqid_"><div class="caption p"><span>Unedited blot and gel images</span></div> <div class="media p"><div class="caption"> <a href="/articles/instance/11364396/bin/jci-134-180117-s119.pdf" data-ga-action="click_feat_suppl" class="usa-link">jci-134-180117-s119.pdf</a><sup> (7.1MB, pdf) </sup> </div></div></section><section class="sm xbox font-sm" id="db_ds_supplementary-material3_reqid_"><div class="caption p"><span>Supporting data values</span></div> <div class="media p"><div class="caption"> <a href="/articles/instance/11364396/bin/jci-134-180117-s120.xlsx" data-ga-action="click_feat_suppl" class="usa-link">jci-134-180117-s120.xlsx</a><sup> (232.2KB, xlsx) </sup> </div></div></section></section><section id="_adda93_" lang="en" class="data-availability-statement"><h3 class="pmc_sec_title">Data Availability Statement</h3> <p>RNA-Seq data were deposited in the NCBI’s GEO database:</p> <p>Human kidney biopsy RNA sequencing data are available at <a href="https://connect.posit.iu.edu/bulk_kidney_bx/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/bulk_kidney_bx/</a></p> <p>For dsRNA IP sequencing (LPS time course), see <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE244941" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE244941</a>. Representative read coverage tracks for the cytoplasmic fraction are available on a genome browser at <a href="https://connect.posit.iu.edu/view_GY/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/view_GY/</a></p> <p>For bulk kidney total RNA-Seq data for wild-type mice after LPS challenge (LPS time course), see <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE247727" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE247727</a>.</p> <p>For bulk kidney total RNA-Seq data for wild-type mice after ischemia/reperfusion injury (IRI) (IRI time course), see GSE267650 (reviewer token: mdynmimctbahrcn). Data are available at <a href="https://connect.posit.iu.edu/IRI_timecourse_WT/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/IRI_timecourse_WT/</a></p> <p>For bulk kidney total RNA-Seq data for Azin1-locked and uneditable mice (IRI time course), see <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE253286" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE253286</a> for baseline and 24 hours and GSE267650 for 48 and 72 hours (reviewer token: mdynmimctbahrcn). Azin1 mouse kidney RNA-Seq data for baseline and 24 hours after IRI are available at <a href="https://connect.posit.iu.edu/azin1_mouse_kidney/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/azin1_mouse_kidney/</a></p> <p>For mouse kidney nanopore PCR-free direct cDNA sequencing (LPS time course), see GSE244942 (reviewer token: otinkqkqdjypbav).</p> <p>AZIN1 cell line RNA-Seq data are available at <a href="https://connect.posit.iu.edu/azin1/" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://connect.posit.iu.edu/azin1/</a></p> <p>Proteomics data are deposited in ProteomeXchange (accession MSV000093887; ID: MSV000093887_reviewer; password: Azin).</p> <p>Reanalysis of Ribo-Seq and single-cell RNA-Seq was performed using <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE120877" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE120877</a> and <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE151658" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">GSE151658</a>. A <a href="#sd" class="usa-link">Supporting Data Values</a> file is provided as supplemental material.