CINXE.COM
Search results for: spodoptera litura
<!DOCTYPE html> <html lang="en" dir="ltr"> <head> <!-- Google tag (gtag.js) --> <script async src="https://www.googletagmanager.com/gtag/js?id=G-P63WKM1TM1"></script> <script> window.dataLayer = window.dataLayer || []; function gtag(){dataLayer.push(arguments);} gtag('js', new Date()); gtag('config', 'G-P63WKM1TM1'); </script> <!-- Yandex.Metrika counter --> <script type="text/javascript" > (function(m,e,t,r,i,k,a){m[i]=m[i]||function(){(m[i].a=m[i].a||[]).push(arguments)}; m[i].l=1*new Date(); for (var j = 0; j < document.scripts.length; j++) {if (document.scripts[j].src === r) { return; }} k=e.createElement(t),a=e.getElementsByTagName(t)[0],k.async=1,k.src=r,a.parentNode.insertBefore(k,a)}) (window, document, "script", "https://mc.yandex.ru/metrika/tag.js", "ym"); ym(55165297, "init", { clickmap:false, trackLinks:true, accurateTrackBounce:true, webvisor:false }); </script> <noscript><div><img src="https://mc.yandex.ru/watch/55165297" style="position:absolute; left:-9999px;" alt="" /></div></noscript> <!-- /Yandex.Metrika counter --> <!-- Matomo --> <!-- End Matomo Code --> <title>Search results for: spodoptera litura</title> <meta name="description" content="Search results for: spodoptera litura"> <meta name="keywords" content="spodoptera litura"> <meta name="viewport" content="width=device-width, initial-scale=1, minimum-scale=1, maximum-scale=1, user-scalable=no"> <meta charset="utf-8"> <link href="https://cdn.waset.org/favicon.ico" type="image/x-icon" rel="shortcut icon"> <link href="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/css/bootstrap.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/plugins/fontawesome/css/all.min.css" rel="stylesheet"> <link href="https://cdn.waset.org/static/css/site.css?v=150220211555" rel="stylesheet"> </head> <body> <header> <div class="container"> <nav class="navbar navbar-expand-lg navbar-light"> <a class="navbar-brand" href="https://waset.org"> <img src="https://cdn.waset.org/static/images/wasetc.png" alt="Open Science Research Excellence" title="Open Science Research Excellence" /> </a> <button class="d-block d-lg-none navbar-toggler ml-auto" type="button" data-toggle="collapse" data-target="#navbarMenu" aria-controls="navbarMenu" aria-expanded="false" aria-label="Toggle navigation"> <span class="navbar-toggler-icon"></span> </button> <div class="w-100"> <div class="d-none d-lg-flex flex-row-reverse"> <form method="get" action="https://waset.org/search" class="form-inline my-2 my-lg-0"> <input class="form-control mr-sm-2" type="search" placeholder="Search Conferences" value="spodoptera litura" name="q" aria-label="Search"> <button class="btn btn-light my-2 my-sm-0" type="submit"><i class="fas fa-search"></i></button> </form> </div> <div class="collapse navbar-collapse mt-1" id="navbarMenu"> <ul class="navbar-nav ml-auto align-items-center" id="mainNavMenu"> <li class="nav-item"> <a class="nav-link" href="https://waset.org/conferences" title="Conferences in 2024/2025/2026">Conferences</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/disciplines" title="Disciplines">Disciplines</a> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/committees" rel="nofollow">Committees</a> </li> <li class="nav-item dropdown"> <a class="nav-link dropdown-toggle" href="#" id="navbarDropdownPublications" role="button" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"> Publications </a> <div class="dropdown-menu" aria-labelledby="navbarDropdownPublications"> <a class="dropdown-item" href="https://publications.waset.org/abstracts">Abstracts</a> <a class="dropdown-item" href="https://publications.waset.org">Periodicals</a> <a class="dropdown-item" href="https://publications.waset.org/archive">Archive</a> </div> </li> <li class="nav-item"> <a class="nav-link" href="https://waset.org/page/support" title="Support">Support</a> </li> </ul> </div> </div> </nav> </div> </header> <main> <div class="container mt-4"> <div class="row"> <div class="col-md-9 mx-auto"> <form method="get" action="https://publications.waset.org/abstracts/search"> <div id="custom-search-input"> <div class="input-group"> <i class="fas fa-search"></i> <input type="text" class="search-query" name="q" placeholder="Author, Title, Abstract, Keywords" value="spodoptera litura"> <input type="submit" class="btn_search" value="Search"> </div> </div> </form> </div> </div> <div class="row mt-3"> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Commenced</strong> in January 2007</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Frequency:</strong> Monthly</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Edition:</strong> International</div> </div> </div> <div class="col-sm-3"> <div class="card"> <div class="card-body"><strong>Paper Count:</strong> 19</div> </div> </div> </div> <h1 class="mt-3 mb-3 text-center" style="font-size:1.6rem;">Search results for: spodoptera litura</h1> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">19</span> Nutritional Indices and Biology of the Armyworm, Spodoptera litura on Five Cotton Varieties</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Md.%20Ruhul%20Amin">Md. Ruhul Amin</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The effects of CB1, CB3, CB5, CB8 and CB12 cotton varieties on the nutritional indices and biological parameters of armyworm Spodoptera litura were studied under laboratory conditions. The armyworm larvae showed the highest and lowest food consumption rates on CB8 and CB1 variety, respectively. The efficiency of the conversion of digested food, efficiency of conversion of ingested food, approximate digestibility rates were statistically higher and similar on CB5 and CB8, and lowest on CB1. The larvae reared on CB12 variety exerted the lowest feeding and growth indices, and the relative growth rate was highest on CB8. The survival rates of egg, larva, pupa and adult moths were found highest on CB8 and lowest on CB12. The development durations of the immature stages of the insect differed significantly and the time elapsed from egg-to-adult emergence, longevity of both male and female moths, and their lifecycle were shortest on CB12 variety. The nutritional indices and biological parameters of the armyworm indicated that the varieties CB5 and CB8 were suitable host plants for feeding and development of S. litura. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=gossypium%20hirsutum" title="gossypium hirsutum">gossypium hirsutum</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a>, <a href="https://publications.waset.org/abstracts/search?q=food%20consumption" title=" food consumption"> food consumption</a>, <a href="https://publications.waset.org/abstracts/search?q=life%20history" title=" life history"> life history</a> </p> <a href="https://publications.waset.org/abstracts/40633/nutritional-indices-and-biology-of-the-armyworm-spodoptera-litura-on-five-cotton-varieties" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/40633.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">382</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">18</span> Variation in Carboxylesterase Activity in Spodoptera litura Fabricious (Noctuidae: Lepidoptera) Populations from India</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=V.%20Karuppaiah">V. Karuppaiah</a>, <a href="https://publications.waset.org/abstracts/search?q=J.%20C.%20Padaria"> J. C. Padaria</a>, <a href="https://publications.waset.org/abstracts/search?q=C.%20Srivastava"> C. Srivastava</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura Fab (Lepidoptera: Noctuidae) is a polyphagous pest various field and horticulture crops in India. Pest had virtually developed resistance to all commonly used insecticides. Enhanced detoxification is the prime mechanism that is dictated by detoxification different enzymes and carboxylesterase is one of the major enzyme responsible development of resistance. In India, insecticide resistance studies on S. litura are mainly deployed on detoxification enzymes activity and investigation at gene level alteration i.e. at nucleotide level is very merger. In the present study, we collected the S. litura larvae from three different cauliflower growing belt viz., IARI, New Delhi (Delhi), Palari, Sonepat (Haryana) and Varanasi (Uttar Pradesh) to study the role of carboxylesterase activity and its gene level variation The CarE activity was measured using UV-VIS spectrophotometer with 3rd instar larvae of S. litura. The elevated activity of CarE was observed in Sonepat strain (28.09 ± 0.09 µmol/min/mg of protein) followed by Delhi (26.72 ± 0.04 µmol/min/mg of protein) and Varanasi strain (10.00 ± 0.44 µmol/min/mg of protein) of S. litura. The genomic DNA was isolated from 3rd instar larvae and CarE gene was amplified using a primer sequence, F:5’tccagagttccttgtcaggcac3’; R:5’ctgcatcaagcatgtctc3. CarE gene, about 500bp was partially amplified, sequenced and submitted to NCBI (Accession No. KF835886, KF835887 and KF835888). The sequence data revealed polymorphism at nucleotide level in all the three strains and gene found to have 88 to 97% similarity with previous available nucleotide sequences of S. litura, S. littoralis and S. exiqua. The polymorphism at the nucleotide level could be a reason for differential activity of carboxylesterase enzymes among the strains. However, investigation at gene expression level would be useful to analyze the overproduction of carboxylesterase enzyme. