AMB Express | Full text | Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html id="nojs" xmlns="http://www.w3.org/1999/xhtml" xmlns:m="http://www.w3.org/1998/Math/MathML" xmlns:og="http://ogp.me/ns#" xml:lang="en-GB" lang="en-GB" xmlns:wb="“http://open.weibo.com/wb”"> <head><script type="text/javascript" src="/_static/js/bundle-playback.js?v=HxkREWBo" charset="utf-8"></script> <script type="text/javascript" src="/_static/js/wombat.js?v=txqj7nKC" charset="utf-8"></script> <script>window.RufflePlayer=window.RufflePlayer||{};window.RufflePlayer.config={"autoplay":"on","unmuteOverlay":"hidden"};</script> <script type="text/javascript" src="/_static/js/ruffle/ruffle.js"></script> <script type="text/javascript"> __wm.init("https://web.archive.org/web"); __wm.wombat("http://www.amb-express.com:80/content/3/1/41","20150109205656","https://web.archive.org/","web","/_static/", "1420837016"); </script> <link rel="stylesheet" type="text/css" href="/_static/css/banner-styles.css?v=S1zqJCYt" /> <link rel="stylesheet" type="text/css" href="/_static/css/iconochive.css?v=3PDvdIFv" />  <title>AMB Express | Full text | Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68</title> <link rel="shortcut icon" type="image/x-icon" href="/web/20150109205656im_/http://www.amb-express.com/images/icon/10217/favicon.ico"/> <link rel="apple-touch-icon" sizes="72x72" href="/web/20150109205656im_/http://www.amb-express.com/sites/10217/images/70.gif"/> <meta http-equiv="X-UA-Compatible" content="IE=7"/>  <meta name="citation_journal_title" content="AMB Express"/> <meta name="citation_publisher" content="Springer"/> <meta name="citation_author" content="Yuka Sone"/> <meta name="citation_author_institution" content="Department of Public Health and Molecular Toxicology, School of Pharmacy, Kitasato University, 5-9-1 Shirokane, Tokyo, Minato-ku 108-8641, Japan"/> <meta name="citation_author" content="Yusuke Mochizuki"/> <meta name="citation_author_institution" content="Department of Public Health and Molecular Toxicology, School of Pharmacy, Kitasato University, 5-9-1 Shirokane, Tokyo, Minato-ku 108-8641, Japan"/> <meta name="citation_author" content="Keita Koizawa"/> <meta name="citation_author_institution" content="Department of Public Health and Molecular Toxicology, School of Pharmacy, Kitasato University, 5-9-1 Shirokane, Tokyo, Minato-ku 108-8641, Japan"/> <meta name="citation_author" content="Ryosuke Nakamura"/> <meta name="citation_author_institution" content="Department of Public Health and Molecular Toxicology, School of Pharmacy, Kitasato University, 5-9-1 Shirokane, Tokyo, Minato-ku 108-8641, Japan"/> <meta name="citation_author" content="Hidemitsu Pan-Hou"/> <meta name="citation_author_institution" content="Faculty of Pharmaceutical Sciences, Setsunan University, 45-1 Nagaotoge-cho, Osaka, Hirakata 573-0101, Japan"/> <meta name="citation_author" content="Tomoo Itoh"/> <meta name="citation_author_institution" content="Department of Public Health and Molecular Toxicology, School of Pharmacy, Kitasato University, 5-9-1 Shirokane, Tokyo, Minato-ku 108-8641, Japan"/> <meta name="citation_author" content="Masako Kiyono"/> <meta name="citation_author_institution" content="Department of Public Health and Molecular Toxicology, School of Pharmacy, Kitasato University, 5-9-1 Shirokane, Tokyo, Minato-ku 108-8641, Japan"/> <meta name="citation_issn" content="2191-0855"/> <meta name="citation_title" content="Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68"/> <meta name="citation_volume" content="3"/> <meta name="citation_issue" content="1"/> <meta name="citation_date" content="2013-07-28"/> <meta name="citation_firstpage" content="41"/> <meta name="citation_doi" content="10.1186/2191-0855-3-41"/> <meta