COVID-19: Clinical aspects and therapeutics responses

<!DOCTYPE html> <html lang="en" > <head > <meta charset="UTF-8" /> <meta http-equiv="X-UA-Compatible" content="IE=edge" /> <meta name="HandheldFriendly" content="True" /> <meta name="MobileOptimized" content="320" /> <meta name="viewport" content="width=device-width, initial-scale=1.0" /> <link rel="stylesheet" href="/static/assets/style-70b9163a.css" /> <script type="module" crossorigin="" src="/static/assets/base_style-ec2bc71e.js"></script> <link rel="stylesheet" href="/static/assets/style-ef962842.css" /> <link rel="stylesheet" href="/static/assets/style-3ade8b5c.css" /> <script type="module" crossorigin="" src="/static/assets/article_style-d757a0dd.js"></script> <style> @media screen and (min-width: 64em) { div.pmc-wm { background: repeat-y; background-image: url("data:image/svg+xml,%3Csvg xmlns='http://www.w3.org/2000/svg' width='20' height='350' xmlns:xlink='http://www.w3.org/1999/xlink'%3E%3Cdefs%3E%3Cfilter x='-.02' y='0' width='1.05' height='1' id='c'%3E%3CfeFlood flood-color='%23FFF'/%3E%3CfeComposite in='SourceGraphic'/%3E%3C/filter%3E%3Ctext id='b' font-family='Helvetica' font-size='11pt' style='opacity:1;fill:%23005ea2;stroke:none;text-anchor:middle' x='175' y='14'%3E%3C/text%3E%3Cpath id='a' style='fill:%23005ea2' d='M0 8h350v3H0z'/%3E%3C/defs%3E%3Cuse xlink:href='%23a' transform='rotate(90 10 10)'/%3E%3Cuse xlink:href='%23b' transform='rotate(90 10 10)' filter='url(%23c)'/%3E%3C/svg%3E"); padding-left: 3rem; } } </style> <link rel="apple-touch-icon" sizes="180x180" href="/static/img/favicons/apple-touch-icon.png" /> <link rel="icon" type="image/png" sizes="48x48" href="/static/img/favicons/favicon-48x48.png" /> <link rel="icon" type="image/png" sizes="32x32" href="/static/img/favicons/favicon-32x32.png" /> <link rel="icon" type="image/png" sizes="16x16" href="/static/img/favicons/favicon-16x16.png" /> <link rel="manifest" href="/static/img/favicons/site.webmanifest" /> <link rel="mask-icon" href="/static/img/favicons/safari-pinned-tab.svg" color="#0071bc" /> <meta name="msapplication-config" content="/static/img/favicons/browserconfig.xml" /> <meta name="theme-color" content="#ffffff" /> <title> COVID-19: Clinical aspects and therapeutics responses - PMC </title>  <meta name="ncbi_app" content="cloudpmc-viewer" /> <meta name="ncbi_db" content="pmc" /> <meta name="ncbi_phid" content="6E4B600B741E3CA303600B003865DD0D.m_1" />  <meta name="ncbi_pdid" content="article" /> <link rel="preconnect" href="https://www.google-analytics.com" /> <link rel="dns-prefetch" href="https://cdn.ncbi.nlm.nih.gov" /> <link rel="preconnect" href="https://code.jquery.com" /> <meta name="ncbi_domain" content="saudipharmj"> <meta name="ncbi_type" content="fulltext"> <meta name="ncbi_pcid" content="journal"> <link rel="canonical" href="https://pmc.ncbi.nlm.nih.gov/articles/PMC7332461/"> <meta name="robots" content="INDEX,NOFOLLOW,NOARCHIVE"> <meta name="citation_journal_title" content="Saudi Pharmaceutical Journal : SPJ"> <meta name="citation_title" content="COVID-19: Clinical aspects and therapeutics responses"> <meta name="citation_author" content="Suliman Khan"> <meta name="citation_author_institution" content="Department of Cerebrovascular Diseases, the Second Affiliated Hospital of Zhengzhou University, Zhengzhou, China"> <meta name="citation_author_institution" content="Henan Medical Key Laboratory of Translational Cerebrovascular Diseases, Zhengzhou, China"> <meta name="citation_author" content="Ashaq Ali"> <meta name="citation_author_institution" content="Wuhan Institute of Virology, Chinese Academy of Sciences, Xiao Hong Shan No.44, Wuhan, China"> <meta name="citation_author_institution" content="University of Chinese Academy of Sciences, Beijing 100049, China"> <meta name="citation_author" content="Hongwei Shi"> <meta name="citation_author_institution" content="Key State Laboratory of Virology, School of Life Sciences, Wuhan University, Wuhan, China"> <meta name="citation_author" content="Rabeea Siddique"> <meta name="citation_author_institution" content="Department of Cerebrovascular Diseases, the Second Affiliated Hospital of Zhengzhou University, Zhengzhou, China"> <meta name="citation_author_institution" content="Henan Medical Key Laboratory of Translational Cerebrovascular Diseases, Zhengzhou, China"> <meta name="citation_author" content="Shabana"> <meta name="citation_author_institution" content="Wuhan Institute of Virology, Chinese Academy of Sciences, Xiao Hong Shan No.44, Wuhan, China"> <meta name="citation_author_institution" content="University of Chinese Academy of Sciences, Beijing 100049, China"> <meta name="citation_author" content="Ghulam Nabi"> <meta name="citation_author_institution" content="Key Laboratory of Animal Physiology, Biochemistry and Molecular Biology of Hebei Province, College of Life Sciences, Hebei Normal University,Shijiazhuang 050024, China"> <meta name="citation_author" content="Junjie Hu"> <meta name="citation_author_institution" content="Department of Gastrointestinal Surgery , Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China"> <meta name="citation_author" content="Tiejun Wang"> <meta name="citation_author_institution" content="Department of Breast Surgery, Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China"> <meta name="citation_author" content="Men Dong"> <meta name="citation_author_institution" content="Wuhan Institute of Virology, Chinese Academy of Sciences, Xiao Hong Shan No.44, Wuhan, China"> <meta name="citation_author_institution" content="University of Chinese Academy of Sciences, Beijing 100049, China"> <meta name="citation_author" content="Wajid Zaman"> <meta name="citation_author_institution" content="State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China"> <meta name="citation_author" content="Guang Han"> <meta name="citation_author_institution" content="Department of Radiation Oncology, Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China"> <meta name="citation_publication_date" content="2020 Jul 3"> <meta name="citation_volume" content="28"> <meta name="citation_issue" content="8"> <meta name="citation_firstpage" content="1004"> <meta name="citation_doi" content="10.1016/j.jsps.2020.06.022"> <meta name="citation_pmid" content="32788835"> <meta name="citation_abstract_html_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC7332461/"> <meta name="citation_fulltext_html_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC7332461/"> <meta name="citation_pdf_url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC7332461/pdf/main.pdf"> <meta name="description" content="COVID-19 has created havoc in the world by causing thousands of demises in a short period of time. Up till now, several attempts have been made for potential therapeutics against SARS-COV2. In this retrospective, single-center study, we extracted ..."> <meta name="og:title" content="COVID-19: Clinical aspects and therapeutics responses"> <meta name="og:type" content="article"> <meta name="og:site_name" content="PubMed Central (PMC)"> <meta name="og:description" content="COVID-19 has created havoc in the world by causing thousands of demises in a short period of time. Up till now, several attempts have been made for potential therapeutics against SARS-COV2. In this retrospective, single-center study, we extracted ..."> <meta name="og:url" content="https://pmc.ncbi.nlm.nih.gov/articles/PMC7332461/"> <meta name="og:image" content="https://cdn.ncbi.nlm.nih.gov/pmc/cms/images/pmc-card-share.jpg?_=0"> <meta name="twitter:card" content="summary_large_image"> <meta name="twitter:site" content="@ncbi"> </head> <body > <a class="usa-skipnav " href="#main-content"> Skip to main content </a> <section class="usa-banner " aria-label="Official website of the United States government" > <div class="usa-accordion"> <header class="usa-banner__header"> <div class="usa-banner__inner"> <div class="grid-col-auto"> <img aria-hidden="true" class="usa-banner__header-flag" src="/static/img/us_flag.svg" alt="" /> </div> <div class="grid-col-fill tablet:grid-col-auto" aria-hidden="true"> <p class="usa-banner__header-text"> An official website of the United States government </p> <span class="usa-banner__header-action">Here's how you know</span> </div> <button type="button" class="usa-accordion__button usa-banner__button " aria-expanded="false" aria-controls="gov-banner-default" data-testid="storybook-django-banner" > <span class="usa-banner__button-text">Here's how you know</span> </button> </div> </header> <div class="usa-banner__content usa-accordion__content" id="gov-banner-default" hidden> <div class="grid-row grid-gap-lg"> <div class="usa-banner__guidance tablet:grid-col-6"> <img class="usa-banner__icon usa-media-block__img" src="/static/img/icon-dot-gov.svg" alt="" aria-hidden="true" /> <div class="usa-media-block__body"> <p> <strong>Official websites use .gov</strong> <br /> A <strong>.gov</strong> website belongs to an official government organization in the United States. </p> </div> </div> <div class="usa-banner__guidance tablet:grid-col-6"> <img class="usa-banner__icon usa-media-block__img" src="/static/img/icon-https.svg" alt="" aria-hidden="true" /> <div class="usa-media-block__body"> <p> <strong>Secure .gov websites use HTTPS</strong> <br /> A <strong>lock</strong> ( <span class="icon-lock"> <svg xmlns="http://www.w3.org/2000/svg" width="52" height="64" viewBox="0 0 52 64" class="usa-banner__lock-image" role="graphics-symbol" aria-labelledby="banner-lock-description" focusable="false"> <title id="banner-lock-title">Lock</title> <desc id="banner-lock-description"> Locked padlock icon </desc> <path fill="#000000" fill-rule="evenodd" d="M26 0c10.493 0 19 8.507 19 19v9h3a4 4 0 0 1 4 4v28a4 4 0 0 1-4 4H4a4 4 0 0 1-4-4V32a4 4 0 0 1 4-4h3v-9C7 8.507 15.507 0 26 0zm0 8c-5.979 0-10.843 4.77-10.996 10.712L15 19v9h22v-9c0-6.075-4.925-11-11-11z" /> </svg> </span>) or <strong>https://</strong> means you've safely connected to the .gov website. Share sensitive information only on official, secure websites. </p> </div> </div> </div> </div> </div> </section> <div class="usa-overlay"> </div> <header class="usa-header usa-header--extended usa-header--wide" data-testid="header" data-header > <div class="ncbi-header"> <div class="ncbi-header__container"> <a class="ncbi-header__logo-container" href="/"> <img alt=" PMC home page " class="ncbi-header__logo-image" src="/static/img/ncbi-logos/nih-nlm-ncbi--white.svg" /> </a>  <button type="button" class="usa-menu-btn ncbi-header__hamburger-button " aria-label="Show menu" data-testid="navMenuButton" > <svg aria-hidden="true" class="ncbi-hamburger-icon" fill="none" focusable="false" height="21" viewBox="0 0 31 21" width="31" xmlns="http://www.w3.org/2000/svg"> <path clip-rule="evenodd" d="M0.125 20.75H30.875V17.3333H0.125V20.75ZM0.125 12.2083H30.875V8.79167H0.125V12.2083ZM0.125 0.25V3.66667H30.875V0.25H0.125Z" fill="#F1F1F1" fill-rule="evenodd" /> </svg> </button>  <div class="ncbi-header__desktop-buttons">  <button type="button" class="usa-button usa-button--unstyled ncbi-header__desktop-button " aria-expanded="false" aria-controls="search-field-desktop-navigation" aria-label="Show search overlay" data-testid="toggleSearchPanelButton" data-toggle-search-panel-button > <svg class="usa-icon " role="graphics-symbol" aria-hidden="true" > <use xlink:href="/static/img/sprite.svg#search" /> </svg> Search </button>  <div class="ncbi-header__login-dropdown"> <button type="button" class="usa-button usa-button--unstyled ncbi-header__desktop-button ncbi-header__login-dropdown-button " aria-expanded="false" aria-controls="login-dropdown-menu" aria-label="Show login menu" data-testid="toggleLoginMenuDropdown" data-desktop-login-button > <svg class="usa-icon " role="graphics-symbol" aria-hidden="true" > <use xlink:href="/static/img/sprite.svg#person" /> </svg> <span data-login-dropdown-text>Log in</span>  <svg class="usa-icon ncbi-header__login-dropdown-icon ncbi-header__login-dropdown-icon--expand-less ncbi-header__login-dropdown-icon--hidden" role="graphics-symbol" aria-hidden="true" data-login-dropdown-up-arrow> <use xlink:href="/static/img/sprite.svg#expand_less" /> </svg>  <svg class="usa-icon ncbi-header__login-dropdown-icon ncbi-header__login-dropdown-icon--expand-more ncbi-header__login-dropdown-icon--hidden" role="graphics-symbol" aria-hidden="true" data-login-dropdown-down-arrow> <use xlink:href="/static/img/sprite.svg#expand_more" /> </svg> </button>  <ul class="usa-nav__submenu ncbi-header__login-dropdown-menu" id="login-dropdown-menu" data-desktop-login-menu-dropdown hidden> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/myncbi/" class="usa-link " > Dashboard </a> </li> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/myncbi/collections/bibliography/" class="usa-link " > Publications </a> </li> <li class="usa-nav__submenu-item">  <a href="https://www.ncbi.nlm.nih.gov/account/settings/" class="usa-link " > Account settings </a> </li> <li class="usa-nav__submenu-item"> <button type="button" class="usa-button usa-button--outline ncbi-header__login-dropdown-logout-button " data-testid="desktopLogoutButton" data-desktop-logout-button > Log out </button> </li> </ul> </div> </div> </div> </div>  <div class="ncbi-search-panel ncbi--show-only-at-desktop" data-testid="searchPanel" data-header-search-panel hidden> <div class="ncbi-search-panel__container"> <form action="https://www.ncbi.nlm.nih.gov/search/all/" aria-describedby="search-field-desktop-navigation-help-text" autocomplete="off" class="usa-search usa-search--big ncbi-search-panel__form" data-testid="form" method="GET" role="search"> <label class="usa-sr-only" data-testid="label" for="search-field-desktop-navigation"> Search… </label> <input class="usa-input" data-testid="textInput" id="search-field-desktop-navigation" name="term" placeholder="Search NCBI" type="search" value="" /> <button type="submit" class="usa-button " data-testid="button" > <span class="usa-search__submit-text"> Search NCBI </span> </button> </form> </div> </div> <nav aria-label="Primary navigation" class="usa-nav"> <p class="usa-sr-only" id="primary-navigation-sr-only-title"> Primary site navigation </p>  <button type="button" class="usa-nav__close ncbi-nav__close-button " aria-label="Close navigation menu" data-testid="navCloseButton" > <img src="/static/img/usa-icons/close.svg" alt="Close" /> </button>  <form class="usa-search usa-search--small ncbi--hide-at-desktop margin-top-6" role="search"> <label class="usa-sr-only" for="search-field"> Search </label> <input class="usa-input" id="search-field-mobile-navigation" type="search" placeholder="Search NCBI" name="search" /> <button type="submit" class="usa-button " >  <img src="data:image/svg+xml;base64,PHN2ZyB4bWxucz0iaHR0cDovL3d3dy53My5vcmcvMjAwMC9zdmciIGhlaWdodD0iMjQiIHZpZXdCb3g9IjAgMCAyNCAyNCIgd2lkdGg9IjI0Ij48cGF0aCBkPSJNMCAwaDI0djI0SDB6IiBmaWxsPSJub25lIi8+PHBhdGggZmlsbD0iI2ZmZiIgZD0iTTE1LjUgMTRoLS43OWwtLjI4LS4yN0E2LjQ3MSA2LjQ3MSAwIDAgMCAxNiA5LjUgNi41IDYuNSAwIDEgMCA5LjUgMTZjMS42MSAwIDMuMDktLjU5IDQuMjMtMS41N2wuMjcuMjh2Ljc5bDUgNC45OUwyMC40OSAxOWwtNC45OS01em0tNiAwQzcuMDEgMTQgNSAxMS45OSA1IDkuNVM3LjAxIDUgOS41IDUgMTQgNy4wMSAxNCA5LjUgMTEuOTkgMTQgOS41IDE0eiIvPjwvc3ZnPg==" class="usa-search__submit-icon" alt="Search" /> </button> </form>   <div class="ncbi-nav__mobile-login-menu ncbi--hide-at-desktop" data-mobile-login-menu hidden> <p class="ncbi-nav__mobile-login-menu-status"> Logged in as: <strong class="ncbi-nav__mobile-login-menu-email" data-mobile-login-email-text></strong> </p> <ul class="usa-nav__primary usa-accordion"> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/myncbi/" class="usa-link " > Dashboard </a> </li> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/myncbi/collections/bibliography/" class="usa-link " > Publications </a> </li> <li class="usa-nav__primary-item"> <a href="https://www.ncbi.nlm.nih.gov/account/settings/" class="usa-link " > Account settings </a> </li> </ul> </div> <button type="button" class="usa-button ncbi-nav__mobile-login-button ncbi--hide-at-desktop " data-testid="mobileLoginButton" data-mobile-login-button > Log in </button> </nav> </header> <section class="pmc-header pmc-header--basic" aria-label="PMC Header with search box"> <div class="pmc-nav-container"> <div class="pmc-header__bar"> <div class="pmc-header__logo"> <a href="/" title="Home" aria-label="PMC Home"></a> </div> <button type="button" class="usa-button usa-button--unstyled pmc-header__search__button" aria-label="Open search" data-ga-category="search" data-ga-action="PMC" data-ga-label="pmc_search_panel_mobile" > <svg class="usa-icon width-4 height-4 pmc-icon__open" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#search"></use> </svg> <svg class="usa-icon width-4 height-4 pmc-icon__close" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#close"></use> </svg> </button> </div> <div class="pmc-header__search"> <form class="usa-search usa-search--extra usa-search--article-right-column pmc-header__search__form" autocomplete="off" role="search"> <label class="usa-sr-only" for="pmc-search">Search PMC Full-Text Archive</label> <span class="autoComplete_wrapper flex-1"> <input class="usa-input width-full maxw-none" required="required" placeholder="Search PMC Full-Text Archive" id="pmc-search" type="search" name="term" data-autocomplete-url="/search/autocomplete/"/> </span> <button class="usa-button" type="submit" formaction="https://www.ncbi.nlm.nih.gov/pmc/" data-ga-category="search" data-ga-action="PMC" data-ga-label="PMC_search_button" > <span class="usa-search__submit-text">Search in PMC</span> <img src="/static/img/usa-icons-bg/search--white.svg" class="usa-search__submit-icon" alt="Search" /> </button> </form> <ul class="pmc-header__search__menu"> <li> <a class="usa-link" href="https://www.ncbi.nlm.nih.gov/pmc/advanced/" data-ga-action="featured_link" data-ga-label="advanced_search"> Advanced Search </a> </li> <li> <a class="usa-link" href="/journals/" data-ga-action="featured_link" data-ga-label="journal list"> Journal List </a> </li> <li> <a class="usa-link" href="/about/userguide/" data-ga-action="featured_link" data-ga-label="user guide"> User Guide </a> </li> </ul> </div> </div> </section> <div class="usa-section padding-top-0 desktop:padding-top-6 pmc-article-section" data-article-db="pmc" data-article-id="7332461"> <div class="grid-container pmc-actions-bar" aria-label="Actions bar" role="complementary"> <div class="grid-row"> <div class="grid-col-fill display-flex"> <div class="display-flex"> <ul class="usa-list usa-list--unstyled usa-list--horizontal"> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex mob"> <button type="button" class="usa-button pmc-sidenav__container__open usa-button--unstyled width-auto display-flex" aria-label="Open resources" data-extra-class="is-visible-resources" data-ga-category="resources_accordion" data-ga-action="click" data-ga-label="mobile_icon" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#more_vert"></use> </svg> </button> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex mob"> <a href="https://doi.org/10.1016/j.jsps.2020.06.022" class="usa-link display-flex" role="button" target="_blank" rel="noreferrer noopener" aria-label="View on publisher site" data-ga-category="actions" data-ga-action="click" data-ga-label="publisher_link_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#launch"></use> </svg> </a> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <a href="pdf/main.pdf" class="usa-link display-flex" role="button" aria-label="Download PDF" data-ga-category="actions" data-ga-action="click" data-ga-label="pdf_download_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> </a> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <button class="usa-button usa-button--unstyled collections-dialog-trigger collections-button display-flex collections-button-empty" aria-label="Save article in MyNCBI collections." data-ga-category="actions" data-ga-action="click" data-ga-label="collections_button_mobile" data-collections-open-dialog-enabled="false" data-collections-open-dialog-url="https://account.ncbi.nlm.nih.gov/?back_url=https%3A%2F%2Fpmc.ncbi.nlm.nih.gov%2Farticles%2FPMC7332461%2F%23open-collections-dialog" data-in-collections="false" > <svg class="usa-icon width-4 height-4 usa-icon--bookmark-full" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-full.svg#icon"></use> </svg> <svg class="usa-icon width-4 height-4 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-empty.svg#icon"></use> </svg> </button> </li> <li class="margin-right-2 mobile-lg:margin-right-4 display-flex"> <button role="button" class="usa-button usa-button--unstyled citation-dialog-trigger display-flex" aria-label="Open dialog with citation text in different styles" data-ga-category="actions" data-ga-action="open" data-ga-label="cite_mobile" data-all-citations-url="/resources/citations/7332461/" data-citation-style="nlm" data-download-format-link="/resources/citations/7332461/export/" > <svg class="usa-icon width-4 height-4 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#format_quote"></use> </svg> </button> </li> <li class="pmc-permalink display-flex"> <button type="button" class="usa-button usa-button--unstyled display-flex" aria-label="Show article permalink" aria-expanded="false" aria-haspopup="true" data-ga-category="actions" data-ga-action="open" data-ga-label="permalink_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#share"></use> </svg> </button> <div class="pmc-permalink__dropdown" hidden> <div class="pmc-permalink__dropdown__container"> <h2 class="usa-modal__heading margin-top-0 margin-bottom-2">PERMALINK</h2> <div class="pmc-permalink__dropdown__content"> <input type="text" class="usa-input" value="https://pmc.ncbi.nlm.nih.gov/articles/PMC7332461/" aria-label="Article permalink"> <button class="usa-button display-inline-flex pmc-permalink__dropdown__copy__btn margin-right-0" title="Copy article permalink" data-ga-category="save_share" data-ga-action="link" data-ga-label="copy_link"> <svg class="usa-icon" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span class="margin-left-1">Copy</span> </button> </div> </div> </div> </li> </ul> </div> <button type="button" class="usa-button pmc-sidenav__container__open usa-button--unstyled width-auto display-flex" aria-label="Open article navigation" data-extra-class="is-visible-in-page" data-ga-category="actions" data-ga-action="open" data-ga-label="article_nav_mobile" > <svg class="usa-icon width-4 height-4" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#list"></use> </svg> </button> </div> </div> </div> <div class="grid-container desktop:padding-left-6"> <div id="article-container" class="grid-row grid-gap"> <div class="grid-col-12 desktop:grid-col-8 order-2 pmc-layout__content"> <div class="grid-container padding-left-0 padding-right-0"> <div class="grid-row desktop:margin-left-neg-6"> <div class="grid-col-12"> <div class="pmc-layout__disclaimer" role="complementary" aria-label="Disclaimer note"> As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health.<br/> Learn more: <a class="usa-link" data-ga-category="Link click" data-ga-action="Disclaimer" data-ga-label="New disclaimer box" href="/about/disclaimer/">PMC Disclaimer</a> | <a class="usa-link" data-ga-category="Link click" data-ga-action="PMC Copyright Notice" data-ga-label="New disclaimer box" href="/about/copyright/"> PMC Copyright Notice </a> </div> </div> </div> <div class="grid-row pmc-wm desktop:margin-left-neg-6">  <main id="main-content" class="usa-layout-docs__main usa-layout-docs grid-col-12 pmc-layout pmc-prose padding-0" > <section class="pmc-journal-banner text-center line-height-none" aria-label="Journal banner"><img src="https://cdn.ncbi.nlm.nih.gov/pmc/banners/logo-saudipharmj.gif" alt="Saudi Pharmaceutical Journal : SPJ logo" usemap="#pmc-banner-imagemap" width="500" height="75"><map name="pmc-banner-imagemap"><area alt="Link to Saudi Pharmaceutical Journal : SPJ" title="Link to Saudi Pharmaceutical Journal : SPJ" shape="default" href="http://www.journals.elsevier.com/saudi-pharmaceutical-journal" target="_blank" rel="noopener noreferrer"></map></section><article lang="en"><section aria-label="Article citation and metadata"><section class="pmc-layout__citation font-secondary font-xs"><div> <div class="display-inline-block"><button type="button" class="cursor-pointer text-no-underline bg-transparent border-0 padding-0 text-left margin-0 text-normal text-primary" aria-controls="journal_context_menu">Saudi Pharm J</button></div>. 