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=carboxylesterase" title="carboxylesterase">carboxylesterase</a>, <a href="https://publications.waset.org/abstracts/search?q=CarE%20gene" title=" CarE gene"> CarE gene</a>, <a href="https://publications.waset.org/abstracts/search?q=nucleotide%20polymorphism" title=" nucleotide polymorphism"> nucleotide polymorphism</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide%20resistance" title=" insecticide resistance"> insecticide resistance</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a> </p> <a href="https://publications.waset.org/abstracts/13619/variation-in-carboxylesterase-activity-in-spodoptera-litura-fabricious-noctuidae-lepidoptera-populations-from-india" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/13619.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">922</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">17</span> Antifeedant Activity of Methanol and Hexane Extracts of Datura Innoxia (Mill.) (Solanaceae) in the Management of Spodoptera Litura (F.) (Lepidoptera: Noctuidae) Larvae </h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Vagisha%20Rawal">Vagisha Rawal</a>, <a href="https://publications.waset.org/abstracts/search?q=Anupam%20V.%20Sharma"> Anupam V. Sharma</a>, <a href="https://publications.waset.org/abstracts/search?q=Tarun%20Kumar%20Vats"> Tarun Kumar Vats</a>, <a href="https://publications.waset.org/abstracts/search?q=Ashok%20Kumar%20Singh"> Ashok Kumar Singh</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The antifeedant activity of methanol and hexane extract of leaves and seeds of Datura innoxia (Mill.) (Solanaceae) was evaluated against the 5th instar Spodoptera litura (F.) (Lepidoptera: Noctuidae) larvae in choice and no-choice leaf disc bioassays under laboratory conditions. These larvae when given a choice between the ‘control’ and ‘treated’ leaf discs in choice bioassays, consumed significantly (p ˂ 0.05) greater area of the ‘control’ leaf discs compared to those treated with the crude extracts of leaves and seeds of D. innoxia. The Antifeedant Index (AFI) for 5% concentration of the hexane extract of Datura seeds (DSHE) was 43.3% and 38.5% for methanol extract of Datura seeds (DSME). On the other hand, these values were 34.1% for the hexane extract of Datura leaves (DLHE), and 31.0% for the methanol extract of Datura leaves (DLME), respectively. In no-choice bioassays also, there was a significant (p˂0.05) reduction in the larval consumption of ‘treated’ leaf discs compared to the ‘control’ leaf discs. Maximum AFI was recorded at 5% concentration of the extracts of both the leaves and seeds with 47.7% for DSHE against 40.0% (DSME) and 39.4% for DLHE compared with 38.4% (DLME). Moreover, DSHE was found to have the maximum antifeedant effect irrespective of its concentration in comparison to the other crude extracts of leaves or seeds of D. innoxia. It is evident from these results that the crude methanol and hexane extracts of leaves and seeds of D. innoxia exhibited potent antifeedant activity against the 5th instar S. litura larvae. Also, the use of the bioactive compound(s) present in these extracts can prove to be an effective, eco-friendly, viable and sustainable component that can be integrated in IPM programs for the management of this economically important polyphagous insect pest in the Indian subcontinent. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=antifeedant%20activity" title="antifeedant activity">antifeedant activity</a>, <a href="https://publications.waset.org/abstracts/search?q=antifeedant%20index" title=" antifeedant index"> antifeedant index</a>, <a href="https://publications.waset.org/abstracts/search?q=datura%20innoxia" title=" datura innoxia"> datura innoxia</a>, <a href="https://publications.waset.org/abstracts/search?q=spodoptera%20litura" title=" spodoptera litura"> spodoptera litura</a> </p> <a href="https://publications.waset.org/abstracts/37846/antifeedant-activity-of-methanol-and-hexane-extracts-of-datura-innoxia-mill-solanaceae-in-the-management-of-spodoptera-litura-f-lepidoptera-noctuidae-larvae" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/37846.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">521</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">16</span> Baseline Data for Insecticide Resistance Monitoring in Tobacco Caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae) on Cole Crops</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Prabhjot%20Kaur">Prabhjot Kaur</a>, <a href="https://publications.waset.org/abstracts/search?q=B.K.%20Kang"> B.K. Kang</a>, <a href="https://publications.waset.org/abstracts/search?q=Balwinder%20Singh"> Balwinder Singh</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae) is an agricultural important pest species. S. litura has a wide host range of approximately recorded 150 plant species worldwide. In Punjab, this pest attains sporadic status primarily on cauliflower, Brassica oleracea (L.). This pest destroys vegetable crop and particularly prefers the cruciferae family. However, it is also observed feeding on other crops such as arbi, Colocasia esculenta (L.), mung bean, Vigna radiata (L.), sunflower, Helianthus annuus (L.), cotton, Gossypium hirsutum (L.), castor, Ricinus communis (L.), etc. Larvae of this pest completely devour the leaves of infested plant resulting in huge crop losses which ranges from 50 to 70 per cent. Indiscriminate and continuous use of insecticides has contributed in development of insecticide resistance in insects and caused the environmental degradation as well. Moreover, a base line data regarding the toxicity of the newer insecticides would help in understanding the level of resistance developed in this pest and any possible cross-resistance there in, which could be assessed in advance. Therefore, present studies on development of resistance in S. litura against four new chemistry insecticides (emamectin benzoate, chlorantraniliprole, indoxacarb and spinosad) were carried out in the Toxicology laboratory, Department of Entomology, Punjab Agricultural University, Ludhiana, Punjab, India during the year 2011-12. Various stages of S. litura (eggs, larvae) were collected from four different locations (Malerkotla, Hoshiarpur, Amritsar and Samrala) of Punjab. Resistance is developed in third instars of lepidopterous pests. Therefore, larval bioassays were conducted to estimate the response of field populations of thirty third-instar larvae of S. litura under laboratory conditions at 25±2°C and 65±5 per cent relative humidity. Leaf dip bioassay technique with diluted insecticide formulations recommended by Insecticide Resistance Action Committee (IRAC) was performed in the laboratory with seven to ten treatments depending on the insecticide class, respectively. LC50 values were estimated by probit analysis after correction to record control mortality data which was used to calculate the resistance ratios (RR). The LC50 values worked out for emamectin benzoate, chlorantraniliprole, indoxacarb, spinosad are 0.081, 0.088, 0.380, 4.00 parts per million (ppm) against pest populations collected from Malerkotla; 0.051, 0.060, 0.250, 3.00 (ppm) of Amritsar; 0.002, 0.001, 0.0076, 0.10 ppm for Samrala and 0.000014, 0.00001, 0.00056, 0.003 ppm against pest population of Hoshiarpur, respectively. The LC50 values for populations collected from these four locations were in the order Malerkotla>Amritsar>Samrala>Hoshiarpur for the insecticides (emamectin benzoate, chlorantraniliprole, indoxacarb and spinosad) tested. Based on LC50 values obtained, emamectin benzoate (0.000014 ppm) was found to be the most toxic among all the tested populations, followed by chlorantraniliprole (0.00001 ppm), indoxacarb (0.00056 ppm) and spinosad (0.003 ppm), respectively. The pairwise correlation coefficients of LC50 values indicated that there was lack of cross resistance for emamectin benzoate, chlorantraniliprole, spinosad, indoxacarb in populations of S. litura from Punjab. These insecticides may prove to be promising substitutes for the effective control of insecticide resistant populations of S. litura in Punjab state, India. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Spodoptera%20litura" title="Spodoptera litura">Spodoptera litura</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticides" title=" insecticides"> insecticides</a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity" title=" toxicity"> toxicity</a>, <a href="https://publications.waset.org/abstracts/search?q=resistance" title=" resistance"> resistance</a> </p> <a href="https://publications.waset.org/abstracts/6194/baseline-data-for-insecticide-resistance-monitoring-in-tobacco-caterpillar-spodoptera-litura-fabricius-lepidoptera-noctuidae-on-cole-crops" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/6194.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">342</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">15</span> Effect of Lactone Glycoside on Feeding Deterrence and Nutritive Physiology of Tobacco Caterpillar Spodoptera litura Fabricius (Noctuidae: Lepidoptera)</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Selvamuthukumaran%20Thirunavukkarasu">Selvamuthukumaran Thirunavukkarasu</a>, <a href="https://publications.waset.org/abstracts/search?q=Arivudainambi%20Sundararajan"> Arivudainambi Sundararajan</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The plant active molecules with their known mode of action are important leads to the development of newer insecticides. Lactone glycoside was identified earlier as the active principle in Cleistanthus collinus (Roxb.) Benth. (Fam: Euphorbiaceae). It possessed feeding deterrent, insecticidal and insect growth regulatory actions at varying concentrations. Deducing its mode of action opens a possibility of its further development. A no-choice leaf disc bioassay was carried out with lactone glycoside at different doses for different instars and Deterrence Indices were worked out. Using regression analysis concentrations imparting 10, 30 and 50 per cent deterrence (DI10, DI30 & DI50) were worked out. At these doses, effect on nutritional indices like Relative Consumption and Growth Rates (RCR & RGR), Efficiencies of Conversion of Ingested and Digested food (ECI & ECD) and Approximate Digestibility (AD) were worked out. The Relative Consumption and Growth Rate of control and lactone glycoside larva were compared by regression analysis. Regression analysis of deterrence indices revealed that the concentrations needed for imparting 50 per cent deterrence was 60.66, 68.47 and 71.10 ppm for third, fourth and fifth instars respectively. Relative consumption rate (RCR) and relative growth rate (RGR) were reduced. This confirmed the antifeedant action of the fraction. Approximate digestibility (AD) was found greater in treatments indicating reduced faeces because of poor digestibility and retention of food in the gut. Efficiency of conversion of both ingested and digested (ECI and ECD) food was also found to be greatly reduced. This indicated presence of toxic action. This was proved by comparing growth efficiencies of control and lactone glycoside treated larvae. Lactone glycoside was found to possess both feeding deterrent and toxic modes of action. Studies on molecular targets based on this preliminary site of action lead to new insecticide development. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Spodoptera%20litura%20Fabricius" title="Spodoptera litura Fabricius">Spodoptera litura Fabricius</a>, <a href="https://publications.waset.org/abstracts/search?q=Cleistanthus%20collinus%20%28Roxb.%29%20Benth" title=" Cleistanthus collinus (Roxb.) Benth"> Cleistanthus collinus (Roxb.) Benth</a>, <a href="https://publications.waset.org/abstracts/search?q=feeding%20deterrence" title=" feeding deterrence"> feeding deterrence</a>, <a href="https://publications.waset.org/abstracts/search?q=mode%20of%20action" title=" mode of action"> mode of action</a> </p> <a href="https://publications.waset.org/abstracts/91129/effect-of-lactone-glycoside-on-feeding-deterrence-and-nutritive-physiology-of-tobacco-caterpillar-spodoptera-litura-fabricius-noctuidae-lepidoptera" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/91129.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">155</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">14</span> Efficacy of Agrobacterium Tumefaciens as a Possible Entomopathogenic Agent</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Fouzia%20Qamar">Fouzia Qamar</a>, <a href="https://publications.waset.org/abstracts/search?q=Shahida%20Hasnain"> Shahida Hasnain</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The objective of the present study was to evaluate the possible role of Agrobacterium tumefaciens as a possible insect biocontrol agent. Pests selected for the present challenge were adult males of Periplaneta americana and last instar larvae of Pieris brassicae and Spodoptera litura. Different ranges of bacterial doses were selected and tested to score the mortalities of the insects after 24 hours, for the lethal dose estimation studies. Mode of application for the inoculation of the bacteria, was the microinjection technique. The evaluation of the possible entomopathogenic carrying attribute of bacterial Ti plasmid, led to the conclusion that the loss of plasmid was associated with the loss of virulence against target insects. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=agrobacterium%20tumefaciens" title="agrobacterium tumefaciens">agrobacterium tumefaciens</a>, <a href="https://publications.waset.org/abstracts/search?q=toxicity%20assessment" title=" toxicity assessment"> toxicity assessment</a>, <a href="https://publications.waset.org/abstracts/search?q=biopesticidal%20attribute" title=" biopesticidal attribute"> biopesticidal attribute</a>, <a href="https://publications.waset.org/abstracts/search?q=entomopathogenic%20agent" title=" entomopathogenic agent"> entomopathogenic agent</a> </p> <a href="https://publications.waset.org/abstracts/17439/efficacy-of-agrobacterium-tumefaciens-as-a-possible-entomopathogenic-agent" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/17439.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">378</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">13</span> Insect Inducible Methanol Production in Plants for Insect Resistance</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Gourav%20Jain">Gourav Jain</a>, <a href="https://publications.waset.org/abstracts/search?q=Sameer%20Dixit"> Sameer Dixit</a>, <a href="https://publications.waset.org/abstracts/search?q=Surjeet%20Kumar%20Arya"> Surjeet Kumar Arya</a>, <a href="https://publications.waset.org/abstracts/search?q=Praveen%20C.%20Verma"> Praveen C. Verma</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Plant cell wall plays a major role in defence mechanism against biotic and abiotic stress as it constitutes the physical barrier between the microenvironment and internal component of the cell. It is a complex structure composed of mostly carbohydrates among which cellulose and hemicelluloses are most abundant that is embedded in a matrix of pectins and proteins. Multiple enzymes have been reported which plays a vital role in cell wall modification, Pectin Methylesterase (PME) is one of them which catalyses the demethylesterification of homogalacturonans component of pectin which releases acidic pectin and methanol. As emitted methanol is toxic to the insect pest, we use PME gene for the better methanol production. In the current study we showed overexpression of PME gene isolated from Withania somnifera under the insect inducible promoter causes enhancement of methanol production at the time of insect feeds to plants, and that provides better insect resistance property. We found that the 85-90% mortality causes by transgenic tobacco in both chewing (Spodoptera litura larvae and Helicoverpa armigera) and sap-sucking (Aphid, mealybug, and whitefly) pest. The methanol content and emission level were also enhanced by 10-15 folds at different inducible time point interval (15min, 30min, 45min, 60min) which would be analysed by Purpald/Alcohol Oxidase method. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=methanol" title="methanol">methanol</a>, <a href="https://publications.waset.org/abstracts/search?q=Pectin%20methylesterase" title=" Pectin methylesterase"> Pectin methylesterase</a>, <a href="https://publications.waset.org/abstracts/search?q=inducible%20promoters" title=" inducible promoters"> inducible promoters</a>, <a href="https://publications.waset.org/abstracts/search?q=Purpald%2FAlcohol%20oxidase" title=" Purpald/Alcohol oxidase"> Purpald/Alcohol oxidase</a> </p> <a href="https://publications.waset.org/abstracts/67908/insect-inducible-methanol-production-in-plants-for-insect-resistance" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/67908.