</p></section></section></section><footer class="p courtesy-note font-secondary font-sm text-center"><hr class="headless"> <p>Articles from The Journal of Clinical Investigation are provided here courtesy of <strong>American Society for Clinical Investigation</strong></p></footer></section></article> </main> </div> </div> </div>  <div class="pmc-sidenav desktop:grid-col-4 display-flex"> <section class="pmc-sidenav__container" aria-label="Article resources and navigation"> <button type="button" class="usa-button pmc-sidenav__container__close usa-button--unstyled"> <img src="/static/img/usa-icons/close.svg" role="img" alt="Close" /> </button> <div class="display-none desktop:display-block"> <section class="margin-top-4 desktop:margin-top-0"> <h2 class="margin-top-0">ACTIONS</h2> <ul class="usa-list usa-list--unstyled usa-list--actions"> <li> <a href="https://doi.org/10.1172/JCI180117" class="usa-button usa-button--outline width-24 font-xs usa-link--external padding-left-0 padding-right-0" target="_blank" rel="noreferrer noopener" data-ga-category="actions" data-ga-action="click" data-ga-label="publisher_link_desktop" > <span class="height-3 display-inline-flex flex-align-center">View on publisher site</span> </a> </li> <li> <a href="pdf/jci-134-180117.pdf" class="usa-button usa-button--outline width-24 display-inline-flex flex-align-center flex-justify-start padding-left-1" data-ga-category="actions" data-ga-action="click" data-ga-label="pdf_download_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1">PDF (10.1 MB)</span> </a> </li> <li> <button role="button" class="usa-button width-24 citation-dialog-trigger display-inline-flex flex-align-center flex-justify-start padding-left-1" aria-label="Open dialog with citation text in different styles" data-ga-category="actions" data-ga-action="open" data-ga-label="cite_desktop" data-all-citations-url="/resources/citations/11364396/" data-citation-style="nlm" data-download-format-link="/resources/citations/11364396/export/" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#format_quote"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 button-label">Cite</span> </button> </li> <li> <button class="usa-button width-24 collections-dialog-trigger collections-button display-inline-flex flex-align-center flex-justify-start padding-left-1 collections-button-empty" aria-label="Save article in MyNCBI collections." data-ga-category="actions" data-ga-action="click" data-ga-label="collections_button_desktop" data-collections-open-dialog-enabled="false" data-collections-open-dialog-url="https://account.ncbi.nlm.nih.gov/?back_url=https%3A%2F%2Fpmc.ncbi.nlm.nih.gov%2Farticles%2FPMC11364396%2F%23open-collections-dialog" data-in-collections="false"> <svg class="usa-icon width-3 height-3 usa-icon--bookmark-full" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-full.svg#icon"></use> </svg> <svg class="usa-icon width-3 height-3 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-empty.svg#icon"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1">Collections</span> </button> </li> <li class="pmc-permalink"> <button type="button" class="usa-button usa-button--outline width-24 display-inline-flex flex-align-center flex-justify padding-left-1 shadow-none" aria-label="Show article permalink" aria-expanded="false" aria-haspopup="true" data-ga-category="actions" data-ga-action="open" data-ga-label="permalink_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#share"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 button-label">Permalink</span> </button> <div class="pmc-permalink__dropdown" hidden> <div class="pmc-permalink__dropdown__container"> <h2 class="usa-modal__heading margin-top-0 margin-bottom-2">PERMALINK</h2> <div class="pmc-permalink__dropdown__content"> <input type="text" class="usa-input" value="https://pmc.ncbi.nlm.nih.gov/articles/PMC11364396/" aria-label="Article permalink"> <button class="usa-button display-inline-flex pmc-permalink__dropdown__copy__btn margin-right-0" title="Copy article permalink" data-ga-category="save_share" data-ga-action="link" data-ga-label="copy_link"> <svg class="usa-icon" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span class="margin-left-1">Copy</span> </button> </div> </div> </div> </li> </ul> </section> </div> <section class="pmc-resources margin-top-6 desktop:margin-top-4" data-page-path="/articles/PMC11364396/"> <h2 