2020 Jul 3;28(8):1004–1008. doi: <a href="https://doi.org/10.1016/j.jsps.2020.06.022" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">10.1016/j.jsps.2020.06.022</a> </div> <nav id="journal_context_menu" hidden="hidden"><ul class="menu-list font-family-ui" role="menu"> <li role="presentation"><a href="https://www.ncbi.nlm.nih.gov/pmc/?term=%22Saudi%20Pharm%20J%22%5Bjour%5D" class="usa-link" role="menuitem">Search in PMC</a></li> <li role="presentation"><a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Saudi%20Pharm%20J%22%5Bjour%5D" lang="en" class="usa-link" role="menuitem">Search in PubMed</a></li> <li role="presentation"><a href="https://www.ncbi.nlm.nih.gov/nlmcatalog?term=%22Saudi%20Pharm%20J%22%5BTitle%20Abbreviation%5D" class="usa-link" role="menuitem">View in NLM Catalog</a></li> <li role="presentation"><a href="?term=%22Saudi%20Pharm%20J%22%5Bjour%5D" class="usa-link" role="menuitem" data-add-to-search="true">Add to search</a></li> </ul></nav></section><section class="front-matter"><div class="ameta p font-secondary font-xs"> <hgroup><h1>COVID-19: Clinical aspects and therapeutics responses</h1></hgroup><div class="cg p"> <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Khan%20S%22%5BAuthor%5D" class="usa-link" aria-describedby="id1"><span class="name western">Suliman Khan</span></a><div hidden="hidden" id="id1"> <h3><span class="name western">Suliman Khan</span></h3> <div class="p"> <sup>a</sup>Department of Cerebrovascular Diseases, the Second Affiliated Hospital of Zhengzhou University, Zhengzhou, China</div> <div class="p"> <sup>b</sup>Henan Medical Key Laboratory of Translational Cerebrovascular Diseases, Zhengzhou, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Khan%20S%22%5BAuthor%5D" class="usa-link"><span class="name western">Suliman Khan</span></a> </div> </div> <sup>a,</sup><sup>b,</sup><sup>1,</sup><sup>⁎</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Ali%20A%22%5BAuthor%5D" class="usa-link" aria-describedby="id2"><span class="name western">Ashaq Ali</span></a><div hidden="hidden" id="id2"> <h3><span class="name western">Ashaq Ali</span></h3> <div class="p"> <sup>c</sup>Wuhan Institute of Virology, Chinese Academy of Sciences, Xiao Hong Shan No.44, Wuhan, China</div> <div class="p"> <sup>d</sup>University of Chinese Academy of Sciences, Beijing 100049, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Ali%20A%22%5BAuthor%5D" class="usa-link"><span class="name western">Ashaq Ali</span></a> </div> </div> <sup>c,</sup><sup>d,</sup><sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Shi%20H%22%5BAuthor%5D" class="usa-link" aria-describedby="id3"><span class="name western">Hongwei Shi</span></a><div hidden="hidden" id="id3"> <h3><span class="name western">Hongwei Shi</span></h3> <div class="p"> <sup>e</sup>Key State Laboratory of Virology, School of Life Sciences, Wuhan University, Wuhan, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Shi%20H%22%5BAuthor%5D" class="usa-link"><span class="name western">Hongwei Shi</span></a> </div> </div> <sup>e,</sup><sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Siddique%20R%22%5BAuthor%5D" class="usa-link" aria-describedby="id4"><span class="name western">Rabeea Siddique</span></a><div hidden="hidden" id="id4"> <h3><span class="name western">Rabeea Siddique</span></h3> <div class="p"> <sup>a</sup>Department of Cerebrovascular Diseases, the Second Affiliated Hospital of Zhengzhou University, Zhengzhou, China</div> <div class="p"> <sup>b</sup>Henan Medical Key Laboratory of Translational Cerebrovascular Diseases, Zhengzhou, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Siddique%20R%22%5BAuthor%5D" class="usa-link"><span class="name western">Rabeea Siddique</span></a> </div> </div> <sup>a,</sup><sup>b,</sup><sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Shabana%22%5BAuthor%5D" class="usa-link" aria-describedby="id5"><span class="name western">Shabana</span></a><div hidden="hidden" id="id5"> <h3><span class="name western">Shabana</span></h3> <div class="p"> <sup>c</sup>Wuhan Institute of Virology, Chinese Academy of Sciences, Xiao Hong Shan No.44, Wuhan, China</div> <div class="p"> <sup>d</sup>University of Chinese Academy of Sciences, Beijing 100049, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Shabana%22%5BAuthor%5D" class="usa-link"><span class="name western">Shabana</span></a> </div> </div> <sup>c,</sup><sup>d,</sup><sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Nabi%20G%22%5BAuthor%5D" class="usa-link" aria-describedby="id6"><span class="name western">Ghulam Nabi</span></a><div hidden="hidden" id="id6"> <h3><span class="name western">Ghulam Nabi</span></h3> <div class="p"> <sup>f</sup>Key Laboratory of Animal Physiology, Biochemistry and Molecular Biology of Hebei Province, College of Life Sciences, Hebei Normal University,Shijiazhuang 050024, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Nabi%20G%22%5BAuthor%5D" class="usa-link"><span class="name western">Ghulam Nabi</span></a> </div> </div> <sup>f,</sup><sup>1</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Hu%20J%22%5BAuthor%5D" class="usa-link" aria-describedby="id7"><span class="name western">Junjie Hu</span></a><div hidden="hidden" id="id7"> <h3><span class="name western">Junjie Hu</span></h3> <div class="p"> <sup>g</sup>Department of Gastrointestinal Surgery , Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Hu%20J%22%5BAuthor%5D" class="usa-link"><span class="name western">Junjie Hu</span></a> </div> </div> <sup>g</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Wang%20T%22%5BAuthor%5D" class="usa-link" aria-describedby="id8"><span class="name western">Tiejun Wang</span></a><div hidden="hidden" id="id8"> <h3><span class="name western">Tiejun Wang</span></h3> <div class="p"> <sup>h</sup>Department of Breast Surgery, Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Wang%20T%22%5BAuthor%5D" class="usa-link"><span class="name western">Tiejun Wang</span></a> </div> </div> <sup>h</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Dong%20M%22%5BAuthor%5D" class="usa-link" aria-describedby="id9"><span class="name western">Men Dong</span></a><div hidden="hidden" id="id9"> <h3><span class="name western">Men Dong</span></h3> <div class="p"> <sup>c</sup>Wuhan Institute of Virology, Chinese Academy of Sciences, Xiao Hong Shan No.44, Wuhan, China</div> <div class="p"> <sup>d</sup>University of Chinese Academy of Sciences, Beijing 100049, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Dong%20M%22%5BAuthor%5D" class="usa-link"><span class="name western">Men Dong</span></a> </div> </div> <sup>c,</sup><sup>d</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Zaman%20W%22%5BAuthor%5D" class="usa-link" aria-describedby="id10"><span class="name western">Wajid Zaman</span></a><div hidden="hidden" id="id10"> <h3><span class="name western">Wajid Zaman</span></h3> <div class="p"> <sup>i</sup>State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Zaman%20W%22%5BAuthor%5D" class="usa-link"><span class="name western">Wajid Zaman</span></a> </div> </div> <sup>i</sup>, <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Han%20G%22%5BAuthor%5D" class="usa-link" aria-describedby="id11"><span class="name western">Guang Han</span></a><div hidden="hidden" id="id11"> <h3><span class="name western">Guang Han</span></h3> <div class="p"> <sup>j</sup>Department of Radiation Oncology, Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China</div> <div class="p">Find articles by <a href="https://pubmed.ncbi.nlm.nih.gov/?term=%22Han%20G%22%5BAuthor%5D" class="usa-link"><span class="name western">Guang Han</span></a> </div> </div> <sup>j,</sup><sup>⁎</sup> </div> <ul class="d-buttons inline-list"> <li><button class="d-button" aria-controls="aip_a" aria-expanded="false">Author information</button></li> <li><button class="d-button" aria-controls="anp_a" aria-expanded="false">Article notes</button></li> <li><button class="d-button" aria-controls="clp_a" aria-expanded="false">Copyright and License information</button></li> </ul> <div class="d-panels font-secondary-light"> <div id="aip_a" class="d-panel p" style="display: none"> <div class="p" id="af005"> <sup>a</sup>Department of Cerebrovascular Diseases, the Second Affiliated Hospital of Zhengzhou University, Zhengzhou, China</div> <div id="af010"> <sup>b</sup>Henan Medical Key Laboratory of Translational Cerebrovascular Diseases, Zhengzhou, China</div> <div id="af015"> <sup>c</sup>Wuhan Institute of Virology, Chinese Academy of Sciences, Xiao Hong Shan No.44, Wuhan, China</div> <div id="af020"> <sup>d</sup>University of Chinese Academy of Sciences, Beijing 100049, China</div> <div id="af025"> <sup>e</sup>Key State Laboratory of Virology, School of Life Sciences, Wuhan University, Wuhan, China</div> <div id="af030"> <sup>f</sup>Key Laboratory of Animal Physiology, Biochemistry and Molecular Biology of Hebei Province, College of Life Sciences, Hebei Normal University,Shijiazhuang 050024, China</div> <div id="af035"> <sup>g</sup>Department of Gastrointestinal Surgery , Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China</div> <div id="af050"> <sup>h</sup>Department of Breast Surgery, Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China</div> <div id="af040"> <sup>i</sup>State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China</div> <div id="af045"> <sup>j</sup>Department of Radiation Oncology, Hubei Cancer Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China</div> <div class="author-notes p"> <div class="fn" id="cor1"> <sup>⁎</sup><p class="display-inline">Corresponding authors. <span>suliman.khan18@mails.ucas.ac.cn</span><span>hg7913@hotmail.com</span></p> </div> <div class="fn" id="fn1"> <sup>1</sup><p class="display-inline" id="np010">Equally Contributed.</p> </div> </div> </div> <div id="anp_a" class="d-panel p" style="display: none"><div class="notes p"><section id="historyarticle-meta1" class="history"><p>Received 2020 Jun 5; Accepted 2020 Jun 30; Issue date 2020 Aug.</p></section></div></div> <div id="clp_a" class="d-panel p" style="display: none"> <div>© 2020 The Author(s)</div> <p>This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).</p> <div class="p"><a href="/about/copyright/" class="usa-link">PMC Copyright notice</a></div> </div> </div> <div>PMCID: PMC7332461 PMID: <a href="https://pubmed.ncbi.nlm.nih.gov/32788835/" class="usa-link">32788835</a> </div> </div></section></section><section aria-label="Article content"><section class="body main-article-body"><section class="abstract" id="ab005"><h2>Abstract</h2> <p>COVID-19 has created havoc in the world by causing thousands of demises in a short period of time. Up till now, several attempts have been made for potential therapeutics against SARS-COV2. In this retrospective, single-center study, we extracted data from 122 COVID-19, RT-PCR confirmed patients. who were treated with a new treatment strategy of lianhuaqingwen with Arbidol Hydrochloride. The patients were either asymptomatic or had mild symptoms for COVID-19 disease. Of 122 patients 21 (17.21%) patients developed severe conditions of COVID-19, while total 111 (90.9%) experienced mild symptoms such as fever in 93 (76.22%) patients, cough in 23 (20.17%) and muscle pain were observed in total 8 (7%) patients. Furthermore our newly applied drugs combination (Lianhuaqingwen and Arbidol Hydrochloride) showed therapeutic effects in 5–7 days in patients with mild symptoms with 98% recovery rate. These results indicate that COVID-19 patients with mild symptoms can be treated with Lianhuaqingwen and Arbidol Hydrochloride. However, extensive clinical investigations are required to confirm the effectiveness of these drugs.</p> <section id="kg005" class="kwd-group"><p><strong>Keywords:</strong> COVID-19, Therapeutics, Mild symptoms, TCM, Recoveries</p></section></section><section id="s0005"><h2 class="pmc_sec_title">1. Introduction</h2> <p id="p0025">COVID-19 caused by SARS-CoV has been declared as a global pandemic by WHO on March 11, 2020. The disease has paralyzed the world and is currently causing thousands of mortalities and morbidities worldwide (<a href="#b0055" class="usa-link" aria-describedby="b0055">Khan et al., 2020</a>, <a href="#b0040" class="usa-link" aria-describedby="b0040">Hamza et al., 2020</a>). Besides transmission and biological features, previous studies have largely focused on clinical characteristics and treatment responses. At the outset, a total of 41 cases of COVID-19 reported by <a href="#b0050" class="usa-link" aria-describedby="b0050">Huang et al. (2020)</a> manifested fever, dry cough, myalgia, fatigue, and pneumonia, which in severe cases caused organ dysfunction(<a href="#b0050" class="usa-link" aria-describedby="b0050">Huang et al., 2020</a>). Similarly, <a href="#b0080" class="usa-link" aria-describedby="b0080">Wang et al. (2020)</a> studied the clinical features from 138 patients and found that these patients revealed, fever (98%), fatigue (70%), and dry nonproductive cough (60%) (<a href="#b0080" class="usa-link" aria-describedby="b0080">Wang et al., 2020</a>). In addition, <a href="#b0035" class="usa-link" aria-describedby="b0035">Guan et al. (2020)</a> reported that fever was developed in only 43% of COVID-19 patients on admission, however, the number increased to 88.7% during hospitalization (<a href="#b0035" class="usa-link" aria-describedby="b0035">Guan et al., 2020</a>). On the other hand, studies have also focused on the recovery from COVID-19 in response to treatment with antiviral drugs such as, remdesivir and chloroquine were found effective against COVID-19 disease (<a href="#b0090" class="usa-link" aria-describedby="b0090">Li et al., 2020</a>, <a href="#b0075" class="usa-link" aria-describedby="b0075">Studemeister et al., 2020</a>, <a href="#b0030" class="usa-link" aria-describedby="b0030">Gao et al., 2020</a>). Recently, a Traditional Chinese Medicine (TCM) called Lianhuaqingwen (LH) has received enormous attention in China, particularly in treating COVID-19 patients with mild symptoms. The effect of LH can be enhanced through its combinational therapy with arbidol Hydrochloride (<a href="#b0085" class="usa-link" aria-describedby="b0085">Yang et al., 2020</a>).