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">244</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">12</span> Evaluation of the Most Effective Insecticides against the Spodoptera Frugiperda, on the Maize Production</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ahmed%20Ali%20Hassan">Ahmed Ali Hassan</a> </p> <p class="card-text"><strong>Abstract:</strong></p> In 2016, the Fall Armyworm (FAW) was first discovered in Africa. FAW is abundantly present in Somalia and seriously harms the maize crop. This investigation examined the impact on maize productivity of three different pesticides used to combat the autumn armyworm, Spodoptera frugiperda (Noctuidae: Lepidoptera). During the 2020–2021 growing season, three insecticides (Malathion 57 EC, Ampligo150 ZC, and Carbryle 85 WP) were evaluated at field demonstration plots. Our result showed that, significant mortality of S. frugiperda was observed on the treatment plot treated with Amplico. Ampligo caused over 90% larval mortality after application. Malathion had moderate activity, causing 53.733% mortality after application, while Carbaryl was less effective, causing 36.367% mortality after application. Consequently, the current finding shows that the three selected insecticides reduced the damage and infestation level of S. frugiperda in the maize field conditions and the most effective treatment were Amplico. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=pesticides" title="pesticides">pesticides</a>, <a href="https://publications.waset.org/abstracts/search?q=maize%20fall%20army%20worm" title=" maize fall army worm"> maize fall army worm</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticides" title=" insecticides"> insecticides</a>, <a href="https://publications.waset.org/abstracts/search?q=mortality" title=" mortality"> mortality</a>, <a href="https://publications.waset.org/abstracts/search?q=S.%20frugiperda" title=" S. frugiperda"> S. frugiperda</a> </p> <a href="https://publications.waset.org/abstracts/169800/evaluation-of-the-most-effective-insecticides-against-the-spodoptera-frugiperda-on-the-maize-production" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/169800.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">70</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">11</span> Population Growth of Bracon hebetor Say. under the Influence of Various Lepidopteran Host</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Mohammad%20Muslim">Mohammad Muslim</a>, <a href="https://publications.waset.org/abstracts/search?q=M.%20Shafiq%20Ansari"> M. Shafiq Ansari</a>, <a href="https://publications.waset.org/abstracts/search?q=Fazil%20Hasan"> Fazil Hasan</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Bracon hebetor Say (Hymenoptera: Braconidae) is considered as a highly cosmopolitan ecto-parasitoid of various species of order Lepidoptera. To study the influence of lepidopteran hosts on population growth of B. hebetor, the newly mated gravid females were released on various host and the eggs laid by such females on respective host were counted and a single egg was allow to develop on single host larvae. The experiment was conducted at 27 ± 1°C, 65 ± 5% RH and 14L: 10D hr in Biological Oxygen Demand (BOD) chamber. Upon hatching the tiny larvae of parasitoid pierced the body of insect host, enter into them and consumed the internal body contents of paralyzed host larvae. Present findings showed that B. hebetor took ~36 days to complete its survivorship on Corcyra cephalonica and Galleria mellonella. However, on Spodoptera littoralis the survivorship decreased to 24 days. Nevertheless, development of H. hebetor’s immature was significantly prolonged on S. littoralis and S. litura compared to other insect hosts tested. Female of B. hebetor took longer time to lay eggs on C. cephalonica and G. mellonella than other hosts tested in this study. Longevity of male and female is significantly prolonged on C. cephalonica and G. mellonella compared to others insect hosts tested. Population growth parameters like mx Ro, rm, Tc, and τ was considerably highest on C. cephalonica and lowest on S. littoralis. Based on the demographic studies C. cephalonica and H. armegera were proved to be the most suitable host for the mass rearing of B. hebetor. Nevertheless, results of present investigation could be utilized to improve the mass-breeding program of B. hebetor, so that sufficient number of B. hebetor’s adults could be provided time to time for the effective control of lepidopteran pests of various economically important crops. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=Bracon%20hebetor" title="Bracon hebetor">Bracon hebetor</a>, <a href="https://publications.waset.org/abstracts/search?q=lepidopteran%20hosts" title=" lepidopteran hosts"> lepidopteran hosts</a>, <a href="https://publications.waset.org/abstracts/search?q=demography" title=" demography"> demography</a>, <a href="https://publications.waset.org/abstracts/search?q=biology" title=" biology"> biology</a>, <a href="https://publications.waset.org/abstracts/search?q=development" title=" development"> development</a> </p> <a href="https://publications.waset.org/abstracts/68867/population-growth-of-bracon-hebetor-say-under-the-influence-of-various-lepidopteran-host" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/68867.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">258</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">10</span> Susceptibility of Spodoptera littoralis, Field Populations in Egypt to Chlorantraniliprole and the Role of Detoxification Enzymes</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Mohamed%20H.%20Khalifa">Mohamed H. Khalifa</a>, <a href="https://publications.waset.org/abstracts/search?q=Fikry%20I.%20El-Shahawi"> Fikry I. El-Shahawi</a>, <a href="https://publications.waset.org/abstracts/search?q=Nabil%20A.%20Mansour"> Nabil A. Mansour</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The cotton leafworm, <em>Spodoptera</em> <em>littoralis</em> (Boisduval) is a major insect pest of vegetables and cotton crops in Egypt, and exhibits different levels of tolerance to certain insecticides. Chlorantraniliprole has been registered recently in Egypt for control this insect. The susceptibilities of three <em>S. littoralis</em> populations collected from El Behaira governorate, north Egypt to chlorantraniliprole were determined by leaf-dipping technique on 4<sup>th</sup> instar larvae. Obvious variation of toxicity was observed among the laboratory susceptible, and three field populations with LC<sub>50</sub> values ranged between 1.53 µg/ml and 6.22 µg/ml. However, all the three field populations were less susceptible to chlorantraniliprole than a laboratory susceptible population. The most tolerant populations were sampled from El Delengat (ED) Province where <em>S. littoralis</em> had been frequently challenged by insecticides. Certain enzyme activity assays were carried out to be correlated with the mechanism of the observed field population tolerance. All field populations showed significantly enhanced activities of detoxification enzymes compared with the susceptible strain. The regression analysis between chlorantraniliprole toxicities and enzyme activities revealed that the highest correlation is between α-esterase or β-esterase (α-β-EST) activity and collected field strains susceptibility, otherwise this correlation is not significant (P > 0.05). Synergism assays showed the ED and susceptible strains could be synergized by known detoxification inhibitors such as piperonyl butoxide (PBO), triphenyl phosphate (TPP) and diethyl-maleate (DEM) at different levels (1.01-8.76-fold and 1.09-2.94 fold, respectively), TPP showed the maximum synergism in both strains. The results show that there is a correlation between the enzyme activity and tolerance, and carboxylic-esterase (Car-EST) is likely the main detoxification mechanism responsible for tolerance of <em>S. littoralis</em> to chlorantraniliprole. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=chlorantraniliprole" title="chlorantraniliprole">chlorantraniliprole</a>, <a href="https://publications.waset.org/abstracts/search?q=detoxification%20enzymes" title=" detoxification enzymes"> detoxification enzymes</a>, <a href="https://publications.waset.org/abstracts/search?q=Egypt" title=" Egypt"> Egypt</a>, <a href="https://publications.waset.org/abstracts/search?q=Spodoptera%20littoralis" title=" Spodoptera littoralis"> Spodoptera littoralis</a> </p> <a href="https://publications.waset.org/abstracts/62316/susceptibility-of-spodoptera-littoralis-field-populations-in-egypt-to-chlorantraniliprole-and-the-role-of-detoxification-enzymes" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/62316.