name="citation_pdf_url" content="http://www.amb-express.com/content/pdf/2191-0855-3-41.pdf"/> <meta name="citation_pmid" content="23890172"/> <link rel="alternate" type="application/pdf" title="PDF" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/pdf/2191-0855-3-41.pdf"/> <meta name="title" content="Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68"/> <meta name="description" content="We report the complete nucleotide sequence of plasmid pMR68, isolated from Pseudomonas strain K-62, two plasmids contribute to broad-spectrum mercury resistance and that the mer operon from one of them (pMR26) has been previously characterized. The plasmid was 71,020 bp in length and contained 75 coding regions. Three mer gene clusters were identified. The first comprised merR-orf4-orf5-merT1-merP1-merF-merA-merB1, which confers bacterial resistance to mercuric ions and organomercury. The second and third clusters comprised merT2-merP2, which encodes a mercury transport system, and merB2, which encodes an organomercurial lyase, respectively. The deduced amino acid sequences for the proteins encoded by each of the mer genes identified in pMR68 bore greater similarity to sequences from Methylobacterium extorquens AM1 than to those from pMR26, a second mercury-resistance plasmid from Pseudomonas strain K-62. Escherichia coli cells carrying pMKY12 (containing merR-orf4-orf5-merT1-merP1-merF-merA-merB1 cloned from pMR68) and cells carrying pMRA114 (containing merR-merT-merP-merA-merG-merB1 cloned from plasmid pMR26) were more resistant to, and volatilized more, mercury from mercuric ions and phenylmercury than the control cells. The present results, together with our earlier findings, indicate that the high phenylmercury resistance noted for Pseudomonas strain K-62 seems to be achieved by multiple genes, particularly by the multiple merB encoding organomercurial lyase and one merG encoding cellular permeability to phenylmercury. The novel mer gene identified in pMR68 may help us to design new strategies aimed at the bioremediation of mercurials."/> <meta name="dc.title" content="Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68"/> <meta name="dc.creator" content="Sone, Yuka"/> <meta name="dc.creator" content="Mochizuki, Yusuke"/> <meta name="dc.creator" content="Koizawa, Keita"/> <meta name="dc.creator" content="Nakamura, Ryosuke"/> <meta name="dc.creator" content="Pan-Hou, Hidemitsu"/> <meta name="dc.creator" content="Itoh, Tomoo"/> <meta name="dc.creator" content="Kiyono, Masako"/> <meta name="dc.description" content="We report the complete nucleotide sequence of plasmid pMR68, isolated from Pseudomonas strain K-62, two plasmids contribute to broad-spectrum mercury resistance and that the mer operon from one of them (pMR26) has been previously characterized. The plasmid was 71,020 bp in length and contained 75 coding regions. Three mer gene clusters were identified. The first comprised merR-orf4-orf5-merT1-merP1-merF-merA-merB1, which confers bacterial resistance to mercuric ions and organomercury. The second and third clusters comprised merT2-merP2, which encodes a mercury transport system, and merB2, which encodes an organomercurial lyase, respectively. The deduced amino acid sequences for the proteins encoded by each of the mer genes identified in pMR68 bore greater similarity to sequences from Methylobacterium extorquens AM1 than to those from pMR26, a second mercury-resistance plasmid from Pseudomonas strain K-62. Escherichia coli cells carrying pMKY12 (containing merR-orf4-orf5-merT1-merP1-merF-merA-merB1 cloned from pMR68) and cells carrying pMRA114 (containing merR-merT-merP-merA-merG-merB1 cloned from plasmid pMR26) were more resistant to, and volatilized more, mercury from mercuric ions and phenylmercury than the control cells. The present results, together with our earlier findings, indicate that the high phenylmercury resistance noted for Pseudomonas strain K-62 seems to be achieved by multiple genes, particularly by the multiple merB encoding organomercurial lyase and one merG encoding cellular permeability to phenylmercury. The novel mer gene identified in pMR68 may help us to design new strategies aimed at the bioremediation of mercurials."