</p> <p id="p0030">LH is a Chinese patent medicine composed of Herbs. The major ingredients of LH consisted of <em>Lonicera japonica</em>, <em>Forsythia suspensa</em>, <em>Isatis indigotica</em>, <em>Ephedra sinica</em>, <em>Pogostemon cablin</em>, <em>Rheum palmatum</em>, <em>Glycyrrhiza uralensis</em>, <em>Houttuynia cordata</em>, <em>Dryopteris crassirhizoma</em>, <em>Rhodiola crenulata</em>, <em>Prunus sibirica</em>, gypsum and 1-mentho (<a href="#b0045" class="usa-link" aria-describedby="b0045">Hu et al., 2020</a>). LH exerted broad-spectrum activities on a number of influenza viruses by inhibiting viral propagation and regulating immune responces and exhibited similar therapeutic efficacy while used with Oseltamivir in reducing the course of H1N1 virus infection (<a href="#b0025" class="usa-link" aria-describedby="b0025">Duan et al., 2011</a>). LH showed its anti-coronavirus activity by inhibiting virus replication and decreasing the cytokine release from host recently reported by (<a href="#b0070" class="usa-link" aria-describedby="b0070">Runfeng et al., 2020</a>) However, limited details are available regarding the recovery of patients with mild symptoms or asymptomatic patients. in response to the combination of Traditional Chinese Medicines (TCM), antiviral drugs, and/or antibiotics. In this study, we briefly demonstrate the characteristics of 122 hospitalized patients with COVID-19 and compare them with previously reported information. We further report the effectiveness of LH in combination with the antiviral drug for COVID-19 in asymptomatic patients or patients with mild symptoms.</p></section><section id="s0010"><h2 class="pmc_sec_title">2. Methods</h2> <section id="s0015"><h3 class="pmc_sec_title">2.1. Study design</h3> <p id="p0035">This retrospective, cohort, single-center study was conducted in Wuchang Fencang hospital, a makeshift hospital in Wuhan, Hubei China. Patients were admitted to the Fenceng hospital after the onset of the specified symptoms and based on selected criteria such as if an individual RT-PCR test were found positive or respiratory rate > 30 and blood oxygen saturation > 93%. All cases in this study were confirmed according to WHO recommended laboratory diagnosis guidelines. The clinical outcomes (i-e admission, length of stay, discharged, and mortality) were monitored from Feb-4, 2020 to March 17, 2020. The data including demographic data exposure history, signs and symptoms, medical history, laboratory findings, and chest computed tomographic (CT) scan were reviewed by a team of trained and experienced physicians. The date of disease onset defined from the day when the first symptoms were noticed (symptomatic patients) or the SARS-CoV-2 was detected in samples (in case of asymptomatic patients). Treatment strategies were recommended by expert medical team, mainly composed of physicians (infection department, respiratory department, endocrinology department, oncology department, traditional Chinese medicine department, and psychology department, etc.), radiologists, and laboratory doctors and the responses were observed until the termination of treatment. Informed consent was obtained from patients and permission was obtained from the National Health Commission of China regarding the publication of this data.</p></section><section id="s0020"><h3 class="pmc_sec_title">2.2. Definitions</h3> <p id="p0040">The severity of COVID-19 was defined by satisfying at least one of these factors; the ratio of the partial pressure of arterial oxygen (PaO2) to the fraction of inspired oxygen (FiO2) 300 mmHg (1 mmHg ¼ 0.133 kPa) breathing rate > 30/min and pulse oximeter oxygen saturation at rest < 93%, Critical illness if satisfying at least one of the following items, the respiratory failure occurred and individuals received mechanical ventilation, failure of other organs, shock, and received care in the intensive care unit.</p></section><section id="s0025"><h3 class="pmc_sec_title">2.3. Laboratory confirmation</h3> <p id="p0045">RT PCR was performed for detection of SARS-CoV-2 in nasal swab samples from the COVID-19 patients or suspected individuals, according to the established protocol by the Chinese Center for Disease Control (<a href="#b0050" class="usa-link" aria-describedby="b0050">Huang et al., 2020</a>). Two genes, nucleocapsid protein (N) and Open Reading Frame1ab (ORF1ab) were amplified and targeted by RT-PCR. Target 1 (<em>ORF1ab</em>): Forward primer CCCTGTGGGTTTTACACTTAA, Reverse primer as ACGATTGTGCATCAGCTGA; Probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. For Target 2 (N): Forward primer GGGGAACTTCTCCTGCTAGAAT; and Reverse primer CAGACATTTTGCTCTCAAGCTG; with Probe as 5′-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3′. The extracted RNA was assayed for real-time RT-PCR using a SARS-COV2 nucleic acid detection kit as per the manufacturer’s protocol (Shanghai bio germ Medical Technology Co Ltd).</p></section><section id="s0030"><h3 class="pmc_sec_title">2.4. Statistical analysis</h3> <p id="p0050">The statistical analyses were performed using software R, where different parameters were described in percentages, frequency rates, and continuous variables described via Interquartile range (IQR) mean and median. IQR Interquartile Range.</p></section></section><section id="s0035"><h2 class="pmc_sec_title">3. Results</h2> <p id="p0055">The median age of patients in this study was 49 years comprised of 70 (57.3%) females and 52 (42.27%) males. Of these patients total of 8 (6.5%) were found asymptomatic (<a href="#t0005" class="usa-link">Table 1</a>). At the onset of the disease, fever [93 (76.22%) patients], cough [23 (20.17%) patients] and muscle pain [8 (7%) patients] were the most common symptoms, and less common symptoms were diarrhea, nausea, headache, and vomiting <a href="#f0005" class="usa-link">Figure 1</a>. The median duration of stay in the hospital was 18 days, and the average incubation period was 7 days. The significant alternation in laboratory findings during hospitalization was a high level of C reactive protein, lymphopenia, increases in WBC, and neutrophil count (<a href="#t0010" class="usa-link">Table 2</a>). Out of the total 122 patient 111 recovered, female accounted (n = 60, 54%) and (n = 42, 37%) were male, with median hospitalization of 17.99 days. However, 21 patients were shifted to another hospital including 11 (9%) female and 10 (8.1%) male, where the majority (n = 17, 81%) were later recovered.</p> <section class="tw xbox font-sm" id="t0005"><h3 class="obj_head">Table 1.</h3> <div class="caption p"><p>Baseline characteristics of COVID-19 Patients.</p></div> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"> <thead><tr> <th colspan="1" rowspan="1">Gender (total = 122)</th> <th colspan="1" rowspan="1">Number</th> <th colspan="1" rowspan="1">%</th> </tr></thead> <tbody> <tr> <td colspan="1" rowspan="1">Female</td> <td colspan="1" rowspan="1">70</td> <td colspan="1" rowspan="1">57.37</td> </tr> <tr> <td colspan="1" rowspan="1">Male</td> <td colspan="1" rowspan="1">52</td> <td colspan="1" rowspan="1">42.6</td> </tr> <tr> <td colspan="1" rowspan="1">Mean</td> <td colspan="1" rowspan="1">49.2</td> <td colspan="1" rowspan="1">–</td> </tr> <tr> <td colspan="1" rowspan="1">Median</td> <td colspan="1" rowspan="1">49</td> <td colspan="1" rowspan="1">–</td> </tr> <tr> <td colspan="1" rowspan="1">Range</td> <td colspan="1" rowspan="1">11–72</td> <td colspan="1" rowspan="1">–</td> </tr> <tr> <td colspan="1" rowspan="1"><strong>Symptoms</strong></td> <td colspan="1" rowspan="1"></td> <td colspan="1" rowspan="1"></td> </tr> <tr> <td colspan="1" rowspan="1">Fever (including low fever)</td> <td colspan="1" rowspan="1">93</td> <td colspan="1" rowspan="1">76.22</td> </tr> <tr> <td colspan="1" rowspan="1">Cough</td> <td colspan="1" rowspan="1">23</td> <td colspan="1" rowspan="1">18.85</td> </tr> <tr> <td colspan="1" rowspan="1">Muscle pain</td> <td colspan="1" rowspan="1">8</td> <td colspan="1" rowspan="1">6.56</td> </tr> <tr> <td colspan="1" rowspan="1">Fatigue</td> <td colspan="1" rowspan="1">7</td> <td colspan="1" rowspan="1">5.74</td> </tr> <tr> <td colspan="1" rowspan="1">Shortness of breath</td> <td colspan="1" rowspan="1">7</td> <td colspan="1" rowspan="1">5.74</td> </tr> <tr> <td colspan="1" rowspan="1">Diarrhea</td> <td colspan="1" rowspan="1">6</td> <td colspan="1" rowspan="1">4.92</td> </tr> <tr> <td colspan="1" rowspan="1">headache</td> <td colspan="1" rowspan="1">3</td> <td colspan="1" rowspan="1">2.46</td> </tr> <tr> <td colspan="1" rowspan="1">Sore throat</td> <td colspan="1" rowspan="1">3</td> <td colspan="1" rowspan="1">2.46</td> </tr> <tr> <td colspan="1" rowspan="1">nausea</td> <td colspan="1" rowspan="1">2</td> <td colspan="1" rowspan="1">1.64</td> </tr> <tr> <td colspan="1" rowspan="1">Sputum</td> <td colspan="1" rowspan="1">2</td> <td colspan="1" rowspan="1">1.64</td> </tr> <tr> <td colspan="1" rowspan="1">Nasal congestion</td> <td colspan="1" rowspan="1">1</td> <td colspan="1" rowspan="1">0.82</td> </tr> </tbody> </table></div> <div class="p text-right font-secondary"><a href="table/t0005/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></section><figure class="fig xbox font-sm" id="f0005"><h3 class="obj_head">Fig. 1.</h3> <p class="img-box line-height-none margin-x-neg-2 tablet:margin-x-0 text-center"><a class="tileshop" target="_blank" href="https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=7414069_gr1.jpg"><img class="graphic zoom-in" src="https://cdn.ncbi.nlm.nih.gov/pmc/blobs/45e0/7414069/d45422fd7b00/gr1.jpg" loading="lazy" height="615" width="645" alt="Fig. 1"></a></p> <div class="p text-right font-secondary"><a href="figure/f0005/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div> <figcaption><p>Ratio of Sign and Symptoms of in 122, COVID-19 Patients.</p></figcaption></figure><section class="tw xbox font-sm" id="t0010"><h3 class="obj_head">Table 2.</h3> <div class="caption p"><p>Laboratory Findings of COVID-19 Patients.</p></div> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"> <thead><tr> <th colspan="1" rowspan="1">Blood</th> <th colspan="1" rowspan="1">Median (IQR)</th> </tr></thead> <tbody> <tr> <td colspan="1" rowspan="1">WBC</td> <td colspan="1" rowspan="1">1.725 (2.18–11.14)</td> </tr> <tr> <td colspan="1" rowspan="1">Neutrophil count</td> <td colspan="1" rowspan="1">1.44 (1.13–8.53)</td> </tr> <tr> <td colspan="1" rowspan="1">Lymphocytes count</td> <td colspan="1" rowspan="1">0.64 (0.57–3.45)</td> </tr> <tr> <td colspan="1" rowspan="1">ALY# 10^9/L</td> <td colspan="1" rowspan="1">0.01 (0–0.05)</td> </tr> <tr> <td colspan="1" rowspan="1">RBC (/L)</td> <td colspan="1" rowspan="1">0.625 (1.9–6.06)</td> </tr> <tr> <td colspan="1" rowspan="1">NRBC# 10^9/L</td> <td colspan="1" rowspan="1">1.955 (0.13–79.71)</td> </tr> <tr> <td colspan="1" rowspan="1">HGB (g/L)</td> <td colspan="1" rowspan="1">18 (48–166)</td> </tr> <tr> <td colspan="1" rowspan="1">Platelets 10^9/L</td> <td colspan="1" rowspan="1">165 (125–188)</td> </tr> <tr> <td colspan="1" rowspan="1">FR-CRP (mg/L)</td> <td colspan="1" rowspan="1">7.59 (0.08–173.81)</td> </tr> <tr> <td colspan="1" rowspan="1">hs-CRP (mg/L)</td> <td colspan="1" rowspan="1">2.3125 (0.08->10)</td> </tr> <tr> <td colspan="1" rowspan="1">CRP (mg/L)</td> <td colspan="1" rowspan="1">38.645 (<10–10.43)</td> </tr> </tbody> </table></div> <div class="p text-right font-secondary"><a href="table/t0010/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></section><p id="p0060">Both patients with mild symptoms and asymptomatic, received TCM LH Capsule in combination with Arbidol Hydrochloride tablets, with dosage and duration detail in (<a href="#t0015" class="usa-link">Table 3</a>). This newly applied combination showed effects in 5–7 days for patients with mild symptoms and was found effective with 98% recovery rate. As a result, no mechanical support was required to any of the recovered patients, during the overall course treatment. Interestingly the recovery response of the aged people and patients with other coexisting conditions such as asthma and hypertension were also noticeable. A total 47 (85%) out of 55 with the age of 60 or above were fully recovered. Similarly, in the age group of 40–60 total 61 (81.3%) patients were recovered. In our observations, this strategy with zero adverse effects (<a href="#t0020" class="usa-link">Table 4</a>) demonstrated significant recovery responses from all age groups. Moreover, the severity and complications of the COVID-19 were found in male patients as compared to female patients. However asymptomatic cases were found in females more which can be potential source of infection.</p> <section class="tw xbox font-sm" id="t0015"><h3 class="obj_head">Table 3.</h3> <div class="caption p"><p>Treatment Strategy for mild or asymptomatic COVID-19 Patients.</p></div> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"><tbody> <tr> <td colspan="1" rowspan="1"> <strong>S. No</strong><hr> </td> <td colspan="1" rowspan="1"> <strong>Medicine Chinese/Western</strong><hr> </td> <td colspan="1" rowspan="1"> <strong>Disease stage</strong><hr> </td> <td rowspan="3" colspan="1"> <strong>Out comes/ Complication</strong><ul id="l0005" class="list" style="list-style-type:none"> <li id="o0005"> <span class="label">•</span><p class="display-inline" id="p0005">Drug shows effects in 5 to 7 days after they receive the medicine treatment.</p> </li> <li id="o0010"> <span class="label">•</span><p class="display-inline" id="p0010">Asymptomatic or mild symptom mostly observed in females. These features make female higher potential source of infection</p> </li> <li id="o0015"> <span class="label">•</span><p class="display-inline" id="p0015">111/122 patients recovered initially, where total 60/111(54%) were female while 42/111 (37%) were male.