class="margin-top-0">RESOURCES</h2> <div class="usa-accordion usa-accordion--multiselectable" data-allow-multiple> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-similar-articles" data-ga-category="resources_accordion" data-ga-action="open_similar_articles" data-ga-label="/articles/PMC11364396/" data-action-open="open_similar_articles" data-action-close="close_similar_articles" > Similar articles </button> </h3> <div id="resources-similar-articles" class="usa-accordion__content usa-prose" data-source-url="/resources/similar-article-links/38954486/" > </div> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-cited-by-other-articles" data-ga-category="resources_accordion" data-ga-action="open_cited_by" data-ga-label="/articles/PMC11364396/" data-action-open="open_cited_by" data-action-close="close_cited_by" > Cited by other articles </button> </h3> <div id="resources-cited-by-other-articles" class="usa-accordion__content usa-prose" data-source-url="/resources/cited-by-links/38954486/" > </div> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-links-to-ncbi-databases" data-ga-category="resources_accordion" data-ga-action="open_NCBI_links" data-ga-label="/articles/PMC11364396/" data-action-open="open_NCBI_links" data-action-close="close_NCBI_link" > Links to NCBI Databases </button> </h3> <div id="resources-links-to-ncbi-databases" class="usa-accordion__content usa-prose" data-source-url="/resources/db-links/11364396/" > </div> </div> </section> <section class="usa-in-page-nav usa-in-page-nav--wide margin-top-6 desktop:margin-top-4" data-title-text="On this page" data-title-heading-level="h2" data-scroll-offset="0" data-root-margin="-10% 0px -80% 0px" data-main-content-selector="main" data-threshold="1" hidden ></section> </section> </div> <div class="overlay" role="dialog" aria-label="Citation Dialog" hidden> <div class="dialog citation-dialog" aria-hidden="true"> <div class="display-inline-flex flex-align-center flex-justify width-full margin-bottom-2"> <h2 class="usa-modal__heading margin-0">Cite</h2> <button type="button" class="usa-button usa-button--unstyled close-overlay text-black width-auto" tabindex="1"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#close"></use> </svg> </button> </div> <div class="citation-text-block"> <div class="citation-text margin-bottom-2"></div> <ul class="usa-list usa-list--unstyled display-inline-flex flex-justify width-full flex-align-center"> <li> <button class="usa-button usa-button--unstyled text-no-underline display-flex flex-align-center copy-button dialog-focus" data-ga-category="save_share" data-ga-action="cite" data-ga-label="copy" tabindex="2"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span>Copy</span> </button> </li> <li> <a href="#" role="button" class="usa-button usa-button--unstyled text-no-underline display-flex flex-align-center export-button" data-ga-category="save_share" data-ga-action="cite" data-ga-label="download" title="Download a file for external citation management software" tabindex="3"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> <span class="display-none mobile-lg:display-inline">Download .nbib</span> <span class="display-inline mobile-lg:display-none">.nbib</span> </a> </li> <li> <div class="display-inline-flex flex-align-center"> <label class="usa-label margin-top-0">Format:</label> <select aria-label="Format" class="usa-select citation-style-selector padding-1 margin-top-0 border-0 padding-right-4" tabindex="4" > <option data-style-url-name="ama" value="AMA" > AMA </option> <option data-style-url-name="apa" value="APA" > APA </option> <option data-style-url-name="mla" value="MLA" > MLA </option> <option data-style-url-name="nlm" value="NLM" selected="selected"> NLM </option> </select> </div> </li> </ul> </div> </div> </div> <div class="overlay" role="dialog" hidden> <div id="collections-action-dialog" class="dialog