/> <meta name="dc.source" content="AMB Express 2013 3:41"/> <meta name="dc.format" content="text/html"/> <meta name="dc.publisher" content="Springer"/> <meta name="dc.date" content="2013-07-28"/> <meta name="dc.type" content="Original article"/> <meta name="dc.identifier" content="10.1186/2191-0855-3-41"/> <meta name="dc.identifier" content="info:pmid/23890172"/> <meta name="dc.language" content="en"/> <meta name="dc.copyright" content="2013 Sone et al.; licensee Springer."/> <meta name="dc.rights" content="http://creativecommons.org/licenses/by/2.0/"/> <meta name="dc.rightsAgent" content="reprints@biomedcentral.com"/> <meta name="prism.issn" content="2191-0855"/> <meta name="prism.publicationName" content="AMB Express"/> <meta name="prism.publicationDate" content="2013-07-28"/> <meta name="prism.volume" content="3"/> <meta name="prism.number" content="1"/> <meta name="prism.section" content="Original article"/> <meta name="prism.startingPage" content="41"/> <meta name="prism.copyright" content="2013 Sone et al.; licensee Springer."/> <meta name="prism.rightsAgent" content="reprints@biomedcentral.com"/> <meta name="citation_abstract_html_url" content="http://www.amb-express.com/content/3/1/41/abstract"/> <meta name="citation_fulltext_html_url" content="http://www.amb-express.com/content/3/1/41"/> <link rel="alternate" type="text/xml" title="XML version" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/download/xml/2191-0855-3-41.xml"/> <link rel="image_src" href="https://web.archive.org/web/20150109205656im_/http://www.amb-express.com/content/figures/2191-0855-3-41-toc.gif"/> <link rel="section" href="http://amb-express.com/content/download/supplementary/2191-0855-3-41-s1.pdf" title="Additional file 1: Table S1"/> <link rel="section" href="http://amb-express.com/content/download/supplementary/2191-0855-3-41-s2.pdf" title="Additional file 2: Table S2"/> <script type="text/javascript"> // must run before css document.documentElement.id = "js"; </script> <script src="//web.archive.org/web/20150109205656js_/http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script> <link rel="stylesheet" type="text/css" href="/web/20150109205656cs_/http://www.amb-express.com/css/main-0.css" media="screen, print"/> <link rel="stylesheet" type="text/css" href="/web/20150109205656cs_/http://www.amb-express.com/css/plugins-0.css" media="screen, print"/> <link rel="stylesheet" type="text/css" href="https://web.archive.org/web/20150109205656cs_/http://www.bmcimg.com/css/articles-0.css" media="screen, print"/> <link rel="stylesheet" type="text/css" href="/web/20150109205656cs_/http://www.amb-express.com/css/themes/10217.css" media="screen, print"/> <link rel="stylesheet" type="text/css" href="/web/20150109205656cs_/http://www.amb-express.com/css/media/print-0.css" media="print"/>   <script type="text/javascript"> //configuration OAS_url = '//web.archive.org/web/20150109205656/http://oas.biomedcentral.com/RealMedia/ads/'; // control of advert's position on page [AMC] OAS_sitepage = "amb-express.com/article/10.1186/2191/0855/3/41"; OAS_listpos = 'Top,x96,Right3'; OAS_query = ''; OAS_target = '_top'; //end of configuration OAS_version = 10; OAS_rn = '001234567890'; OAS_rns = '1234567890'; OAS_rn = new String (Math.random()); OAS_rns = OAS_rn.substring (2, 11); function OAS_NORMAL(pos) { document.write('<a href="' + OAS_url + 'click_nx.ads/' + OAS_sitepage + '/1' + OAS_rns + '@' + OAS_listpos + '!' + pos + '?' + OAS_query + '" target="' + OAS_target + '">'); document.write('<img src="' + OAS_url + 'adstream_nx.ads/' + OAS_sitepage + '/1' + OAS_rns + '@' + OAS_listpos + '!' + pos + '?' + OAS_query + '" border="0"/></a>'); } function refererTerms(referer) { if(referer.match("q=") != null) { referer = referer.split("q="); referer = referer[1].split("&"); referer = referer[0]; } else { referer = referer; } if(referer.match("%20") != null && referer.match("%20").length >= 1) { referer = referer.replace(/%20/gi,"+"); return referer; } else { return referer; } } </script> <script type="text/javascript"> // Set the version of JavaScript to 10 for a Browser 'Mozilla/3' on webTV OAS_version = 11; if ((navigator.userAgent.indexOf('Mozilla/3') != -1) || (navigator.userAgent.indexOf('Mozilla/4.0 WebTV') != -1)) { OAS_version = 10; } if (OAS_version >= 11) { document.write('<scr' + 'ipt type="text/javascript" src="' + OAS_url + 'adstream_mjx.ads/' + OAS_sitepage + '/1' + OAS_rns + '@' + OAS_listpos + '?' + OAS_query + '"><\/script>'); } </script> <script type="text/javascript"> document.write(''); function OAS_AD(pos) { if (OAS_version >= 11) OAS_RICH(pos); else OAS_NORMAL(pos); } </script> <script type="text/javascript"> jsonLoaders = function(){ var _loaders = []; return { register: function(config){ config.prefix = config.prefix || '/webapi/1.0/blogs/'; config.feedLength = config.feedLength || 3; _loaders.push(config); }, list: function(){return _loaders} }; }(); function totext() { document.write('<a href="javascript:returnToText();">Return to text</a>'); } function retrieve_doi(){ var metas = document.getElementsByTagName('meta'); var i; for (i = 0; i < metas.length; i++) if (metas[i].getAttribute('name') == "citation_doi") break; var citation_doi = metas[i].getAttribute('content'); return citation_doi; } </script> <script src="https://web.archive.org/web/20150109205656js_/http://tjs.sjs.sinajs.cn/open/api/js/wb.js" type="text/javascript" charset="utf-8"></script> <link title="Latest articles" rel="alternate" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/latest/rss" type="application/rss+xml" exposetoheader="true"/> <link title="Most viewed" rel="alternate" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/mostviewed/rss/" type="application/rss+xml" exposetoheader="true"/> <link title="Latest comments" rel="alternate" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/latestcomments/rss" type="application/rss+xml" exposetoheader="true"/> <script type="text/javascript"> var _gaq = _gaq || []; _gaq.push(['_setAccount', 'UA-17419507-2']); _gaq.push(['_gat._anonymizeIp']); _gaq.push(['_setLocalRemoteServerMode']); /*for cross domain tracking*/ //_gaq.push(['_setAllowLinker', true]); //_gaq.push(['_setDomainName', 'amb-express.com']); //this journal's domain /**/ _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://web.archive.org/web/20150109205656/https://ssl' : 'https://web.archive.org/web/20150109205656/http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); //var iframe = document.getElementById('casesdb-search-widget'); //if(iframe !