</p> </li> <li id="o0020"> <span class="label">•</span><p class="display-inline" id="p0020">Total 21 patients with severe conditions shifted to another hospital where 19 recovered while 2 were still hospitalized.</p> </li> </ul> </td> </tr> <tr> <td colspan="1" rowspan="1">1.</td> <td colspan="1" rowspan="1">i. Arbidol Hydrochloride<br>(2 tables/each time, three times one day) for 5 days<br>ii. TCM* (Lianghua Qingwen)<br>(4 capsules/each time, three times one day) for 10 to 14 days.</td> <td colspan="1" rowspan="1">Mild Symptoms/ Asymptomatic confirmed<br>All 122 (100%) Patients received this combination</td> </tr> <tr> <td colspan="1" rowspan="1">2.</td> <td colspan="1" rowspan="1">Moxifloxacin‘Hydrochloride<br>(1 table/each time, one times one day) for 7–14 days along with combination S.No.1</td> <td colspan="1" rowspan="1">Symptomatic Patients with Fever, cough, muscle pain etc.Total 39 Patients received this additional Antibiotics</td> </tr> </tbody></table></div> <div class="p text-right font-secondary"><a href="table/t0015/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></section><section class="tw xbox font-sm" id="t0020"><h3 class="obj_head">Table 4.</h3> <div class="caption p"><p>Age and Gender wise recovery responses groups.</p></div> <div class="tbl-box p" tabindex="0"><table class="content" frame="hsides" rules="groups"> <thead> <tr> <th colspan="1" rowspan="1">Number of Patients with age group<br>Total 122</th> <th colspan="3" rowspan="1">Recovered Patients.<br>111/122<br>(90.9%)<hr> </th> <th colspan="3" rowspan="1">Serious<br>21/122<br>17.2%<hr> </th> </tr> <tr> <th colspan="1" rowspan="1"></th> <th colspan="1" rowspan="1"></th> <th colspan="1" rowspan="1">Male</th> <th colspan="1" rowspan="1">Female</th> <th colspan="1" rowspan="1"></th> <th colspan="1" rowspan="1">Male</th> <th colspan="1" rowspan="1">Female</th> </tr> </thead> <tbody> <tr> <td colspan="1" rowspan="1">4 < 30 y</td> <td colspan="1" rowspan="1">4 (100%)</td> <td colspan="1" rowspan="1">01 (25%)</td> <td colspan="1" rowspan="1">03 (75%)</td> <td colspan="1" rowspan="1">0</td> <td colspan="1" rowspan="1">NA</td> <td colspan="1" rowspan="1">NA</td> </tr> <tr> <td colspan="1" rowspan="1">22 (30–40)</td> <td colspan="1" rowspan="1">18 (81.8%)</td> <td colspan="1" rowspan="1">07 (38%)</td> <td colspan="1" rowspan="1">11 (61%)</td> <td colspan="1" rowspan="1">04 (18.1%)</td> <td colspan="1" rowspan="1">01 (25%)</td> <td colspan="1" rowspan="1">03 (75%)</td> </tr> <tr> <td colspan="1" rowspan="1">41 (40–50)</td> <td colspan="1" rowspan="1">32 (78%)</td> <td colspan="1" rowspan="1">11 (34.3)</td> <td colspan="1" rowspan="1">21 (65.6%)</td> <td colspan="1" rowspan="1">09 (21.9%)</td> <td colspan="1" rowspan="1">04 (44.4%)</td> <td colspan="1" rowspan="1">05 (55.5%)</td> </tr> <tr> <td colspan="1" rowspan="1">34 (50–60)</td> <td colspan="1" rowspan="1">29 (85%)</td> <td colspan="1" rowspan="1">13 (44.8%)</td> <td colspan="1" rowspan="1">16 (55.1%)</td> <td colspan="1" rowspan="1">05 (14.7%)</td> <td colspan="1" rowspan="1">02 (40%)</td> <td colspan="1" rowspan="1">03 (60%)</td> </tr> <tr> <td colspan="1" rowspan="1">20 (60–70)</td> <td colspan="1" rowspan="1">17 (85%)</td> <td colspan="1" rowspan="1">09 (52.9%)</td> <td colspan="1" rowspan="1">08 (47%)</td> <td colspan="1" rowspan="1">03 (15%)</td> <td colspan="1" rowspan="1">0266.6%)</td> <td colspan="1" rowspan="1">01 (33.3%)</td> </tr> <tr> <td colspan="1" rowspan="1">1 > 70 y</td> <td colspan="1" rowspan="1">1 (100%)</td> <td colspan="1" rowspan="1">N/A</td> <td colspan="1" rowspan="1">01</td> <td colspan="1" rowspan="1">0</td> <td colspan="1" rowspan="1">N/A</td> <td colspan="1" rowspan="1">N/A</td> </tr> </tbody> </table></div> <div class="p text-right font-secondary"><a href="table/t0020/" class="usa-link" target="_blank" rel="noopener noreferrer">Open in a new tab</a></div></section></section><section id="s0040"><h2 class="pmc_sec_title">4. Discussion</h2> <p id="p0065">Findings of the current study have shown that the treatment of COVID-19 patients with LH capsule in combination with Arbidol Hydrochloride resulted in significant recovery. Out of 122 patients, 111 were fully recovered and discharged from the hospital. However, with higher infection proportion in females, our finding confers recently published results (<a href="#b0080" class="usa-link" aria-describedby="b0080">Wang et al., 2020</a>), while disagreeing with the early report by Chen et al. (<a href="#b0010" class="usa-link" aria-describedby="b0010">Chen et al., 2020</a>), which showed that males are most likely affected by COVID-19. Moreover, we found that asymptomatic cases were more common in females, as reported earlier (<a href="#b0065" class="usa-link" aria-describedby="b0065">Noelle Breslin et al., 2020</a>). Similarly another study showed that the majority of COVID-19 infected females developed mild symptoms and recovered quickly as compared male patients (<a href="#b0060" class="usa-link" aria-describedby="b0060">Liu et al., 2020</a>). No convincing evidence is available to support the phenomenon that most of the females develop mild symptoms or remain asymptomatic. However, it is well konwn that women are less susceptible to viral infections as compared to men due differences in innate immunity factors related to sex chromosomes and steroidal hormones (<a href="#b0015" class="usa-link" aria-describedby="b0015">Conti, 2020</a>), which could be one of the reasons that most of the COVID-19 infected females do not develop severe symptoms. The occurrences and risk of COVID-19 infection are similar in different ages there are no significant differences found, unlike reported previously (<a href="#b0050" class="usa-link" aria-describedby="b0050">Huang et al., 2020</a>).</p> <p id="p0070">Furthermore, the combination of LH and Aribidol Hydrochrolride we applied showed significant effects against COVID-19 in 5 to 7 days (Table No.4), where the symptoms reduced very rapidly as compared to many other tested drugs including Arbidol Hydrochloride, when used alone or in combination with other drugs (<a href="#b0090" class="usa-link" aria-describedby="b0090">Li et al., 2020</a>, <a href="#b0005" class="usa-link" aria-describedby="b0005">Ashraf et al., 2020</a>). It may be due to the mechanism of action of LH (<a href="#b0020" class="usa-link" aria-describedby="b0020">Dong et al., 2014</a>) that can effectively reduce systematic and airway inflammation by regulation of immune systems through inhibiting the release of the corresponding inflammatory factors. Moreover, recovery responses of patients aged over 60 years were also notable with 85% recovery, indicating that Arbidol’s role by inhibiting the fusion of the viral envelope to the target host cell membrane (<a href="#b0060" class="usa-link" aria-describedby="b0060">Liu et al., 2020</a>) and LH anti-inflammation role are supportive to elderly recovery.</p> <p id="p0075">By applying this new treatment strategy, the mild symptoms were relieved without the application of mechanical or any other therapeutics support. However, patients with bacterial infection additionally received Moxifloxacin Hydrochloride. Despite the interesting results presented in this study, the combination of TCM with western medicines should further be investigated prior to clinical recommendation for COVID-19 patients on large scale. This will help determining the most promising therapeutic combination against COVID-19 disease.</p></section><section id="s0045"><h2 class="pmc_sec_title">5. Conclusion</h2> <p id="p0080">The ratio of patients remained asymptomatic and patients with mild symptoms was found higher in females as compaored to males, suggesting that males are more suscepitible to develope symptoms. Furthermore, the combination of LH with Aribidol hydrochloride can be used as effective therapeutic option against COVID-19, specifically in the case of patients with mild symptoms. However further studies and clinical investigations are recommended to confirm its efficacy.</p></section><section id="s0050"><h2 class="pmc_sec_title">6. Ethics approval and consent to participate</h2> <p id="p0085">Approval was obtained from the National Health Commission of China, Hospital Institutional eview board approval and informed patient’s consent was obtained.</p></section><section id="s0055"><h2 class="pmc_sec_title">Funding</h2> <p id="p0090">This project received the funding from the Postdoctoral research grants from the Second Affiliated Hospital of Zhengzhou University, Zhengzhou China and the Chinese Postdoctoral Science Foundation (for S.K.).</p></section><section id="s0060"><h2 class="pmc_sec_title">Contributors</h2> <p id="p0095">J.Hu, T. Wang, G. Han conducted the main study and collected the data, S.Khan analyzed the data, A.Ali and S.Khan conceived the idea and wrote initial draft, R.Siddique, and Shabana did the literature search and wrote the initial draft, and S.Khan, G. Nabi, G. Han, W.Zaman M.Dong review, revised the final manuscript.</p></section><section id="sec13"><h2 class="pmc_sec_title">Declaration of Competing Interest</h2> <p id="p0100">The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.</p></section><section id="ak005" class="ack"><h2 class="pmc_sec_title">Acknowledgments</h2> <p>The authors acknowledge grant support from the National Natural Science Foundation of China (grant numbers 81870942, 81471174 and 81520108011) and CAS-TWAS Fellowship Programme by Chinese Academy of Sciences.</p></section><section id="fn-group1" class="fn-group"><h2 class="pmc_sec_title">Footnotes</h2> <div class="fn-group p font-secondary-light font-sm"><div class="fn p" id="d32e436"><p id="np005">Peer review under responsibility of King Saud University.</p></div></div></section><section id="_ci93_" lang="en" class="contrib-info"><h2 class="pmc_sec_title">Contributor Information</h2> <p>Suliman Khan, Email: suliman.khan18@mails.ucas.ac.cn.</p> <p>Guang Han, Email: hg7913@hotmail.com.</p></section><section id="bi005" class="ref-list"><h2 class="pmc_sec_title">References</h2> <section id="bi005_sec2"><ol class="ref-list font-sm"> <li id="b0005"><cite>Ashraf, M.A., Shokouhi, N., Shirali, E., Davari-tanha, F., Memar, O., Kamalipour, A., Azarnoush, A., Mabadi, A., Ossareh, A., Sanginabadi, M., Mokhtari Azad, T., Aghaghazvini, L., Ghaderkhani, S., Poordast, T., Pourdast, A., Nazemi, P., 2020. COVID-19 in Iran, a comprehensive investigation from exposure to treatment outcomes. MedRxiv, 2020.04.20.20072421. https://doi.org/10.1101/2020.04.20.20072421.</cite></li> <li id="b0010"> <cite>Chen N., Zhou M., Dong X., Qu J., Gong F., Han Y., Qiu Y., Wang J., Liu Y., Wei Y., Xia J., Yu T., Zhang X., Zhang L. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study. The Lancet. 2020;395(10223):507–513. doi: 10.1016/S0140-6736(20)30211-7.</cite> [<a href="https://doi.org/10.1016/S0140-6736(20)30211-7" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7135076/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32007143/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=The%20Lancet&title=Epidemiological%20and%20clinical%20characteristics%20of%2099%20cases%20of%202019%20novel%20coronavirus%20pneumonia%20in%20Wuhan,%20China:%20a%20descriptive%20study&author=N.%20Chen&author=M.%20Zhou&author=X.%20Dong&author=J.%20Qu&author=F.%20Gong&volume=395&issue=10223&publication_year=2020&pages=507-513&pmid=32007143&doi=10.1016/S0140-6736(20)30211-7&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0015"> <cite>Conti P, Y. A., 2020. Coronavirus COV-19/SARS-CoV-2 affects women less than men: clinical response to viral infection. J. Biol. Regul. Homeost Agents. <a href="https://www.ncbi.nlm.nih.gov/pubmed/32253888" class="usa-link" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">https://www.ncbi.nlm.nih.gov/pubmed/32253888</a></cite> [<a href="https://doi.org/10.23812/Editorial-Conti-3" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32253888/" class="usa-link">PubMed</a>]</li> <li id="b0020"> <cite>Dong L., Xia J.W., Gong Y., Chen Z., Yang H.H., Zhang J., He J., Chen X.D. Effect of lianhuaqingwen capsules on airway inflammation in patients with acute exacerbation of chronic obstructive pulmonary disease. Evid.-Based Complement. Alternat. Med. 2014;2014 doi: 10.1155/2014/637969.</cite> [<a href="https://doi.org/10.1155/2014/637969" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC4058171/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/24971150/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Evid.-Based%20Complement.%20Alternat.%20Med.&title=Effect%20of%20lianhuaqingwen%20capsules%20on%20airway%20inflammation%20in%20patients%20with%20acute%20exacerbation%20of%20chronic%20obstructive%20pulmonary%20disease&author=L.%20Dong&author=J.W.%20Xia&author=Y.%20Gong&author=Z.%20Chen&author=H.H.%20Yang&volume=2014&publication_year=2014&pmid=24971150&doi=10.1155/2014/637969&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0025"> <cite>Duan Z.