collections-dialog" aria-hidden="true"> <div class="display-inline-flex flex-align-center flex-justify width-full margin-bottom-2"> <h2 class="usa-modal__heading margin-0">Add to Collections</h2> </div> <div class="collections-action-panel action-panel"> <form id="collections-action-dialog-form" class="usa-form maxw-full collections-action-panel-form action-panel-content action-form action-panel-smaller-selectors" data-existing-collections-url="/list-existing-collections/" data-add-to-existing-collection-url="/add-to-existing-collection/" data-create-and-add-to-new-collection-url="/create-and-add-to-new-collection/" data-myncbi-max-collection-name-length="100" data-collections-root-url="https://www.ncbi.nlm.nih.gov/myncbi/collections/"> <input type="hidden" name="csrfmiddlewaretoken" value="9q7ziZYYzwS0jHyJiJwCKgSHFpfcOjfLq0vS5sFge179SzWB75Hmw1B1SMzsEexl"> <fieldset class="usa-fieldset margin-bottom-2"> <div class="usa-radio"> <input type="radio" id="collections-action-dialog-new" class="usa-radio__input usa-radio__input--tile collections-new margin-top-0" name="collections" value="new" data-ga-category="collections_button" data-ga-action="click" data-ga-label="collections_radio_new" /> <label class="usa-radio__label" for="collections-action-dialog-new">Create a new collection</label> </div> <div class="usa-radio"> <input type="radio" id="collections-action-dialog-existing" class="usa-radio__input usa-radio__input--tile collections-existing" name="collections" value="existing" checked="true" data-ga-category="collections_button" data-ga-action="click" data-ga-label="collections_radio_existing" /> <label class="usa-radio__label" for="collections-action-dialog-existing">Add to an existing collection</label> </div> </fieldset> <fieldset class="usa-fieldset margin-bottom-2"> <div class="action-panel-control-wrap new-collections-controls"> <label for="collections-action-dialog-add-to-new" class="usa-label margin-top-0"> Name your collection <abbr title="required" class="usa-hint usa-hint--required text-no-underline">*</abbr> </label> <input type="text" name="add-to-new-collection" id="collections-action-dialog-add-to-new" class="usa-input collections-action-add-to-new" pattern="[^"&=<>/]*" title="The following characters are not allowed in the Name field: "&=<>/" maxlength="" data-ga-category="collections_button" data-ga-action="create_collection" data-ga-label="non_favorties_collection" required /> </div> <div class="action-panel-control-wrap existing-collections-controls"> <label for="collections-action-dialog-add-to-existing" class="usa-label margin-top-0"> Choose a collection </label> <select id="collections-action-dialog-add-to-existing" class="usa-select collections-action-add-to-existing" data-ga-category="collections_button" data-ga-action="select_collection" data-ga-label="($('.collections-action-add-to-existing').val() === 'Favorites') ? 'Favorites' : 'non_favorites_collection'"> </select> <div class="collections-retry-load-on-error usa-input-error-message selection-validation-message"> Unable to load your collection due to an error<br> <a href="#">Please try again</a> </div> </div> </fieldset> <div class="display-inline-flex"> <button class="usa-button margin-top-0 action-panel-submit" type="submit" data-loading-label="Adding..." data-pinger-ignore data-ga-category="collections_button" data-ga-action="click" data-ga-label="add"> Add </button> <button class="usa-button usa-button--outline margin-top-0 action-panel-cancel" aria-label="Close 'Add to Collections' panel" ref="linksrc=close_collections_panel" data-ga-category="collections_button" data-ga-action="click" data-ga-label="cancel"> Cancel </button> </div> </form> </div> </div> </div> </div> </div> </div> <footer class="ncbi-footer ncbi-dark-background " > <div class="ncbi-footer__icon-section"> <div class="ncbi-footer__social-header"> Follow NCBI </div> <div class="grid-container