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">274</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">9</span> Occurrence of the fall armyworm, Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae), on Maize in Katsina State, Nigeria and preliminary study of its Developmental Characteristics under Laboratory Conditions</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ibrahim%20Sani">Ibrahim Sani</a>, <a href="https://publications.waset.org/abstracts/search?q=Suleiman%20Mohammed."> Suleiman Mohammed.</a>, <a href="https://publications.waset.org/abstracts/search?q=Salisu%20Sulaiman"> Salisu Sulaiman</a>, <a href="https://publications.waset.org/abstracts/search?q=Aminu%20Musa"> Aminu Musa</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The fall army worm (FAW), Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae) has recently become one of the major threats to maize production in the world. It is native to tropical and subtropical America and began to spread to many African and a few Asian Countries. A survey for the observation of infestation and collection of fall armyworm was conducted in field planted with maize in the northern part of Katsina state. Eggs and immature stages were collected, place in a plastic container and brought to the laboratory for observation and study of developmental stages. FAW was identified based on the morphological characteristics, i.e. the “Y” inverted shape on the head capsule and the patterns of black spots on the abdominal segments (square and trapezoidal forms). Different growing stage of maize are affected by fall armyworm, but the damage is greatest during the early growing phase of corn. Heavy infestation on the leaves also cause defoliation. Four developmental stages (eggs larvae, pupae and adults) of the FAW were studied when fed with young corn under laboratory conditions. Furthermore, effective scouting or monitoring of FAW could be practice at early stage of growth of maize. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=infestation" title="infestation">infestation</a>, <a href="https://publications.waset.org/abstracts/search?q=katsina" title=" katsina"> katsina</a>, <a href="https://publications.waset.org/abstracts/search?q=maize" title=" maize"> maize</a>, <a href="https://publications.waset.org/abstracts/search?q=fall%20armyworm" title=" fall armyworm"> fall armyworm</a> </p> <a href="https://publications.waset.org/abstracts/180992/occurrence-of-the-fall-armyworm-spodoptera-frugiperda-j-e-smith-lepidoptera-noctuidae-on-maize-in-katsina-state-nigeria-and-preliminary-study-of-its-developmental-characteristics-under-laboratory-conditions" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/180992.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">74</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">8</span> Natural Enemies of the Fall Armyworm (Spodoptera frugiperda, Smith) and Comparing Neem Aqueous Extracts against Its Larvae in Gurage Zone, Central Ethiopia</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Abera%20Hailu%20Degaga">Abera Hailu Degaga</a>, <a href="https://publications.waset.org/abstracts/search?q=Emana%20Getu%20Degaga"> Emana Getu Degaga</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Spodoptera frugiperda is an invasive insect pest that infests and feeds various crops, particularly affecting maize yields. However, nature has its own way of maintaining balance, and in this case, natural enemies play a crucial role in regulating the population of S. frugiperda. Locally available and easily prepared botanical sources, bio-pesticides, are also important. The objectives of the study were to investigate the natural enemies of S. frugiperda in the Gurage zone and to compare Neem aqueous extracts against its larvae in central Ethiopia. S. frugiperda larvae and egg masses were collected randomly from smallholder maize farms infested with pests between June and August 2023. Our findings revealed the existence of diverse types of parasitoids, predators, and entomopathogenic fungi associated with S. frugiperda. Notably, we documented three species of parasitoids, namely Exorista xanthaspis and Tachina spp. (Diptera: Tachinidae) and Charops annulipes (Hymenoptera: Ichneumonidae). All three species of parasitoids were recorded from Ethiopia for the first time. The overall parasitism rate was 5.3%, with individual rates ranging from 1.3 to 4%. Additionally, we identified ten species of predator insects from four different orders, including Hemiptera, Dermaptera, Coleoptera, and Mantodea, in the maize farms infested with S. frugiperda. Aqueous extract of Neem seed and leaf powder and green leaf exhibited similar mortality rates of S. frugiperda larvae at 72 hours even though there was a significant difference at 24 and 48 hours of the test. For effective management of S. frugiperda further research is necessary to fully exploit the potential of these natural enemies and additionally to use botanical source pesticides like Azadirachta indica. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=bio-pesticide" title="bio-pesticide">bio-pesticide</a>, <a href="https://publications.waset.org/abstracts/search?q=natural%20enemy" title=" natural enemy"> natural enemy</a>, <a href="https://publications.waset.org/abstracts/search?q=parasitoids" title=" parasitoids"> parasitoids</a>, <a href="https://publications.waset.org/abstracts/search?q=predators" title=" predators"> predators</a>, <a href="https://publications.waset.org/abstracts/search?q=Tachinid%20flies" title=" Tachinid flies"> Tachinid flies</a> </p> <a href="https://publications.waset.org/abstracts/180993/natural-enemies-of-the-fall-armyworm-spodoptera-frugiperda-smith-and-comparing-neem-aqueous-extracts-against-its-larvae-in-gurage-zone-central-ethiopia" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/180993.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">66</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">7</span> Autophagy in the Midgut Epithelium of Spodoptera exigua Hübner (Lepidoptera: Noctuidae) Larvae Exposed to Various Cadmium Concentration - 6-Generational Exposure</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Magdalena%20Maria%20Rost-Roszkowska">Magdalena Maria Rost-Roszkowska</a>, <a href="https://publications.waset.org/abstracts/search?q=Alina%20Chachulska-%C5%BByme%C5%82ka"> Alina Chachulska-Żymełka</a>, <a href="https://publications.waset.org/abstracts/search?q=Monika%20Tarnawska"> Monika Tarnawska</a>, <a href="https://publications.waset.org/abstracts/search?q=Maria%20Augustyniak"> Maria Augustyniak</a>, <a href="https://publications.waset.org/abstracts/search?q=Alina%20Kafel"> Alina Kafel</a>, <a href="https://publications.waset.org/abstracts/search?q=Agnieszka%20Babczy%C5%84ska"> Agnieszka Babczyńska</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Autophagy is a form of cell remodeling in which an internalization of organelles into vacuoles that are called autophagosomes occur. Autophagosomes are the targets of lysosomes, thus causing digestion of cytoplasmic components. Eventually, it can lead to the death of the entire cell. However, in response to several stress factors, e.g., starvation, heavy metals (e.g., cadmium) autophagy can also act as a pro-survival factor, protecting the cell against its death. The main aim of our studies was to check if the process of autophagy, which could appear in the midgut epithelium after Cd treatment, can be fixed during the following generations of insects. As a model animal, we chose the beet armyworm Spodoptera exigua Hübner (Lepidoptera: Noctuidae), a well-known polyphagous pest of many vegetable crops. We analyzed specimens at final larval stage (5th larval stage), due to its hyperfagy, resulting in great amount of cadmium assimilate. The culture consisted of two strains: a control strain (K) fed a standard diet, and a cadmium strain (Cd), fed on standard diet supplemented with cadmium (44 mg Cd per kg of dry weight of food) for 146 generations, both strains. In addition, the control insects were transferred to the Cd supplemented diet (5 mg Cd per kg of dry weight of food, 10 mg Cd per kg of dry weight of food, 20 mg Cd per kg of dry weight of food, 44 mg Cd per kg of dry weight of food). Therefore, we obtained Cd1, Cd2, Cd3 and KCd experimental groups. Autophagy has been examined using transmission electron microscope. During this process, degenerated organelles were surrounded by a membranous phagophore and enclosed in an autophagosome. Eventually, after the autophagosome fused with a lysosome, an autolysosome was formed and the process of the digestion of organelles began. During the 1st year of the experiment, we analyzed specimens of 6 generations in all the lines. The intensity of autophagy depends significantly on the generation, tissue and cadmium concentration in the insect rearing medium. In the Ist, IInd, IIIrd, IVth, Vth and VIth generation the intensity of autophagy in the midguts from cadmium-exposed strains decreased gradually according to the following order of strains: Cd1, Cd2, Cd3 and KCd. The higher amount of cells with autophagy was observed in Cd1 and Cd2. However, it was still higher than the percentage of cells with autophagy in the same tissues of the insects from the control and multigenerational cadmium strain. This may indicate that during 6-generational exposure to various Cd concentration, a preserved tolerance to cadmium was not maintained. The study has been financed by the National Science Centre Poland, grant no 2016/21/B/NZ8/00831. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=autophagy" title="autophagy">autophagy</a>, <a href="https://publications.waset.org/abstracts/search?q=cell%20death" title=" cell death"> cell death</a>, <a href="https://publications.waset.org/abstracts/search?q=digestive%20system" title=" digestive system"> digestive system</a>, <a href="https://publications.waset.org/abstracts/search?q=ultrastructure" title=" ultrastructure"> ultrastructure</a> </p> <a href="https://publications.waset.org/abstracts/90369/autophagy-in-the-midgut-epithelium-of-spodoptera-exigua-hubner-lepidoptera-noctuidae-larvae-exposed-to-various-cadmium-concentration-6-generational-exposure" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/90369.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">233</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">6</span> The Impact of Three Different Insecticides Against Fall Armyworms on Maize Productivity, in Somalia</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Ahmed%20Ali%20Hassan">Ahmed Ali Hassan</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The fall armyworm (FAW) was first identified in 2016 in Africa. FAW is widely distributed in Somalia and severely damages the maize crop. The effect of three different pesticides used to control the autumn armyworm, Spodoptera frugiperda (Noctuidae: Lepidoptera), on maize productivity was investigated in this study. During the 2020–2021 growing season, three insecticides (Malathion 57 EC, Ampligo150 ZC, and Carbryle 85 WP) were evaluated at field demonstration plots. Our result showed that significant mortality of S. frugiperda was observed on the treatment plot treated with Amplico. After spraying, Ampligo resulted in (92.200%) larval death. Compared to Carbaryl, which was less active and only caused 36.367% mortality after application, Malathion had a moderate mortality rate of 53.733%. Consequently, our current finding shows that the three selected insecticides reduced the damage and infestation level of S. frugiperda in the maize field conditions, and the most effective treatment was Amplico. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=maize" title="maize">maize</a>, <a href="https://publications.waset.org/abstracts/search?q=fall%20armyworm" title=" fall armyworm"> fall armyworm</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticides" title=" insecticides"> insecticides</a>, <a href="https://publications.waset.org/abstracts/search?q=mortality" title=" mortality"> mortality</a> </p> <a href="https://publications.waset.org/abstracts/191889/the-impact-of-three-different-insecticides-against-fall-armyworms-on-maize-productivity-in-somalia" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/191889.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">25</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">5</span> Activation of Apoptosis in the Midgut Epithelium of Spodoptera exigua Hübner (Lepidoptera: Noctuidae) Exposed to Various Cadmium Concentration</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Magdalena%20Maria%20Rost-Roszkowska">Magdalena Maria Rost-Roszkowska</a>, <a href="https://publications.waset.org/abstracts/search?q=Alina%20Chachulska-%C5%BByme%C5%82ka"> Alina Chachulska-Żymełka</a>, <a href="https://publications.waset.org/abstracts/search?q=Monika%20Tarnawska"> Monika Tarnawska</a>, <a href="https://publications.waset.org/abstracts/search?q=Maria%20Augustyniak"> Maria Augustyniak</a>, <a href="https://publications.waset.org/abstracts/search?q=Alina%20Kafel"> Alina Kafel</a>, <a href="https://publications.waset.org/abstracts/search?q=Agnieszka%20Babczy%C5%84ska"> Agnieszka Babczyńska</a> </p> <p class="card-text"><strong>Abstract:</strong></p> The digestive system of insects is composed of three distinct regions: fore-, mid- and hingut. The middle region (the midgut) is treated as one of the barriers which protects the organism against any stressors which originate from external environment, e.g. toxic metals. Such factors can activate the cell death in epithelial cells to preserve the entire tissue/organs against the degeneration. Different mechanisms involved in homeostasis maintenance have been described, but the studies of animals under field conditions do not give the opportunity to conclude about potential ability of subsequent generation to inherit the tolerance mechanisms. It is possible only by a multigenerational strain of an animal led under laboratory conditions, exposed to a selected toxic factor, present also in polluted ecosystems. The main purpose of the project was to check if changes, which appear in the midgut epithelium after Cd treatment, can be fixed during the following generations of insects with the special emphasis on apoptosis. As the animal for these studies we chose 5th larval stage of the beet armyworm Spodoptera exigua Hübner (Lepidoptera: Noctuidae), which is one of pest of many vegetable crops. Animals were divided into some experimental groups: K, Cd, KCd, Cd1, Cd2, Cd3. A control group (K) fed a standard diet, and was conducted for XX generations, a cadmium group (Cd), fed on standard diet supplemented with cadmium (44 mg Cd per kg of dry weight of food) for XXX generations. A reference Cd group (KCd) has been initiated: control insects were fed with Cd supplemented diet (44 mg Cd per kg of dry weight of food). Experimental groups Cd1, Cd2, Cd3 developed from the control one: 5 mg Cd per kg of dry weight of food, 10 mg Cd per kg of dry weight of food, 20 mg Cd per kg of dry weight of food. We were interested in the activation of apoptosis during following generations in all experimental groups. Therefore, during the 1st year of the experiment, the measurements were done for 6 generations in all experimental group. The intensity and the course of apoptosis have been examined using transmission electron microscope (TEM), confocal microscope and flow cytometry. During apoptosis the cell started to shrink, extracellular spaces appeared between digestive and neighboring cells, the nucleus achieved a lobular shape. Eventually, the apoptotic cells was discharged into the midgut lumen. A quantitative analysis revealed that the number of apoptotic cells depends significantly on the generation, tissue and cadmium concentration in the insect rearing medium. In the following 6 generations, we observed that the percentage of apoptotic cells in the midguts from cadmium-exposed groups decreased gradually according to the following order of strains: Cd1, Cd2, Cd3 and KCd. At the same time, it was still higher than the percentage of apoptotic cells in the same tissues of the insects from the control and multigenerational cadmium strain. The results of our studies suggest that changes caused by cadmium treatment were preserved during 6-generational development of lepidopteran larvae. The study has been financed by the National Science Centre Poland, grant no 2016/21/B/NZ8/00831. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=cadmium" title="cadmium">cadmium</a>, <a href="https://publications.waset.org/abstracts/search?q=cell%20death" title=" cell death"> cell death</a>, <a href="https://publications.waset.org/abstracts/search?q=digestive%20system" title=" digestive system"> digestive system</a>, <a href="https://publications.waset.org/abstracts/search?q=ultrastructure" title=" ultrastructure"> ultrastructure</a> </p> <a href="https://publications.waset.org/abstracts/90370/activation-of-apoptosis-in-the-midgut-epithelium-of-spodoptera-exigua-hubner-lepidoptera-noctuidae-exposed-to-various-cadmium-concentration" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/90370.