-P., Jia Z.-H., Zhang J., Liu S., Chen Y., Liang L.-C., Zhang C.-Q., Zhang Z., Sun Y., Zhang S.-Q., Wang Y.-Y., Wu Y.-L. Natural herbal medicine Lianhuaqingwen capsule anti-influenza A (H1N1) trial: a randomized, double blind, positive controlled clinical trial. Chin. Med. J. 2011;124(18):2925–2933. <a href="http://europepmc.org/abstract/MED/22040504" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">http://europepmc.org/abstract/MED/22040504</a></cite> [<a href="https://pubmed.ncbi.nlm.nih.gov/22040504/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Chin.%20Med.%20J.&title=Natural%20herbal%20medicine%20Lianhuaqingwen%20capsule%20anti-influenza%20A%20(H1N1)%20trial:%20a%20randomized,%20double%20blind,%20positive%20controlled%20clinical%20trial&author=Z.-P.%20Duan&author=Z.-H.%20Jia&author=J.%20Zhang&author=S.%20Liu&author=Y.%20Chen&volume=124&issue=18&publication_year=2011&pages=2925-2933&pmid=22040504&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0030"> <cite>Gao J., Tian Z., Yang X. Breakthrough: Chloroquine phosphate has shown apparent efficacy in treatment of COVID-19 associated pneumonia in clinical studies. Biosci. Trends. 2020;14(1):72–73. doi: 10.5582/BST.2020.01047.</cite> [<a href="https://doi.org/10.5582/BST.2020.01047" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32074550/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Biosci.%20Trends&title=Breakthrough:%20Chloroquine%20phosphate%20has%20shown%20apparent%20efficacy%20in%20treatment%20of%20COVID-19%20associated%20pneumonia%20in%20clinical%20studies&author=J.%20Gao&author=Z.%20Tian&author=X.%20Yang&volume=14&issue=1&publication_year=2020&pages=72-73&pmid=32074550&doi=10.5582/BST.2020.01047&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0035"> <cite>Guan W., Ni Z., Hu Y., Liang W., Ou C., He J., Liu L., Shan H., Lei C., Hui D.S.C., Du B., Li L., Zeng G., Yuen K.-Y., Chen R., Tang C., Wang T., Chen P., Xiang J., Zhong N. Clinical Characteristics of Coronavirus Disease 2019 in China. N. Engl. J. Med. 2020;1–13 doi: 10.1056/nejmoa2002032.</cite> [<a href="https://doi.org/10.1056/nejmoa2002032" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7092819/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32109013/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=N.%20Engl.%20J.%20Med.&title=Clinical%20Characteristics%20of%20Coronavirus%20Disease%202019%20in%20China&author=W.%20Guan&author=Z.%20Ni&author=Y.%20Hu&author=W.%20Liang&author=C.%20Ou&volume=1%E2%80%9313&publication_year=2020&pmid=32109013&doi=10.1056/nejmoa2002032&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0040"> <cite>Hamza M., Ali A., Khan S., Ahmed S., Attique Z., Rehman S.U., Khan A., Ali H., Rizwan M., Khan A.M., Siddique F., Mehmood A., Hamza M., Ali A., Khan S., Ahmed S., Attique Z. nCOV-19 peptides mass fingerprinting identification, binding, and blocking of inhibitors flavonoids and anthraquinone of Moringa oleifera and hydroxychloroquine. J. Biomol. Struct. Dynam. 2020:1–11. doi: 10.1080/07391102.2020.1778534.</cite> [<a href="https://doi.org/10.1080/07391102.2020.1778534" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7332867/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32567487/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=J.%20Biomol.%20Struct.%20Dynam.&title=nCOV-19%20peptides%20mass%20fingerprinting%20identification,%20binding,%20and%20blocking%20of%20inhibitors%20flavonoids%20and%20anthraquinone%20of%20Moringa%20oleifera%20and%20hydroxychloroquine&author=M.%20Hamza&author=A.%20Ali&author=S.%20Khan&author=S.%20Ahmed&author=Z.%20Attique&publication_year=2020&pages=1-11&pmid=32567487&doi=10.1080/07391102.2020.1778534&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0045"> <cite>Hu, K., Guan, W.-J., Bi, Y., Zhang, W., Li, L., Zhang, B., Liu, Q., Song, Y., Li, X., Duan, Z., Zheng, Q., Yang, Z., Liang, J., Han, M., Ruan, L., Wu, C., Zhang, Y., Jia, Z.-H., Zhong, N.-S., 2020. Efficacy and safety of Lianhuaqingwen capsules, a repurposed Chinese herb, in patients with coronavirus disease 2019: A multicenter, prospective, randomized controlled trial. Phytomedicine 153242. 10.1016/j.phymed.2020.153242.</cite> [<a href="https://doi.org/10.1016/j.phymed.2020.153242" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7229744/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/33867046/" class="usa-link">PubMed</a>]</li> <li id="b0050"> <cite>Huang C., Wang Y., Li X., Ren L., Zhao J., Hu Y., Zhang L., Fan G., Xu J., Gu X., Cheng Z., Yu T., Xia J., Wei Y., Wu W., Xie X., Yin W., Li H., Liu M., Cao B. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. The Lancet. 2020;395(10223):497–506. doi: 10.1016/S0140-6736(20)30183-5.</cite> [<a href="https://doi.org/10.1016/S0140-6736(20)30183-5" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7159299/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/31986264/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=The%20Lancet&title=Clinical%20features%20of%20patients%20infected%20with%202019%20novel%20coronavirus%20in%20Wuhan,%20China&author=C.%20Huang&author=Y.%20Wang&author=X.%20Li&author=L.%20Ren&author=J.%20Zhao&volume=395&issue=10223&publication_year=2020&pages=497-506&pmid=31986264&doi=10.1016/S0140-6736(20)30183-5&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0055"> <cite>Khan S., Nabi G., Han G., Siddique R., Lian S., Shi H., Bashir N., Ali A., Shereen M.A. Novel coronavirus : how things are in Wuhan. Clin. Microbiol. Infect. 2020;26(4):399–400. doi: 10.1016/j.cmi.2020.02.005.</cite> [<a href="https://doi.org/10.1016/j.cmi.2020.02.005" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7129990/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32058086/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Clin.%20Microbiol.%20Infect.&title=Novel%20coronavirus%20:%20how%20things%20are%20in%20Wuhan&author=S.%20Khan&author=G.%20Nabi&author=G.%20Han&author=R.%20Siddique&author=S.%20Lian&volume=26&issue=4&publication_year=2020&pages=399-400&pmid=32058086&doi=10.1016/j.cmi.2020.02.005&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0060"><cite>Liu, Q., Fang, X., Tian, L., Chen, X., Chung, U., Wang, K., Li, D., Dai, X., Zhu, Q., Xu, F., Shen, L., Wang, B., Yao, L., & Peng, P., 2020. The effect of Arbidol Hydrochloride on reducing mortality of Covid-19 patients: a retrospective study of real world date from three hospitals in Wuhan. MedRxiv, 2020.04.11.20056523. https://doi.org/10.1101/2020.04.11.20056523.</cite></li> <li id="b0065"> <cite>Noelle Breslin, MD; Caitlin Baptiste, MD; Cynthia Gyamfi-Bannerman, MD, MPH; Russell Miller, MD; Rebecca Martinez, M., Kyra Bernstein, MD; Laurence Ring, MD; Ruth Landau, MD; Stephanie Purisch, MD; Alexander M. Friedman, MD, M., Karin Fuchs, MD; Desmond Sutton, XX; Maria Andrikopoulou, MD; Devon Rupley, MD; Jean-Ju Sheen, MD; Janice Aubey, M., Noelia Zork, MD; Leslie Moroz, MD; Mirella Mourad, MD; Ronald Wapner, MD; Lynn L. Simpson, MD; Mary E. D’Alton, M., & Dena Goffman, M. (2020). Case Series. Am. J. Obstet. Gynecol. MFM, april 9. https://doi.org/10.1016/j.ajogmf.2020.100118.</cite> [<a href="https://doi.org/10.1016/j.ajogmf.2020.100118" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7144599/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32292903/" class="usa-link">PubMed</a>]</li> <li id="b0070"> <cite>Runfeng, L., Yunlong, H., Jicheng, H., Weiqi, P., Qinhai, M., Yongxia, S., Chufang, L., Jin, Z., Zhenhua, J., Haiming, J., Kui, Z., Shuxiang, H., Jun, D., Xiaobo, L., Xiaotao, H., Lin, W., Nanshan, Z., Zifeng, Y., 2020. Lianhuaqingwen exerts anti-viral and anti-inflammatory activity against novel coronavirus (SARS-CoV-2). Pharmacol. Res. 156, 104761. 10.1016/j.phrs.2020.104761.</cite> [<a href="https://doi.org/10.1016/j.phrs.2020.104761" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7102548/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32205232/" class="usa-link">PubMed</a>]</li> <li id="b0075"> <cite>Studemeister A., Redinski J., Ahmed S., Bernett J., Chelliah D., Chen D., Chihara S., Cohen S.H., Cunningham J., Monforte A.D.A., Ismail S., Mera R., Gaggar A., Myers R.P., Brainard D.M., Childs R., Flanigan T. Compassionate Use of Remdesivir for Patients with Severe. 2020;Covid-19:1–10. doi: 10.1056/NEJMoa2007016.</cite> [<a href="https://doi.org/10.1056/NEJMoa2007016" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=Compassionate%20Use%20of%20Remdesivir%20for%20Patients%20with%20Severe&author=A.%20Studemeister&author=J.%20Redinski&author=S.%20Ahmed&author=J.%20Bernett&author=D.%20Chelliah&volume=Covid-19&publication_year=2020&pages=1-10&doi=10.1056/NEJMoa2007016&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0080"> <cite>Wang D., Hu B., Hu C., Zhu F., Liu X., Zhang J., Wang B., Xiang H., Cheng Z., Xiong Y., Zhao Y., Li Y., Wang X., Peng Z. Clinical Characteristics of 138 Hospitalized Patients with 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA – J. Am. Med. Assoc. 2020;323(11):1061–1069. doi: 10.1001/jama.2020.1585.</cite> [<a href="https://doi.org/10.1001/jama.2020.1585" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7042881/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32031570/" class="usa-link">PubMed</a>] [<a href="https://scholar.google.com/scholar_lookup?journal=JAMA%20%E2%80%93%20J.%20Am.%20Med.%20Assoc.&title=Clinical%20Characteristics%20of%20138%20Hospitalized%20Patients%20with%202019%20Novel%20Coronavirus-Infected%20Pneumonia%20in%20Wuhan,%20China&author=D.%20Wang&author=B.%20Hu&author=C.%20Hu&author=F.%20Zhu&author=X.%20Liu&volume=323&issue=11&publication_year=2020&pages=1061-1069&pmid=32031570&doi=10.1001/jama.2020.1585&" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">Google Scholar</a>]</li> <li id="b0085"> <cite>Yang, Y., Islam, S., Wang, J., Li, Y., & Chen, X., 2020. Traditional Chinese Medicine in the Treatment of Patients Infected with 2019-New Coronavirus (SARS-CoV-2): A Review and Perspective. 16. https://doi.org/10.7150/ijbs.45538.</cite> [<a href="https://doi.org/10.7150/ijbs.45538" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7098036/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32226288/" class="usa-link">PubMed</a>]</li> <li id="b0090"> <cite>Li, Y., Xie, Z., Lin, W., Cai, W., Wen, C., Guan, Y., Mo, X., Wang, J., Wang, Y., Peng, P., Chen, X., Hong, W., Xiao, G., Liu, J., Zhang, L., Hu, F., Li, F., Zhang, F., Deng, X., Li, L., 2020. Efficacy and safety of lopinavir/ritonavir or arbidol in adult patients with mild/moderate COVID-19: an exploratory randomized controlled trial. Med. https://doi.org/10.1016/j.medj.2020.04.001</cite> [<a href="https://doi.org/10.1016/j.medj.2020.04.001" class="usa-link usa-link--external" data-ga-action="click_feat_suppl" target="_blank" rel="noopener noreferrer">DOI</a>] [<a href="/articles/PMC7235585/" class="usa-link">PMC free article</a>] [<a href="https://pubmed.ncbi.nlm.nih.gov/32838353/" class="usa-link">PubMed</a>]</li> </ol></section></section></section><footer class="p courtesy-note font-secondary font-sm text-center"><hr class="headless"> <p>Articles from Saudi Pharmaceutical Journal : SPJ are provided here courtesy of <strong>Elsevier</strong></p></footer></section></article> </main> </div> </div> </div>  <div class="pmc-sidenav desktop:grid-col-4 display-flex"> <section class="pmc-sidenav__container" aria-label="Article resources and navigation"> <button type="button" class="usa-button pmc-sidenav__container__close usa-button--unstyled"> <img src="/static/img/usa-icons/close.svg" role="img" alt="Close" /> </button> <div class="display-none desktop:display-block"> <section class="margin-top-4 desktop:margin-top-0"> <h2 class="margin-top-0">ACTIONS</h2> <ul class="usa-list usa-list--unstyled usa-list--actions"> <li> <a href="https://doi.org/10.1016/j.jsps.2020.06.022" class="usa-button usa-button--outline width-24 font-xs usa-link--external padding-left-0 padding-right-0" target="_blank" rel="noreferrer noopener" data-ga-category="actions" data-ga-action="click" data-ga-label="publisher_link_desktop" > <span class="height-3 display-inline-flex flex-align-center">View on publisher site</span> </a> </li> <li> <a href="pdf/main.pdf" class="usa-button usa-button--outline width-24 display-inline-flex flex-align-center flex-justify-start padding-left-1" data-ga-category="actions" data-ga-action="click" data-ga-label="pdf_download_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1">PDF (545.3 KB)</span> </a> </li> <li> <button role="button" class="usa-button width-24 citation-dialog-trigger display-inline-flex flex-align-center flex-justify-start padding-left-1" aria-label="Open dialog with citation text in different styles" data-ga-category="actions" data-ga-action="open" data-ga-label="cite_desktop" data-all-citations-url="/resources/citations/7332461/" data-citation-style="nlm" data-download-format-link="/resources/citations/7332461/export/" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#format_quote"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 button-label">Cite</span> </button> </li> <li> <button class="usa-button width-24 