ncbi-footer__ncbi-social-icons-container"> <a href="https://twitter.com/ncbi" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="40" height="40" viewBox="0 0 40 40" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="m6.067 8 10.81 13.9L6 33.2h4.2l8.4-9.1 7.068 9.1H34L22.8 18.5 31.9 8h-3.5l-7.7 8.4L14.401 8H6.067Zm3.6 1.734h3.266l16.8 21.732H26.57L9.668 9.734Z"> </path> </svg> <span class="usa-sr-only">NCBI on X (formerly known as Twitter)</span> </a> <a href="https://www.facebook.com/ncbi.nlm" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="16" height="29" focusable="false" aria-hidden="true" viewBox="0 0 16 29" fill="none" xmlns="http://www.w3.org/2000/svg"> <path d="M3.8809 21.4002C3.8809 19.0932 3.8809 16.7876 3.8809 14.478C3.8809 14.2117 3.80103 14.1452 3.54278 14.1492C2.53372 14.1638 1.52334 14.1492 0.514288 14.1598C0.302626 14.1598 0.248047 14.0972 0.248047 13.8936C0.256034 12.4585 0.256034 11.0239 0.248047 9.58978C0.248047 9.37013 0.302626 9.30224 0.528931 9.3049C1.53798 9.31688 2.54837 9.3049 3.55742 9.31555C3.80103 9.31555 3.8809 9.26097 3.87957 9.00272C3.87158 8.00565 3.85428 7.00592 3.90753 6.00884C3.97142 4.83339 4.31487 3.73115 5.04437 2.78467C5.93095 1.63318 7.15699 1.09005 8.56141 0.967577C10.5582 0.79319 12.555 0.982221 14.5518 0.927641C14.7102 0.927641 14.7462 0.99287 14.7449 1.13664C14.7449 2.581 14.7449 4.02668 14.7449 5.47104C14.7449 5.67604 14.6517 5.68669 14.4946 5.68669C13.4523 5.68669 12.4113 5.68669 11.3703 5.68669C10.3506 5.68669 9.92057 6.10868 9.90593 7.13904C9.89661 7.7647 9.91525 8.39303 9.89794 9.01869C9.88995 9.26364 9.96583 9.31822 10.2015 9.31688C11.7204 9.30623 13.2393 9.31688 14.7595 9.3049C15.0257 9.3049 15.0723 9.3728 15.0444 9.62439C14.89 10.9849 14.7515 12.3467 14.6144 13.7085C14.5691 14.1571 14.5785 14.1585 14.1458 14.1585C12.8386 14.1585 11.5313 14.1665 10.2254 14.1518C9.95119 14.1518 9.89794 14.2317 9.89794 14.4899C9.90593 19.0799 9.89794 23.6752 9.91125 28.2612C9.91125 28.5674 9.8407 28.646 9.53186 28.6433C7.77866 28.6273 6.02414 28.6366 4.27094 28.634C3.82499 28.634 3.87158 28.6992 3.87158 28.22C3.87602 25.9472 3.87913 23.6739 3.8809 21.4002Z"> </path> </svg> <span class="usa-sr-only">NCBI on Facebook</span> </a> <a href="https://www.linkedin.com/company/ncbinlm" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="25" height="23" viewBox="0 0 26 24" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M14.6983 9.98423C15.6302 9.24808 16.5926 8.74754 17.6762 8.51991C19.673 8.09126 21.554 8.30824 23.1262 9.7526C24.2351 10.7723 24.7529 12.1115 25.0165 13.5612C25.1486 14.3363 25.2105 15.1218 25.2015 15.9081C25.2015 18.3043 25.2015 20.6898 25.2082 23.0806C25.2082 23.3468 25.1549 23.444 24.8621 23.4414C23.1297 23.4272 21.3992 23.4272 19.6704 23.4414C19.4041 23.4414 19.3429 23.3588 19.3442 23.1019C19.3535 20.5194 19.3442 17.9368 19.3442 15.3543C19.3442 14.0005 18.3258 12.9448 17.0266 12.9488C15.7273 12.9528 14.6983 14.0071 14.6983 15.361C14.6983 17.9328 14.6917 20.5047 14.6983 23.0753C14.6983 23.3708 14.6198 23.444 14.3296 23.4427C12.6185 23.4294 10.9079 23.4294 9.19779 23.4427C8.93155 23.4427 8.86099 23.3735 8.86232 23.1086C8.8783 19.7619 8.88628 16.4144 8.88628 13.066C8.88628 11.5688 8.87874 10.0708 8.86365 8.57182C8.86365 8.3575 8.90758 8.27896 9.14054 8.28029C10.9048 8.29094 12.6687 8.29094 14.4321 8.28029C14.6464 8.28029 14.6983 8.34818 14.6983 8.54653C14.6903 9.00047 14.6983 9.45441 14.6983 9.98423Z"> </path> <path d="M6.55316 15.8443C6.55316 18.2564 6.55316 20.6699 6.55316 23.082C6.55316 23.3629 6.48127 23.4388 6.19906 23.4374C4.47737 23.4241 2.75568 23.4241 1.03399 23.4374C0.767751 23.4374 0.69986 23.3629 0.701191 23.1006C0.709178 18.2648 0.709178 13.4281 0.701191 8.59053C0.701191 8.34026 0.765089 8.27237 1.01669 8.2737C2.74991 8.28435 4.48048 8.28435 6.20838 8.2737C6.47462 8.2737 6.5465 8.33627 6.54517 8.6065C6.54783 11.0186 6.55316 13.4308 6.55316 15.8443Z"> </path> <path d="M3.65878 0.243898C5.36804 