== null) { // var pageTracker = _gat._getTrackerByName(); // iframe.src = pageTracker._getLinkerUrl('https://web.archive.org/web/20150109205656/http://www.casesdatabase.com/'); //} })(); </script> </head> <body class=" theme "> <div id="oas-campaign" style="display:none">amb-express.com/article/10.1186/2191/0855/3/41</div> <div id="oas-positions" style="display:none">Bottom,Top</div> <div id="branding" role="banner"> <dl class="google-ad wide "> <dt class="hide"> <a class="banner-ad" href="https://web.archive.org/web/20150109205656/http://www.biomedcentral.com/advertisers/digital_advertising"></a> </dt> <dd>  <script type="text/javascript"> OAS_AD('Top'); </script>  </dd> </dl> <noscript> <dl class="google-ad wide noscript"> <dt class="hide"></dt> <dd> <a href="//web.archive.org/web/20150109205656/http://oas.biomedcentral.com/RealMedia/ads/click_nx.ads/amb-express.com/article/10.1186/2191/0855/3/41/11777358987@Top"> <img src="//web.archive.org/web/20150109205656im_/http://oas.biomedcentral.com/RealMedia/ads/adstream_nx.ads/amb-express.com/article/10.1186/2191/0855/3/41/11060098550@Top" alt="advert"/> </a> </dd> </dl> </noscript> <div class="sup-panel-outer"> <div class="sup-panel-inner"> <style> #nojs li.greeting, #nojs li#loginLink {display:none;} </style> <ul id="login" class="login"> <noscript><li><a href="/web/20150109205656/http://www.amb-express.com/log"><img class="greeting" src="/web/20150109205656im_/http://www.amb-express.com/images/log.gif"/></a></li></noscript> <li id="welcome"><span id="username"></span></li> <li id="loginLink"><a href=""></a></li> </ul> <script> function login() { /* cookie getter/setter */ var allCookies = { getItem: function (sKey) { if (!sKey || !this.hasItem(sKey)) { return null; } return unescape(document.cookie.replace(new RegExp("(?:^|.*;\\s*)" + escape(sKey).replace(/[\-\.\+\*]/g, "\\$&") + "\\s*\\=\\s*((?:[^;](?!;))*[^;]?).*"), "$1")); }, setItem: function (sKey, sValue, vEnd, sPath, sDomain, bSecure) { if (!sKey || /^(?:expires|max\-age|path|domain|secure)$/i.test(sKey)) { return; } var sExpires = ""; if (vEnd) { switch (vEnd.constructor) { case Number: sExpires = vEnd === Infinity ? "; expires=Tue, 19 Jan 2038 03:14:07 GMT" : "; max-age=" + vEnd; break; case String: sExpires = "; expires=" + vEnd; break; case Date: sExpires = "; expires=" + vEnd.toGMTString(); break; } } document.cookie = escape(sKey) + "=" + escape(sValue) + sExpires + (sDomain ? "; domain=" + sDomain : "") + (sPath ? "; path=" + sPath : "") + (bSecure ? "; secure" : ""); }, removeItem: function (sKey, sPath) { if (!sKey || !this.hasItem(sKey)) { return; } document.cookie = escape(sKey) + "=; expires=Thu, 01 Jan 1970 00:00:00 GMT" + (sPath ? "; path=" + sPath : ""); }, hasItem: function (sKey) { return (new RegExp("(?:^|;\\s*)" + escape(sKey).replace(/[\-\.\+\*]/g, "\\$&") + "\\s*\\=")).test(document.cookie); }, keys: /* optional method: you can safely remove it! */ function () { var aKeys = document.cookie.replace(/((?:^|\s*;)[^\=]+)(?=;|$)|^\s*|\s*(?:\=[^;]*)?(?:\1|$)/g, "").split(/\s*(?:\=[^;]*)?;\s*/); for (var nIdx = 0; nIdx < aKeys.length; nIdx++) { aKeys[nIdx] = unescape(aKeys[nIdx]); } return aKeys; } }; // converts cookie into js object function parseCookie(cookie) { cookie = cookie.split("&"); var obj = {}; for(var i = 0; i < cookie.length; i++) { var c = cookie[i].split("="); c[0] = c[0].replace('"',''); obj[c[0]] = c[1]; } return obj; } var cookie = allCookies.getItem("bmccookie"); var obj = (cookie != null) ? parseCookie(cookie) : {}; var welcome = ""; if(obj.hasOwnProperty("fname")) { // insert user welcome welcome = obj.fname.replace(/\+/g, " ") + " " + obj['lname'].replace(/\+/g," "); if(jQuery("#welcome").length > 0) { jQuery("#welcome").prepend("<strong>Welcome</strong> "); jQuery("#username").prepend('<strong>' + welcome + '</strong><span class="divider"></span>'); } // update link url jQuery("#loginLink a").text("Log off"); jQuery("#loginLink a").attr("href", window.location.protocol + "//" + window.location.host + "/logoff"); window.bmcloggedon = true; } else if(obj.hasOwnProperty("institution_name")) { // insert institution