collections-dialog-trigger collections-button display-inline-flex flex-align-center flex-justify-start padding-left-1 collections-button-empty" aria-label="Save article in MyNCBI collections." data-ga-category="actions" data-ga-action="click" data-ga-label="collections_button_desktop" data-collections-open-dialog-enabled="false" data-collections-open-dialog-url="https://account.ncbi.nlm.nih.gov/?back_url=https%3A%2F%2Fpmc.ncbi.nlm.nih.gov%2Farticles%2FPMC7332461%2F%23open-collections-dialog" data-in-collections="false"> <svg class="usa-icon width-3 height-3 usa-icon--bookmark-full" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-full.svg#icon"></use> </svg> <svg class="usa-icon width-3 height-3 usa-icon--bookmark-empty" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/action-bookmark-empty.svg#icon"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1">Collections</span> </button> </li> <li class="pmc-permalink"> <button type="button" class="usa-button usa-button--outline width-24 display-inline-flex flex-align-center flex-justify padding-left-1 shadow-none" aria-label="Show article permalink" aria-expanded="false" aria-haspopup="true" data-ga-category="actions" data-ga-action="open" data-ga-label="permalink_desktop" > <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img" hidden> <use xlink:href="/static/img/sprite.svg#share"></use> </svg> <span class="display-inline-flex flex-justify-center flex-1 button-label">Permalink</span> </button> <div class="pmc-permalink__dropdown" hidden> <div class="pmc-permalink__dropdown__container"> <h2 class="usa-modal__heading margin-top-0 margin-bottom-2">PERMALINK</h2> <div class="pmc-permalink__dropdown__content"> <input type="text" class="usa-input" value="https://pmc.ncbi.nlm.nih.gov/articles/PMC7332461/" aria-label="Article permalink"> <button class="usa-button display-inline-flex pmc-permalink__dropdown__copy__btn margin-right-0" title="Copy article permalink" data-ga-category="save_share" data-ga-action="link" data-ga-label="copy_link"> <svg class="usa-icon" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span class="margin-left-1">Copy</span> </button> </div> </div> </div> </li> </ul> </section> </div> <section class="pmc-resources margin-top-6 desktop:margin-top-4" data-page-path="/articles/PMC7332461/"> <h2 class="margin-top-0">RESOURCES</h2> <div class="usa-accordion usa-accordion--multiselectable" data-allow-multiple> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-similar-articles" data-ga-category="resources_accordion" data-ga-action="open_similar_articles" data-ga-label="/articles/PMC7332461/" data-action-open="open_similar_articles" data-action-close="close_similar_articles" > Similar articles </button> </h3> <div id="resources-similar-articles" class="usa-accordion__content usa-prose" data-source-url="/resources/similar-article-links/32788835/" > </div> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-cited-by-other-articles" data-ga-category="resources_accordion" data-ga-action="open_cited_by" data-ga-label="/articles/PMC7332461/" data-action-open="open_cited_by" data-action-close="close_cited_by" > Cited by other articles </button> </h3> <div id="resources-cited-by-other-articles" class="usa-accordion__content usa-prose" data-source-url="/resources/cited-by-links/32788835/" > </div> <h3 class="usa-accordion__heading"> <button type="button" class="usa-accordion__button" aria-expanded="false" aria-controls="resources-links-to-ncbi-databases" data-ga-category="resources_accordion" data-ga-action="open_NCBI_links" data-ga-label="/articles/PMC7332461/" data-action-open="open_NCBI_links" data-action-close="close_NCBI_link" > Links to NCBI Databases </button> </h3> <div id="resources-links-to-ncbi-databases" class="usa-accordion__content usa-prose" data-source-url="/resources/db-links/7332461/" > </div> </div> </section> <section class="usa-in-page-nav usa-in-page-nav--wide margin-top-6 desktop:margin-top-4" data-title-text="On this page" data-title-heading-level="h2" data-scroll-offset="0" data-root-margin="-10% 0px -80% 0px" data-main-content-selector="main" data-threshold="1" hidden ></section> </section> </div> <div class="overlay" role="dialog" aria-label="Citation Dialog" hidden> <div class="dialog citation-dialog" aria-hidden="true"> <div class="display-inline-flex flex-align-center flex-justify width-full margin-bottom-2"> <h2 class="usa-modal__heading margin-0">Cite</h2> <button type="button" class="usa-button usa-button--unstyled close-overlay text-black width-auto" tabindex="1"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#close"></use> </svg> </button> </div> <div class="citation-text-block"> <div class="citation-text margin-bottom-2"></div> <ul class="usa-list usa-list--unstyled display-inline-flex flex-justify width-full flex-align-center"> <li> <button class="usa-button usa-button--unstyled text-no-underline display-flex flex-align-center copy-button dialog-focus" data-ga-category="save_share" data-ga-action="cite" data-ga-label="copy" tabindex="2"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#content_copy"></use> </svg> <span>Copy</span> </button> </li> <li> <a href="#" role="button" class="usa-button usa-button--unstyled text-no-underline display-flex flex-align-center export-button" data-ga-category="save_share" data-ga-action="cite" data-ga-label="download" title="Download a file for external citation management software" tabindex="3"> <svg class="usa-icon width-3 height-3" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#file_download"></use> </svg> <span class="display-none mobile-lg:display-inline">Download .nbib</span> <span class="display-inline mobile-lg:display-none">.nbib</span> </a> </li> <li> <div class="display-inline-flex flex-align-center"> <label class="usa-label margin-top-0">Format:</label> <select aria-label="Format" class="usa-select citation-style-selector padding-1 margin-top-0 border-0 padding-right-4" tabindex="4" > <option data-style-url-name="ama" value="AMA" > AMA </option> <option data-style-url-name="apa" value="APA" > APA </option> <option data-style-url-name="mla" value="MLA" > MLA </option> <option data-style-url-name="nlm" value="NLM" selected="selected"> NLM </option> </select> </div> </li> </ul> </div> </div> </div> <div class="overlay" role="dialog" hidden> <div id="collections-action-dialog" class="dialog collections-dialog" aria-hidden="true"> <div class="display-inline-flex flex-align-center flex-justify width-full margin-bottom-2"> <h2 class="usa-modal__heading margin-0">Add to Collections</h2> </div> <div class="collections-action-panel action-panel"> <form id="collections-action-dialog-form" class="usa-form maxw-full collections-action-panel-form action-panel-content action-form action-panel-smaller-selectors" data-existing-collections-url="/list-existing-collections/" data-add-to-existing-collection-url="/add-to-existing-collection/" data-create-and-add-to-new-collection-url="/create-and-add-to-new-collection/" data-myncbi-max-collection-name-length="100" data-collections-root-url="https://www.ncbi.nlm.nih.gov/myncbi/collections/"> <input type="hidden" name="csrfmiddlewaretoken" value="wsySFHNobA2IuQQ3czerrxbr2waz54KnnZvF08Qw56acaSytdY6dhAkmsMfQpe0z"> <fieldset class="usa-fieldset margin-bottom-2"> <div class="usa-radio"> <input type="radio" id="collections-action-dialog-new" class="usa-radio__input usa-radio__input--tile collections-new margin-top-0" name="collections" value="new" data-ga-category="collections_button" data-ga-action="click" data-ga-label="collections_radio_new" /> <label class="usa-radio__label" for="collections-action-dialog-new">Create a new collection</label> </div> <div class="usa-radio"> <input type="radio" id="collections-action-dialog-existing" class="usa-radio__input usa-radio__input--tile collections-existing" name="collections" value="existing" checked="true" data-ga-category="collections_button" data-ga-action="click" data-ga-label="collections_radio_existing" /> <label class="usa-radio__label" for="collections-action-dialog-existing">Add to an existing collection</label> </div> </fieldset> <fieldset class="usa-fieldset margin-bottom-2"> <div class="action-panel-control-wrap new-collections-controls"> <label for="collections-action-dialog-add-to-new" class="usa-label margin-top-0"> Name your collection <abbr title="required" class="usa-hint usa-hint--required text-no-underline">*</abbr> </label> <input type="text" name="add-to-new-collection" id="collections-action-dialog-add-to-new" class="usa-input collections-action-add-to-new" pattern="[^"&=<>/]*" title="The following characters are not allowed in the Name field: "&=<>/" maxlength="" data-ga-category="collections_button" data-ga-action="create_collection" data-ga-label="non_favorties_collection" required /> </div> <div class="action-panel-control-wrap existing-collections-controls"> <label for="collections-action-dialog-add-to-existing" class="usa-label margin-top-0"> Choose a collection </label> <select id="collections-action-dialog-add-to-existing" class="usa-select collections-action-add-to-existing" data-ga-category="collections_button" data-ga-action="select_collection" data-ga-label="($('.collections-action-add-to-existing').val() === 'Favorites') ? 'Favorites' : 'non_favorites_collection'"> </select> <div class="collections-retry-load-on-error usa-input-error-message selection-validation-message"> Unable to load your collection due to an error<br> <a href="#">Please try again</a> </div> </div> </fieldset> <div class="display-inline-flex"> <button class="usa-button margin-top-0 action-panel-submit" type="submit" data-loading-label="Adding..." data-pinger-ignore data-ga-category="collections_button" data-ga-action="click" data-ga-label="add"> Add </button> <button class="usa-button usa-button--outline margin-top-0 action-panel-cancel" aria-label="Close 'Add to Collections' panel" ref="linksrc=close_collections_panel" data-ga-category="collections_button" data-ga-action="click" data-ga-label="cancel"> Cancel </button> </div> </form> </div> </div> </div> </div> </div> </div> <footer class="ncbi-footer ncbi-dark-background " > <div class="ncbi-footer__icon-section"> <div class="ncbi-footer__social-header"> Follow NCBI </div> <div class="grid-container ncbi-footer__ncbi-social-icons-container"> <a href="https://twitter.com/ncbi" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="40" height="40" viewBox="0 0 40 40" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="m6.067 8 10.81 13.9L6 33.2h4.2l8.4-9.1 7.068 9.1H34L22.8 18.5 31.9 8h-3.5l-7.7 8.4L14.401 8H6.067Zm3.6 1.734h3.266l16.8 21.732H26.57L9.668 9.734Z"> </path> </svg> <span class="usa-sr-only">NCBI on X (formerly known as Twitter)</span> </a> <a href="https://www.facebook.com/ncbi.nlm" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="16" height="29" focusable="false" aria-hidden="true" viewBox="0 0 16 29" fill="none" xmlns="http://www.w3.org/2000/svg"> <path d="M3.8809 21.4002C3.8809 19.0932 3.8809 16.7876 3.8809 14.478C3.8809 14.2117 3.80103 14.1452 3.54278 14.1492C2.53372 14.1638 1.52334 14.1492 0.514288 14.1598C0.302626 14.1598 0.248047 14.0972 0.248047 13.8936C0.256034 12.4585 0.256034 11.0239 0.248047 9.58978C0.248047 9.37013 0.302626 9.30224 0.528931 9.3049C1.53798 9.31688 2.54837 9.3049 3.55742 9.31555C3.80103 9.31555 3.8809 9.26097 3.87957 9.00272C3.87158 8.00565 3.85428 7.00592 3.90753 6.00884C3.97142 4.83339 4.31487 3.73115 5.04437 2.78467C5.93095 1.63318 7.15699 1.09005 8.56141 0.967577C10.5582 0.79319 12.555 0.982221 14.5518 0.927641C14.7102 0.927641 14.7462 0.99287 14.7449 1.13664C14.7449 2.581 14.7449 4.02668 14.7449 5.47104C14.7449 5.67604 14.6517 5.68669 14.4946 5.68669C13.4523 5.68669 12.4113 5.68669 11.3703 5.68669C10.3506 5.68669 9.92057 6.10868 9.90593 7.13904C9.89661 7.7647 9.91525 8.39303 9.89794 9.01869C9.88995 9.26364 9.96583 9.31822 10.2015 9.31688C11.7204 9.30623 13.2393 9.31688 14.7595 9.3049C15.0257 9.3049 15.0723 9.3728 15.0444 9.62439C14.89 10.9849 14.7515 12.3467 14.6144 13.7085C14.5691 14.1571 14.5785 14.1585 14.1458 14.1585C12.8386 14.1585 11.5313 14.1665 10.2254 14.1518C9.95119 14.1518 9.89794 14.2317 9.89794 14.4899C9.90593 19.0799 9.89794 23.6752 9.91125 28.2612C9.91125 28.5674 9.8407 28.646 9.53186 28.6433C7.77866 28.6273 6.02414 28.6366 4.27094 28.634C3.82499 28.634 3.87158 28.6992 3.87158 28.22C3.87602 25.9472 3.87913 23.6739 3.8809 21.4002Z"> </path> </svg> <span class="usa-sr-only">NCBI on Facebook</span> </a> <a href="https://www.linkedin.com/company/ncbinlm" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="25" height="23" viewBox="0 0 26 24" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M14.6983 9.98423C15.6302 9.24808 16.5926 8.74754 17.6762 8.51991C19.673 8.09126 21.554 8.30824 23.1262 9.7526C24.2351 10.7723 24.7529 12.1115 25.0165 13.5612C25.1486 14.3363 25.2105 15.1218 25.2015 15.9081C25.2015 18.3043 25.2015 20.6898 25.2082 23.0806C25.2082 23.3468 25.1549 23.444 24.8621 23.4414C23.1297 23.4272 21.3992 23.4272 19.6704 23.4414C19.4041 23.4414 19.3429 23.3588 19.3442 23.1019C19.3535 20.5194 19.3442 17.9368 19.3442 15.3543C19.3442 14.0005 