0.243898 6.58743 1.45529 6.58743 3.1406C6.58743 4.75801 5.32145 5.95742 3.60819 5.96807C3.22177 5.97614 2.83768 5.90639 2.47877 5.76299C2.11985 5.61959 1.79344 5.40546 1.51897 5.13334C1.24449 4.86123 1.02755 4.53668 0.881058 4.17902C0.734563 3.82136 0.661505 3.43788 0.666231 3.05141C0.67555 1.42601 1.9362 0.242566 3.65878 0.243898Z"> </path> </svg> <span class="usa-sr-only">NCBI on LinkedIn</span> </a> <a href="https://github.com/ncbi" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="28" height="27" viewBox="0 0 28 28" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M16.7228 20.6334C17.5057 20.5527 18.2786 20.3944 19.0301 20.1608C21.3108 19.4193 22.5822 17.8259 22.963 15.4909C23.1228 14.5112 23.1814 13.5287 22.9883 12.5437C22.8106 11.6423 22.4013 10.8028 21.8007 10.1076C21.7526 10.0605 21.7197 10 21.7064 9.934C21.6931 9.86799 21.7 9.79952 21.7262 9.73748C22.0856 8.6206 21.9711 7.51969 21.601 6.42677C21.582 6.3497 21.5345 6.2827 21.468 6.23923C21.4016 6.19577 21.3211 6.17906 21.2429 6.19248C20.7329 6.21649 20.2313 6.33051 19.7611 6.52928C19.1103 6.7908 18.4899 7.12198 17.9104 7.51703C17.84 7.56996 17.7581 7.60551 17.6713 7.62078C17.5846 7.63605 17.4954 7.6306 17.4112 7.60489C15.2596 7.05882 13.0054 7.06203 10.8554 7.61421C10.7806 7.63586 10.7018 7.63967 10.6253 7.62534C10.5487 7.611 10.4766 7.57892 10.4148 7.53167C9.64788 7.03247 8.85171 6.58918 7.96368 6.33359C7.65781 6.24338 7.34123 6.19458 7.02239 6.18849C6.94879 6.17986 6.87462 6.19893 6.81432 6.242C6.75402 6.28507 6.71191 6.34904 6.69621 6.42145C6.32342 7.51437 6.2209 8.61527 6.56307 9.73348C6.59635 9.84264 6.64694 9.93316 6.54177 10.0516C5.47666 11.2604 5.09988 12.6834 5.19574 14.2676C5.2663 15.4244 5.46201 16.5466 6.01454 17.5769C6.84399 19.1171 8.21664 19.9119 9.85158 20.3352C10.3938 20.4706 10.9444 20.5698 11.4998 20.632C11.5384 20.7492 11.4506 20.7798 11.408 20.8291C11.1734 21.1179 10.9894 21.4441 10.8634 21.7942C10.7622 22.0458 10.8315 22.4039 10.6065 22.5516C10.263 22.7766 9.83827 22.8485 9.42421 22.8871C8.17936 23.0056 7.26471 22.4877 6.6283 21.4348C6.25552 20.8184 5.76956 20.3325 5.08523 20.0663C4.76981 19.9325 4.42139 19.8967 4.08537 19.9638C3.7898 20.029 3.73788 20.1901 3.93891 20.4111C4.03639 20.5234 4.14989 20.6207 4.27575 20.6999C4.9796 21.1318 5.51717 21.7884 5.80152 22.5636C6.37002 23.9973 7.48039 24.5697 8.93825 24.6323C9.43741 24.6575 9.93768 24.615 10.4254 24.5058C10.5892 24.4672 10.6531 24.4872 10.6517 24.6762C10.6451 25.4936 10.6637 26.3123 10.6517 27.131C10.6517 27.6635 10.1684 27.9297 9.58663 27.7393C8.17396 27.2671 6.84977 26.5631 5.66838 25.656C2.59555 23.2891 0.720966 20.1861 0.217704 16.3376C-0.357453 11.9127 0.911353 8.00824 3.98551 4.73881C6.11909 2.42656 8.99932 0.939975 12.1203 0.540191C16.5351 -0.0601815 20.4347 1.14323 23.7232 4.16373C26.2449 6.47869 27.724 9.37672 28.1048 12.7726C28.5828 17.0325 27.3686 20.7945 24.4768 23.9827C22.9762 25.6323 21.0956 26.8908 18.9982 27.6488C18.8783 27.6927 18.7585 27.738 18.636 27.7726C18.0356 27.9404 17.6189 27.6395 17.6189 27.0098C17.6189 25.7452 17.6308 24.4806 17.6295 23.2159C17.6329 22.9506 17.6128 22.6856 17.5696 22.4238C17.4325 21.6664 17.3419 21.484 16.7228 20.6334Z"> </path> </svg> <span class="usa-sr-only">NCBI on GitHub</span> </a> <a href="https://ncbiinsights.ncbi.nlm.nih.gov/" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="26" height="26" viewBox="0 0 27 27" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M23.7778 26.4574C23.1354 26.3913 22.0856 26.8024 21.636 26.3087C21.212 25.8444 21.4359 24.8111 21.324 24.0347C19.9933 14.8323 14.8727 8.80132 6.09057 5.85008C4.37689 5.28406 2.58381 4.99533 0.779072 4.99481C0.202773 4.99481 -0.0229751 4.83146 0.00455514 4.21479C0.0660406 3.08627 0.0660406 1.95525 0.00455514 0.826734C-0.0413285 0.0815827 0.259669 -0.0193618 0.896534 0.00266238C6.96236 0.222904 12.3693 2.24179 16.9889 6.16209C22.9794 11.2478 26.1271 17.7688 26.4372 25.648C26.4629 26.294 