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">214</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">4</span> Understanding the Effect of Fall Armyworm and Integrated Pest Management Practices on the Farm Productivity and Food Security in Malawi</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Innocent%20Pangapanga">Innocent Pangapanga</a>, <a href="https://publications.waset.org/abstracts/search?q=Eric%20Mungatana"> Eric Mungatana</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Fall armyworm (FAW) (Spodoptera frugiperda), an invasive lepidopteran pest, has caused substantial yield loss since its first detection in September 2016, thereby threatening the farm productivity food security and poverty reduction initiatives in Malawi. Several stakeholders, including households, have adopted chemical pesticides to control FAW without accounting for its costs on welfare, health and the environment. Thus, this study has used panel data endogenous switching regression model to investigate the impact of FAW and the integrated pest management (IPM) –related practices on-farm productivity and food security. The study finds that FAW substantively reduces farm productivity by seven (7) percent and influences the adoption of IPM –related practices, namely, intercropping, mulching, and agroforestry, by 6 percent, ceteris paribus. Interestingly, multiple adoptions of the IPM -related practices noticeably increase farm productivity by 21 percent. After accounting for potential endogeneity through the endogenous switching regression model, the IPM practices further demonstrate tenfold more improvement on food security, implying the role of the IPM –related practices in containing the effect of FAW at the household level. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=hunger" title="hunger">hunger</a>, <a href="https://publications.waset.org/abstracts/search?q=invasive%20fall%20army%20worms" title=" invasive fall army worms"> invasive fall army worms</a>, <a href="https://publications.waset.org/abstracts/search?q=integrated%20pest%20management%20practices" title=" integrated pest management practices"> integrated pest management practices</a>, <a href="https://publications.waset.org/abstracts/search?q=farm%20productivity" title=" farm productivity"> farm productivity</a>, <a href="https://publications.waset.org/abstracts/search?q=endogenous%20switching%20regression" title=" endogenous switching regression"> endogenous switching regression</a> </p> <a href="https://publications.waset.org/abstracts/147296/understanding-the-effect-of-fall-armyworm-and-integrated-pest-management-practices-on-the-farm-productivity-and-food-security-in-malawi" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/147296.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">138</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">3</span> NeuroBactrus, a Novel, Highly Effective, and Environmentally Friendly Recombinant Baculovirus Insecticide</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Yeon%20Ho%20Je">Yeon Ho Je</a> </p> <p class="card-text"><strong>Abstract:</strong></p> A novel recombinant baculovirus, NeuroBactrus, was constructed to develop an improved baculovirus insecticide with additional beneficial properties, such as a higher insecticidal activity and improved recovery, compared to wild-type baculovirus. For the construction of NeuroBactrus, the Bacillus thuringiensis crystal protein gene (here termed cry1-5) was introduced into the Autographa californica nucleopolyhedrovirus (AcMNPV) genome by fusion of the polyhedrin–cry1-5–polyhedrin genes under the control of the polyhedrin promoter. In the opposite direction, an insect-specific neurotoxin gene, AaIT, from Androctonus australis was introduced under the control of an early promoter from Cotesia plutellae bracovirus by fusion of a partial fragment of orf603. The polyhedrin–Cry1-5–polyhedrin fusion protein expressed by the NeuroBactrus was not only occluded into the polyhedra, but it was also activated by treatment with trypsin, resulting in an_65-kDa active toxin. In addition, quantitative PCR revealed that the neurotoxin was expressed from the early phase of infection. NeuroBactrus showed a high level of insecticidal activity against Plutella xylostella larvae and a significant reduction in the median lethal time against Spodoptera exigua larvae compared to those of wild-type AcMNPV. Rerecombinant mutants derived from NeuroBactrus in which AaIT and/or cry1-5 were deleted were generated by serial passages in vitro. Expression of the foreign proteins (B. thuringiensis toxin and AaIT) was continuously reduced during the serial passage of the NeuroBactrus. Moreover, polyhedra collected from S. exigua larvae infected with the serially passaged NeuroBactrus showed insecticidal activity similar to that of wild-type AcMNPV. These results suggested that NeuroBactrus could be recovered to wild-type AcMNPV through serial passaging. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=baculovirus" title="baculovirus">baculovirus</a>, <a href="https://publications.waset.org/abstracts/search?q=insecticide" title=" insecticide"> insecticide</a>, <a href="https://publications.waset.org/abstracts/search?q=neurotoxin" title=" neurotoxin"> neurotoxin</a>, <a href="https://publications.waset.org/abstracts/search?q=neurobactrus" title=" neurobactrus"> neurobactrus</a> </p> <a href="https://publications.waset.org/abstracts/26296/neurobactrus-a-novel-highly-effective-and-environmentally-friendly-recombinant-baculovirus-insecticide" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/26296.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">318</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">2</span> Strategies of Drug Discovery in Insects</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Alaaeddeen%20M.%20Seufi">Alaaeddeen M. Seufi</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Many have been published on therapeutic derivatives from living organisms including insects. In addition to traditional maggot therapy, more than 900 therapeutic products were isolated from insects. Most people look at insects as enemies and others believe that insects are friends. Many beneficial insects rather than Honey Bees, Silk Worms and Shellac insect could insure human-insect friendship. In addition, insects could be MicroFactories, Biosensors or Bioreactors. InsectFarm is an amazing example of the applied research that transfers insects from laboratory to market by Prof Mircea Ciuhrii and co-workers. They worked for 18 years to derive therapeutics from insects. Their research resulted in production of more than 30 commercial medications derived from insects (e.g. Imunomax, Noblesse, etc.). Two general approaches were followed to discover drugs from living organisms. Some laboratories preferred biochemical approach to purify components of the innate immune system of insects and insect metabolites as well. Then the purified components could be tested for many therapeutic trials. Other researchers preferred molecular approach based on proteomic studies. Components of the innate immune system of insects were then tested for their medical activities. Our Laboratory team preferred to induce insect immune system (using oral, topical and injection routes of administration), then a transcriptomic study was done to discover the induced genes and to identify specific biomarkers that can help in drug discovery. Biomarkers play an important role in medicine and in drug discovery and development as well. Optimum biomarker development and application will require a team approach because of the multifaceted nature of biomarker selection, validation, and application. This team uses several techniques such as pharmacoepidemiology, pharmacogenomics, and functional proteomics; bioanalytical development and validation; modeling and simulation to improve and refine drug development. Our Achievements included the discovery of four components of the innate immune system of Spodoptera littoralis and Musca domestica. These components were designated as SpliDef (defesin), SpliLec (lectin), SpliCec (cecropin) and MdAtt (attacin). SpliDef, SpliLec and MdAtt were confirmed as antimicrobial peptides, while SpliCec was additionally confirmed as anticancer peptide. Our current research is going on to achieve something in antioxidants and anticoagulants from insects. Our perspective is to achieve something in the mass production of prototypes of our products and to reach it to the commercial level. These achievements are the integrated contributions of everybody in our team staff. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=AMPs" title="AMPs">AMPs</a>, <a href="https://publications.waset.org/abstracts/search?q=insect" title=" insect"> insect</a>, <a href="https://publications.waset.org/abstracts/search?q=innate%20immunitty" title=" innate immunitty"> innate immunitty</a>, <a href="https://publications.waset.org/abstracts/search?q=therappeutics" title=" therappeutics"> therappeutics</a> </p> <a href="https://publications.waset.org/abstracts/38537/strategies-of-drug-discovery-in-insects" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/38537.