18.3258 12.9448 17.0266 12.9488C15.7273 12.9528 14.6983 14.0071 14.6983 15.361C14.6983 17.9328 14.6917 20.5047 14.6983 23.0753C14.6983 23.3708 14.6198 23.444 14.3296 23.4427C12.6185 23.4294 10.9079 23.4294 9.19779 23.4427C8.93155 23.4427 8.86099 23.3735 8.86232 23.1086C8.8783 19.7619 8.88628 16.4144 8.88628 13.066C8.88628 11.5688 8.87874 10.0708 8.86365 8.57182C8.86365 8.3575 8.90758 8.27896 9.14054 8.28029C10.9048 8.29094 12.6687 8.29094 14.4321 8.28029C14.6464 8.28029 14.6983 8.34818 14.6983 8.54653C14.6903 9.00047 14.6983 9.45441 14.6983 9.98423Z"> </path> <path d="M6.55316 15.8443C6.55316 18.2564 6.55316 20.6699 6.55316 23.082C6.55316 23.3629 6.48127 23.4388 6.19906 23.4374C4.47737 23.4241 2.75568 23.4241 1.03399 23.4374C0.767751 23.4374 0.69986 23.3629 0.701191 23.1006C0.709178 18.2648 0.709178 13.4281 0.701191 8.59053C0.701191 8.34026 0.765089 8.27237 1.01669 8.2737C2.74991 8.28435 4.48048 8.28435 6.20838 8.2737C6.47462 8.2737 6.5465 8.33627 6.54517 8.6065C6.54783 11.0186 6.55316 13.4308 6.55316 15.8443Z"> </path> <path d="M3.65878 0.243898C5.36804 0.243898 6.58743 1.45529 6.58743 3.1406C6.58743 4.75801 5.32145 5.95742 3.60819 5.96807C3.22177 5.97614 2.83768 5.90639 2.47877 5.76299C2.11985 5.61959 1.79344 5.40546 1.51897 5.13334C1.24449 4.86123 1.02755 4.53668 0.881058 4.17902C0.734563 3.82136 0.661505 3.43788 0.666231 3.05141C0.67555 1.42601 1.9362 0.242566 3.65878 0.243898Z"> </path> </svg> <span class="usa-sr-only">NCBI on LinkedIn</span> </a> <a href="https://github.com/ncbi" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="28" height="27" viewBox="0 0 28 28" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M16.7228 20.6334C17.5057 20.5527 18.2786 20.3944 19.0301 20.1608C21.3108 19.4193 22.5822 17.8259 22.963 15.4909C23.1228 14.5112 23.1814 13.5287 22.9883 12.5437C22.8106 11.6423 22.4013 10.8028 21.8007 10.1076C21.7526 10.0605 21.7197 10 21.7064 9.934C21.6931 9.86799 21.7 9.79952 21.7262 9.73748C22.0856 8.6206 21.9711 7.51969 21.601 6.42677C21.582 6.3497 21.5345 6.2827 21.468 6.23923C21.4016 6.19577 21.3211 6.17906 21.2429 6.19248C20.7329 6.21649 20.2313 6.33051 19.7611 6.52928C19.1103 6.7908 18.4899 7.12198 17.9104 7.51703C17.84 7.56996 17.7581 7.60551 17.6713 7.62078C17.5846 7.63605 17.4954 7.6306 17.4112 7.60489C15.2596 7.05882 13.0054 7.06203 10.8554 7.61421C10.7806 7.63586 10.7018 7.63967 10.6253 7.62534C10.5487 7.611 10.4766 7.57892 10.4148 7.53167C9.64788 7.03247 8.85171 6.58918 7.96368 6.33359C7.65781 6.24338 7.34123 6.19458 7.02239 6.18849C6.94879 6.17986 6.87462 6.19893 6.81432 6.242C6.75402 6.28507 6.71191 6.34904 6.69621 6.42145C6.32342 7.51437 6.2209 8.61527 6.56307 9.73348C6.59635 9.84264 6.64694 9.93316 6.54177 10.0516C5.47666 11.2604 5.09988 12.6834 5.19574 14.2676C5.2663 15.4244 5.46201 16.5466 6.01454 17.5769C6.84399 19.1171 8.21664 19.9119 9.85158 20.3352C10.3938 20.4706 10.9444 20.5698 11.4998 20.632C11.5384 20.7492 11.4506 20.7798 11.408 20.8291C11.1734 21.1179 10.9894 21.4441 10.8634 21.7942C10.7622 22.0458 10.8315 22.4039 10.6065 22.5516C10.263 22.7766 9.83827 22.8485 9.42421 22.8871C8.17936 23.0056 7.26471 22.4877 6.6283 21.4348C6.25552 20.8184 5.76956 20.3325 5.08523 20.0663C4.76981 19.9325 4.42139 19.8967 4.08537 19.9638C3.7898 20.029 3.73788 20.1901 3.93891 20.4111C4.03639 20.5234 4.14989 20.6207 4.27575 20.6999C4.9796 21.1318 5.51717 21.7884 5.80152 22.5636C6.37002 23.9973 7.48039 24.5697 8.93825 24.6323C9.43741 24.6575 9.93768 24.615 10.4254 24.5058C10.5892 24.4672 10.6531 24.4872 10.6517 24.6762C10.6451 25.4936 10.6637 26.3123 10.6517 27.131C10.6517 27.6635 10.1684 27.9297 9.58663 27.7393C8.17396 27.2671 6.84977 26.5631 5.66838 25.656C2.59555 23.2891 0.720966 20.1861 0.217704 16.3376C-0.357453 11.9127 0.911353 8.00824 3.98551 4.73881C6.11909 2.42656 8.99932 0.939975 12.1203 0.540191C16.5351 -0.0601815 20.4347 1.14323 23.7232 4.16373C26.2449 6.47869 27.724 9.37672 28.1048 12.7726C28.5828 17.0325 27.3686 20.7945 24.4768 23.9827C22.9762 25.6323 21.0956 26.8908 18.9982 27.6488C18.8783 27.6927 18.7585 27.738 18.636 27.7726C18.0356 27.9404 17.6189 27.6395 17.6189 27.0098C17.6189 25.7452 17.6308 24.4806 17.6295 23.2159C17.6329 22.9506 17.6128 22.6856 17.5696 22.4238C17.4325 21.6664 17.3419 21.484 16.7228 20.6334Z"> </path> </svg> <span class="usa-sr-only">NCBI on GitHub</span> </a> <a href="https://ncbiinsights.ncbi.nlm.nih.gov/" class="ncbi-footer__social-icon ncbi-footer__social-icon--gray" target="_blank" rel="noreferrer noopener"> <svg width="26" height="26" viewBox="0 0 27 27" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M23.7778 26.4574C23.1354 26.3913 22.0856 26.8024 21.636 26.3087C21.212 25.8444 21.4359 24.8111 21.324 24.0347C19.9933 14.8323 14.8727 8.80132 6.09057 5.85008C4.37689 5.28406 2.58381 4.99533 0.779072 4.99481C0.202773 4.99481 -0.0229751 4.83146 0.00455514 4.21479C0.0660406 3.08627 0.0660406 1.95525 0.00455514 0.826734C-0.0413285 0.0815827 0.259669 -0.0193618 0.896534 0.00266238C6.96236 0.222904 12.3693 2.24179 16.9889 6.16209C22.9794 11.2478 26.1271 17.7688 26.4372 25.648C26.4629 26.294 26.3179 26.5271 25.6609 26.4684C25.0827 26.417 24.4991 26.4574 23.7778 26.4574Z"> </path> <path d="M14.8265 26.441C14.0924 26.441 13.2371 26.6795 12.6626 26.3786C12.0092 26.0372 12.3781 25.0644 12.246 24.378C11.1154 18.5324 6.6849 14.5497 0.74755 14.1001C0.217135 14.0615 -0.0104482 13.9422 0.0134113 13.3659C0.0519536 12.1454 0.0482829 10.9213 0.0134113 9.69524C-0.00127145 9.14464 0.196946 9.03268 0.703502 9.04736C9.21217 9.27128 16.5994 16.2511 17.2804 24.7231C17.418 26.4446 17.418 26.4446 15.6579 26.4446H14.832L14.8265 26.441Z"> </path> <path d="M3.58928 26.4555C2.64447 26.4618 1.73584 26.0925 1.06329 25.4289C0.39073 24.7653 0.00933763 23.8617 0.0030097 22.9169C-0.00331824 21.9721 0.365937 21.0635 1.02954 20.3909C1.69315 19.7184 2.59675 19.337 3.54156 19.3306C4.48637 19.3243 5.39499 19.6936 6.06755 20.3572C6.7401 21.0208 7.1215 21.9244 7.12782 22.8692C7.13415 23.814 6.7649 24.7226 6.10129 25.3952C5.43768 26.0677 4.53409 26.4491 3.58928 26.4555Z"> </path> </svg> <span class="usa-sr-only">NCBI RSS feed</span> </a> </div> </div> <div data-testid="gridContainer" class="grid-container ncbi-footer__container"> <div class="grid-row ncbi-footer__main-content-container" data-testid="grid"> <div class="ncbi-footer__column"> <p class="ncbi-footer__circled-icons-heading"> Connect with NLM </p> <div class="ncbi-footer__circled-icons-list"> <a href=https://twitter.com/nlm_nih class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="32" height="32" viewBox="0 0 40 40" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="m6.067 8 10.81 13.9L6 33.2h4.2l8.4-9.1 7.068 9.1H34L22.8 18.5 31.9 8h-3.5l-7.7 8.4L14.401 8H6.067Zm3.6 1.734h3.266l16.8 21.732H26.57L9.668 9.734Z"> </path> </svg> <span class="usa-sr-only">NLM on X (formerly known as Twitter)</span> </a> <a href=https://www.facebook.com/nationallibraryofmedicine class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="13" height="24" viewBox="0 0 13 24" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M4.11371 23.1369C4.11371 23.082 4.11371 23.0294 4.11371 22.9745V12.9411H0.817305C0.6709 12.9411 0.670898 12.9411 0.670898 12.8016C0.670898 11.564 0.670898 10.3287 0.670898 9.09341C0.670898 8.97903 0.705213 8.95158 0.815017 8.95158C1.8673 8.95158 2.91959 8.95158 3.97417 8.95158H4.12057V8.83263C4.12057 7.8055 4.12057 6.7738 4.12057 5.74897C4.1264 4.92595 4.31387 4.11437 4.66959 3.37217C5.12916 2.38246 5.94651 1.60353 6.95717 1.1921C7.64827 0.905008 8.3913 0.764035 9.13953 0.778051C10.0019 0.791777 10.8644 0.830666 11.7268 0.860404C11.8869 0.860404 12.047 0.894717 12.2072 0.90158C12.2964 0.90158 12.3261 0.940469 12.3261 1.02968C12.3261 1.5421 12.3261 2.05452 12.3261 2.56465C12.3261 3.16857 12.3261 3.7725 12.3261 4.37642C12.3261 4.48165 12.2964 4.51367 12.1912 4.51138C11.5369 4.51138 10.8804 4.51138 10.2261 4.51138C9.92772 4.51814 9.63058 4.5526 9.33855 4.61433C9.08125 4.6617 8.84537 4.78881 8.66431 4.97766C8.48326 5.16652 8.3662 5.40755 8.32972 5.66661C8.28476 5.89271 8.26027 6.1224 8.25652 6.35289C8.25652 7.19014 8.25652 8.02969 8.25652 8.86923C8.25652 8.89439 8.25652 8.91955 8.25652 8.95615H12.0219C12.1797 8.95615 12.182 8.95616 12.1614 9.10714C12.0768 9.76596 11.9876 10.4248 11.9029 11.0813C11.8312 11.6319 11.7626 12.1824 11.697 12.733C11.6719 12.9434 11.6787 12.9434 11.4683 12.9434H8.26338V22.899C8.26338 22.979 8.26338 23.0591 8.26338 23.1392L4.11371 23.1369Z"> </path> </svg> <span class="usa-sr-only">NLM on Facebook</span> </a> <a href=https://www.youtube.com/user/NLMNIH class="ncbi-footer__social-icon ncbi-footer__social-icon--circled" target="_blank" rel="noreferrer noopener"> <svg width="21" height="15" viewBox="0 0 21 15" fill="none" xmlns="http://www.w3.org/2000/svg" focusable="false" aria-hidden="true"> <path d="M19.2561 1.47914C18.9016 1.15888 18.5699 0.957569 17.2271 0.834039C15.5503 0.678484 13.2787 0.655608 11.563 0.65332H9.43556C7.71987 0.65332 5.4483 0.678484 3.77151 0.834039C2.43098 0.957569 2.097 1.15888 1.74242 1.47914C0.813665 2.32097 0.619221 4.62685 0.598633 6.89384C0.598633 7.31781 0.598633 7.74101 0.598633 8.16345C0.626084 10.4121 0.827391 12.686 1.74242 13.521C2.097 13.8412 2.4287 14.0425 3.77151 14.1661C5.4483 14.3216 7.71987 14.3445 9.43556 14.3468H11.563C13.2787 14.3468 15.5503 14.3216 17.2271 14.1661C18.5676 14.0425 18.9016 13.8412 19.2561 13.521C20.1712 12.6929 20.3725 10.451 20.3999 8.22064C20.3999 7.74025 20.3999 7.25986 20.3999 6.77946C20.3725 4.54907 20.1689 2.30724 19.2561 1.47914ZM8.55942 10.5311V4.65201L13.5601 7.50005L8.55942 10.5311Z" fill="white" /> </svg> <span class="usa-sr-only">NLM on YouTube</span> </a> </div> </div> <address class="ncbi-footer__address ncbi-footer__column"> <p> <a class="usa-link usa-link--external" href="https://www.google.com/maps/place/8600+Rockville+Pike,+Bethesda,+MD+20894/%4038.9959508, -77.101021,17z/data%3D!3m1!4b1!4m5!3m4!1s0x89b7c95e25765ddb%3A0x19156f88b27635b8!8m2!3d38.9959508! 4d-77.0988323" rel="noopener noreferrer" target="_blank">National Library of Medicine <br/> 8600 Rockville Pike<br/> Bethesda, MD 20894</a> </p> </address> <ul class="usa-list usa-list--unstyled ncbi-footer__vertical-list ncbi-footer__column"> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/web_policies.html" class="usa-link usa-link--alt ncbi-footer__link" > Web Policies </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nih.gov/institutes-nih/nih-office-director/office-communications-public-liaison/freedom-information-act-office" class="usa-link usa-link--alt ncbi-footer__link" > FOIA </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.hhs.gov/vulnerability-disclosure-policy/index.html" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > HHS Vulnerability Disclosure </a> </li> </ul> <ul class="usa-list usa-list--unstyled ncbi-footer__vertical-list ncbi-footer__column"> <li class="ncbi-footer__vertical-list-item"> <a href="https://support.nlm.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > Help </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/accessibility.html" class="usa-link usa-link--alt ncbi-footer__link" > Accessibility </a> </li> <li class="ncbi-footer__vertical-list-item"> <a href="https://www.nlm.nih.gov/careers/careers.html" class="usa-link usa-link--alt ncbi-footer__link" > Careers </a> </li> </ul> </div> <div class="grid-row grid-col-12" data-testid="grid"> <ul class="ncbi-footer__bottom-links-list"> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.nlm.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > NLM </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.nih.gov/" class="usa-link usa-link--alt ncbi-footer__link" > NIH </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.hhs.gov/" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > HHS </a> </li> <li class="ncbi-footer__bottom-list-item"> <a href="https://www.usa.gov/" class="usa-link usa-link--external usa-link--alt ncbi-footer__link" rel="noreferrer noopener" target='_blank' > USA.gov </a> </li> </ul> </div> </div> </footer> <script type="text/javascript" src="https://cdn.ncbi.nlm.nih.gov/core/pinger/pinger.js"> </script> <button class="back-to-top" data-ga-category="pagination" data-ga-action="back_to_top"> <label>Back to Top</label> <svg class="usa-icon order-0" aria-hidden="true" focusable="false" role="img"> <use xlink:href="/static/img/sprite.svg#arrow_upward"></use> </svg> </button> <script src="https://code.jquery.com/jquery-3.5.0.min.js" integrity="sha256-xNzN2a4ltkB44Mc/Jz3pT4iU1cmeR0FkXs4pru/JxaQ=" crossorigin="anonymous"> </script> <script type="text/javascript">var exports = {};</script> <script src="/static/CACHE/js/output.13b077bc3ffd.js"></script> <script type="application/javascript"> window.ncbi = window.ncbi || {}; window.ncbi.pmc = window.ncbi.pmc || {}; window.ncbi.pmc.options = { logLevel: 'INFO', staticEndpoint: '/static/', citeCookieName: 'pmc-cf', }; </script> <script type="module" crossorigin="" src="/static/assets/base-9bea7450.js"></script> <script type="module" crossorigin="" src="/static/assets/article-722d91a2.js"></script> </body> </html>

CINXE.COM

COVID-19: Clinical aspects and therapeutics responses - PMC