26.3179 26.5271 25.6609 26.4684C25.0827 26.417 24.4991 26.4574 23.7778 26.4574Z"> </path> <path d="M14.8265 26.441C14.0924 26.441 13.2371 26.6795 12.6626 26.3786C12.0092 26.0372 12.3781 25.0644 12.246 24.378C11.1154 18.5324 6.6849 14.5497 0.74755 14.1001C0.217135 14.0615 -0.0104482 13.9422 0.0134113 13.3659C0.0519536 12.1454 0.0482829 10.9213 0.0134113 9.69524C-0.00127145 9.14464 0.196946 9.03268 0.703502 9.04736C9.21217 9.27128 16.5994 16.2511 17.2804 24.7231C17.418 26.4446 17.418 26.4446 15.6579 26.4446H14.832L14.8265 26.441Z"> </path> <path d="M3.58928 26.4555C2.64447 26.4618 1.73584 26.0925 1.06329 25.4289C0.39073 24.7653 0.00933763 23.8617 0.0030097 22.9169C-0.00331824 21.9721 0.365937 21.0635 1.02954 20.3909C1.69315 19.7184 2.59675 19.337 3.54156 19.3306C4.48637 19.3243 5.39499 19.6936 6.06755 20.3572C6.7401 21.0208 7.1215 21.9244 7.12782 22.8692C7.13415 23.814 6.7649 24.7226 6.10129 25.3952C5.43768 26.0677 4.53409 26.4491 3.58928 26.4555Z"> </path> </svg> <span class="usa-sr-only">NCBI RSS feed</span> </a> </div> </div> <div data-testid="gridContainer" class="grid-container ncbi-footer__container"> <div class="grid-row ncbi-footer__main-content-container" data-testid="grid"> <div class="ncbi-footer__column"> <p class="ncbi-footer__circled-icons-heading"> Connect with NLM </p> <div class="ncbi-footer__circled-icons-list"> <a href=https://twitter.com/nlm_nih class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="32" height="32" viewBox="0 0 40 40" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="m6.067 8 10.81 13.9L6 33.2h4.2l8.4-9.1 7.068 9.1H34L22.8 18.5 31.9 8h-3.5l-7.7 8.4L14.401 8H6.067Zm3.6 1.734h3.266l16.8 21.732H26.57L9.668 9.734Z"> </path> </svg> <span class="usa-sr-only">NLM on X (formerly known as Twitter)</span> </a> <a href=https://www.facebook.com/nationallibraryofmedicine class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="13" height="24" viewBox="0 0 13 24" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M4.11371 23.1369C4.11371 23.082 4.11371 23.0294 4.11371 22.9745V12.9411H0.817305C0.6709 12.9411 0.670898 12.9411 0.670898 12.8016C0.670898 11.564 0.670898 10.3287 0.670898 9.09341C0.670898 8.97903 0.705213 8.95158 0.815017 8.95158C1.8673 8.95158 2.91959 8.95158 3.97417 8.95158H4.12057V8.83263C4.12057 7.8055 4.12057 6.7738 4.12057 5.74897C4.1264 4.92595 4.31387 4.11437 4.66959 3.37217C5.12916 2.38246 5.94651 1.60353 6.95717 1.1921C7.64827 0.905008 8.3913 0.764035 9.13953 0.778051C10.0019 0.791777 10.8644 0.830666 11.7268 0.860404C11.8869 0.860404 12.047 0.894717 12.2072 0.90158C12.2964 0.90158 12.3261 0.940469 12.3261 1.02968C12.3261 1.5421 12.3261 2.05452 12.3261 2.56465C12.3261 3.16857 12.3261 3.7725 12.3261 4.37642C12.3261 4.48165 12.2964 4.51367 12.1912 4.51138C11.5369 4.51138 10.8804 4.51138 10.2261 4.51138C9.92772 4.51814 9.63058 4.5526 9.33855 4.61433C9.08125 4.6617 8.84537 4.78881 8.66431 4.97766C8.48326 5.16652 8.3662 5.40755 8.32972 5.66661C8.28476 5.89271 8.26027 6.1224 8.25652 6.35289C8.25652 7.19014 8.25652 8.02969 8.25652 8.86923C8.25652 8.89439 8.25652 8.91955 8.25652 8.95615H12.0219C12.1797 8.95615 12.182 8.95616 12.1614 9.10714C12.0768 9.76596 11.9876 10.4248 11.9029 11.0813C11.8312 11.6319 11.7626 12.1824 11.697 12.733C11.6719 12.9434 11.6787 12.9434 11.4683 12.9434H8.26338V22.899C8.26338 22.979 8.26338 23.0591 8.26338 23.1392L4.11371 23.1369Z"> </path> </svg> <span class="usa-sr-only">NLM on Facebook</span> </a> <a href=https://www.youtube.com/user/NLMNIH class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="21" height="15" viewBox="0 0 21 15" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M19.2561 1.47914C18.9016 1.15888 18.5699 0.957569 17.2271 0.834039C15.5503 0.678484 13.2787 0.655608 11.563 0.65332H9.43556C7.71987 0.65332 5.4483 0.678484 3.77151 0.834039C2.43098 0.957569 2.097 1.15888 1.74242 1.47914C0.813665 2.32097 0.619221 4.62685 0.598633 6.89384C0.598633 7.31781 