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">370</span> </span> </div> </div> <div class="card paper-listing mb-3 mt-3"> <h5 class="card-header" style="font-size:.9rem"><span class="badge badge-info">1</span> Density and Relationships Between the Assassin Bugs Sycanus Falleni Stal and Sycanus Croceovittatus Dohrn (Hemiptera: Reduviidae) and Their Prey (Noctuidae: Lepidoptera) on Corn Biomass in the Hoa Binh Province in Northwest Vietnam</h5> <div class="card-body"> <p class="card-text"><strong>Authors:</strong> <a href="https://publications.waset.org/abstracts/search?q=Truong%20Xuan%20Lam">Truong Xuan Lam</a>, <a href="https://publications.waset.org/abstracts/search?q=Nguyen%20Th%E1%BB%8B%20Phuong%20Lien"> Nguyen Thị Phuong Lien</a>, <a href="https://publications.waset.org/abstracts/search?q=Nguyen%20Quang%20Cuong"> Nguyen Quang Cuong</a>, <a href="https://publications.waset.org/abstracts/search?q=Tran%20Th%E1%BB%8B%20Ngat"> Tran Thị Ngat</a> </p> <p class="card-text"><strong>Abstract:</strong></p> Introduction: Corn biomass is a feed for livestock including dairy cows. The Spodoptera frugiperda, Agrotis ypsilon, Heliothis armigera, Mythimna loreyi (Lepidoptera: Noctuidae) are key pests and very dangerous to Corn biomass crops. These pest species are very difficult to control in the field because of genetic resistance to insecticides. Furthermore, corn biomass is feed for livestock so the use of pesticides is always limited to the lowest level. In Vietnam, the assassin bug species Sycanus falleni and Sycanus croceouittatus (Hemiptera: Reduviidae) are the common predators on trees agricultural ecosystems. The reduviid S. falleni and S. croceouittatus have the potential for biological control of pest insects in cotton, corn and vegetable plants as this species attacks many lepidopteran larvae. Moreover, the nymphal instars and adults of S. falleni and S. croceouittatus can be easily reared in the laboratory by the rice meal moth Corcyra cephalonica (Stainton). To conserve the species S. falleni and S. croceouittatus in Corn biomass field in Northwest Vietnam. The results of this study report on the roles and relationships between S. falleni Stal and S. croceovittatus and their prey (key pests and dangerous to Corn) on Corn biomass to provide the basis for using and conserving the species S. falleni and S. croceouittatus as biological control agents on Corn biomass growing areas in Vietnam. Methods: The survey site is at the field of Corn biomass growing in Hoa Binh Province, Northwest Vietnam. The survey of the density of the assassin bugs species and their prey were conducted in 4 Corn biomass fields (each field = 10,000 m2), each point has an area of 1 m2. The survey was conducted every 10 days (3 times/month). The unit of measurement is individual/m2. The relationship between the density of assassin bug species and their prey is expressed through the correlation coefficient R Results: On Corn biomass in Northwest Vietnam, the S. falleni and S. croceouittatus species are such potential candidates for biocontrol of the fall armyworm S. frugiperda, black cutworm A. ypsilon, cotton bollworm H. armigera Hübner, maize caterpillar M. loreyi. Six species of assassin bugs belonging to the family Reduviidae were recorded on Corn biomass, of which S. falleni and S. croceovittatus were common. The relationship between the density of the group of assassin bugs and species S. fallen and S. croceovittatus had a close relationship with each other. The relationship between the density of the group of assassin bugs and the density of their prey in the Winter crops and Summer-Fall crops was a close relationship with each other. The relationship between the density of the S. falleni and S. croceovittatus species and the density of their prey on the Corn biomass were a close relationship in the Summer-Fall crops and the Winter crops. The S. falleni and S. croceouittatus species are such potential biocontrol of the pests on Corn. Possible to conserve and use them for biological control of the dangerous pests S. frugiperda, A. ypsilon, H. armigera , M. loreyi on Corn in Vietnam. <p class="card-text"><strong>Keywords:</strong> <a href="https://publications.waset.org/abstracts/search?q=corn%20biomass" title="corn biomass">corn biomass</a>, <a href="https://publications.waset.org/abstracts/search?q=prey" title=" prey"> prey</a>, <a href="https://publications.waset.org/abstracts/search?q=biocontrol" title=" biocontrol"> biocontrol</a>, <a href="https://publications.waset.org/abstracts/search?q=relationship" title=" relationship"> relationship</a> </p> <a href="https://publications.waset.org/abstracts/189848/density-and-relationships-between-the-assassin-bugs-sycanus-falleni-stal-and-sycanus-croceovittatus-dohrn-hemiptera-reduviidae-and-their-prey-noctuidae-lepidoptera-on-corn-biomass-in-the-hoa-binh-province-in-northwest-vietnam" class="btn btn-primary btn-sm">Procedia</a> <a href="https://publications.waset.org/abstracts/189848.pdf" target="_blank" class="btn btn-primary btn-sm">PDF</a> <span class="bg-info text-light px-1 py-1 float-right rounded"> Downloads <span class="badge badge-light">34</span> </span> </div> </div> </div> </main> <footer> <div id="infolinks" class="pt-3 pb-2"> <div class="container"> <div style="background-color:#f5f5f5;" class="p-3"> <div class="row"> <div class="col-md-2"> <ul class="list-unstyled"> About <li><a href="https://waset.org/page/support">About Us</a></li> <li><a href="https://waset.org/page/support#legal-information">Legal</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/WASET-16th-foundational-anniversary.pdf">WASET celebrates its 16th foundational anniversary</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Account <li><a href="https://waset.org/profile">My Account</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Explore <li><a href="https://waset.org/disciplines">Disciplines</a></li> <li><a href="https://waset.org/conferences">Conferences</a></li> <li><a href="https://waset.org/conference-programs">Conference Program</a></li> <li><a href="https://waset.org/committees">Committees</a></li> <li><a href="https://publications.waset.org">Publications</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Research <li><a href="https://publications.waset.org/abstracts">Abstracts</a></li> <li><a href="https://publications.waset.org">Periodicals</a></li> <li><a href="https://publications.waset.org/archive">Archive</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Open Science <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Philosophy.pdf">Open Science Philosophy</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Science-Award.pdf">Open Science Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Open-Society-Open-Science-and-Open-Innovation.pdf">Open Innovation</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Postdoctoral-Fellowship-Award.pdf">Postdoctoral Fellowship Award</a></li> <li><a target="_blank" rel="nofollow" href="https://publications.waset.org/static/files/Scholarly-Research-Review.pdf">Scholarly Research Review</a></li> </ul> </div> <div class="col-md-2"> <ul class="list-unstyled"> Support <li><a href="https://waset.org/page/support">Support</a></li> <li><a href="https://waset.org/profile/messages/create">Contact Us</a></li> <li><a href="https://waset.org/profile/messages/create">Report Abuse</a></li> </ul> </div> </div> </div> </div> </div> <div class="container text-center"> <hr style="margin-top:0;margin-bottom:.3rem;"> <a href="https://creativecommons.org/licenses/by/4.0/" target="_blank" class="text-muted small">Creative Commons Attribution 4.0 International License</a> <div id="copy" class="mt-2">© 2024 World Academy of Science, Engineering and Technology</div> </div> </footer> <a href="javascript:" id="return-to-top"><i class="fas fa-arrow-up"></i></a> <div class="modal" id="modal-template"> <div class="modal-dialog"> <div class="modal-content"> <div class="row m-0 mt-1"> <div class="col-md-12"> <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">×</span></button> </div> </div> <div class="modal-body"></div> </div> </div> </div> <script src="https://cdn.waset.org/static/plugins/jquery-3.3.1.min.js"></script> <script src="https://cdn.waset.org/static/plugins/bootstrap-4.2.1/js/bootstrap.bundle.min.js"></script> <script src="https://cdn.waset.org/static/js/site.js?v=150220211556"></script> <script> jQuery(document).ready(function() { /*jQuery.get("https://publications.waset.org/xhr/user-menu", function (response) { jQuery('#mainNavMenu').append(response); });*/ jQuery.get({ url: "https://publications.waset.org/xhr/user-menu", cache: false }).then(function(response){ jQuery('#mainNavMenu').append(response); }); }); </script> </body> </html>