0.598633 7.74101 0.598633 8.16345C0.626084 10.4121 0.827391 12.686 1.74242 13.521C2.097 13.8412 2.4287 14.0425 3.77151 14.1661C5.4483 14.3216 7.71987 14.3445 9.43556 14.3468H11.563C13.2787 14.3468 15.5503 14.3216 17.2271 14.1661C18.5676 14.0425 18.9016 13.8412 19.2561 13.521C20.1712 12.6929 20.3725 10.451 20.3999 8.22064C20.3999 7.74025 20.3999 7.25986 20.3999 6.77946C20.3725 4.54907 20.1689 2.30724 19.2561 1.47914ZM8.55942 10.5311V4.65201L13.5601 7.50005L8.55942 10.5311Z" fill="white" /> </svg> <span class="usa-sr-only">NLM on YouTube</span> </a> </div> </div> <address class="ncbi-footer__address ncbi-footer__column"> <p> <a class="usa-link usa-link--external" href="https://www.google.com/maps/place/8600+Rockville+Pike,+Bethesda,+MD+20894/%4038.9959508, -77.101021,17z/data%3D!3m1!4b1!4m5!3m4!1s0x89b7c95e25765ddb%3A0x19156f88b27635b8!8m2!3d38.9959508! 4d-77.0988323" rel="noopener noreferrer" target="_blank">National Library of Medicine <br/> 8600 Rockville Pike<br/> Bethesda, MD 20894</a> </p> </address> <ul class="usa-list usa-list--unstyled ncbi-footer__vertical-list ncbi-footer__column"> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/web_policies.html" class="usa-link usa-link--alt ncbi-footer__link" > Web Policies </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nih.gov/institutes-nih/nih-office-director/office-communications-public-liaison/freedom-information-act-office" class="usa-link usa-link--alt ncbi-footer__link" > FOIA </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.hhs.gov/vulnerability-disclosure-policy/index.html" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > HHS Vulnerability Disclosure </a> </li> </ul> <ul class="usa-list usa-list--unstyled ncbi-footer__vertical-list ncbi-footer__column"> <li class="ncbi-footer__vertical-list-item"> <a href="https://support.nlm.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > Help </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/accessibility.html" class="usa-link usa-link--alt ncbi-footer__link" > Accessibility </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/careers/careers.html" class="usa-link usa-link--alt ncbi-footer__link" > Careers </a> </li> </ul> </div> <div class="grid-row grid-col-12" data-testid="grid"> <ul class="ncbi-footer__bottom-links-list"> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.nlm.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > NLM </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > NIH </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.hhs.gov/" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > HHS </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.usa.gov/" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > USA.gov </a> </li> </ul> </div> </div> </footer> <script type="text/javascript" src="https://cdn.ncbi.nlm.nih.gov/core/pinger/pinger.js"> </script> <button class="back-to-top" data-ga-category="pagination" data-ga-action="back_to_top"> <label>Back to Top</label> <svg class="usa-icon order-0" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#arrow_upward"></use> </svg> </button> <script src="https://code.jquery.com/jquery-3.5.0.min.js" integrity="sha256-xNzN2a4ltkB44Mc/Jz3pT4iU1cmeR0FkXs4pru/JxaQ=" crossorigin="anonymous"> </script> <script type="text/javascript">var exports = {};</script> <script src="/static/CACHE/js/output.13b077bc3ffd.js"></script> <script type="application/javascript"> window.ncbi = window.ncbi || {}; window.ncbi.pmc = window.ncbi.pmc || {}; window.ncbi.pmc.options = { logLevel: 'INFO', staticEndpoint: '/static/', citeCookieName: 'pmc-cf', }; </script> <script type="module" crossorigin="" src="/static/assets/base-9bea7450.js"></script> <script type="module" crossorigin="" src="/static/assets/article-722d91a2.js"></script> </body> </html>

CINXE.COM

Inflammation primes the murine kidney for recovery by activating AZIN1 adenosine-to-inosine editing - PMC