name welcome = obj["institution_name"].replace(/\+/g," "); if(jQuery("#welcome").length > 0) { jQuery("#welcome").prepend("<strong>Welcome</strong> "); jQuery("#username").prepend('<strong>' + welcome + '</strong><span class="divider"></span>'); } // update link url jQuery("#loginLink a").text("Log on"); jQuery("#loginLink a").attr("href", window.location.protocol + "//" + window.location.host + "/logon"); window.bmcloggedon = false; } else { jQuery("#welcome").innerHTML = ""; jQuery("#loginLink a").text("Log on"); jQuery("#loginLink a").attr("href", window.location.protocol + "//" + window.location.host + "/logon"); window.bmcloggedon = false; } // if athens login cookie doesn't exist and the athens login link is visible then remove it. if(allCookies.hasItem("athens") != true && document.getElementById("loginAthensLink") != null) { jQuery("#loginAthensLink").hide(); } } login(); </script> <ul class="nav-sup"> <li id="SPR" class="current"> <a href="https://web.archive.org/web/20150109205656/http://www.springeropen.com/"><span class="img-title"> </span> <span class="text-title">SpringerOpen</span></a> </li> <li><a href="https://web.archive.org/web/20150109205656/http://www.springeropen.com/journals"><span>Journals</span></a></li> </ul> </div> </div> <div class="branding-inner"> <style> .survey { margin: 10px 0; } .survey, .survey .survey-sentence { font-size: 13px; } .survey-button a, .survey-button a:active, .survey-button a:visited, .survey-button a:hover { color: #FFFFFF; text-decoration: none; } .survey-button { background-color: #FFA500; border-radius: 5px; color: #FFFFFF; font-weight: bold; font-size: 13px; font-weight: bold; padding: 5px 13px; background: #ef8142; /* Old browsers */ background: -moz-linear-gradient(top, #ef8142 0%, #ef8142 50%, #a64510 100%, #a64510 100%); /* FF3.6+ */ background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,#ef8142), color-stop(50%,#ef8142), color-stop(100%,#a64510), color-stop(100%,#a64510)); /* Chrome,Safari4+ */ background: -webkit-linear-gradient(top, #ef8142 0%,#ef8142 50%,#a64510 100%,#a64510 100%); /* Chrome10+,Safari5.1+ */ background: -o-linear-gradient(top, #ef8142 0%,#ef8142 50%,#a64510 100%,#a64510 100%); /* Opera 11.10+ */ background: -ms-linear-gradient(top, #ef8142 0%,#ef8142 50%,#a64510 100%,#a64510 100%); /* IE10+ */ background: linear-gradient(to bottom, #ef8142 0%,#ef8142 50%,#a64510 100%,#a64510 100%); /* W3C */ filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#ef8142', endColorstr='#a64510',GradientType=0 ); /* IE6-9 */ } </style> <div class="logo"> <a href="/web/20150109205656/http://www.amb-express.com/"><img alt="AMB Express" title="AMB Express Logo" src="/web/20150109205656im_/http://www.amb-express.com/sites/10217/images/logo.gif"/></a> </div> <div class="module search gray small " role="search"> <div class="module-inner padded"> <form method="get" class="searchForm" action="/web/20150109205656/http://www.amb-express.com/quickSearchRedirectURL " onsubmit="window.location.href=this['url'].value + '?terms=' + encodeURIComponent(this['terms'].value); return false;"> <fieldset class="search"> <span> Search <select name="url"> <option value="http://www.amb-express.com/search/results" selected>AMB Express</option> <option value="http://www.springeropen.com/search/results">SpringerOpen</option> </select> for </span> <input id="searchTerms" name="terms" type="text" alt="Search terms" class="text "/> <button class="w37" value="Go" type="submit">Go</button> </fieldset> </form> </div> <a class="advanced-search" href="/web/20150109205656/http://www.amb-express.com/search">Advanced search</a> </div> <div id="mobile-nav-list"> <ul class="primary-nav" role="navigation"> <li><a href="/web/20150109205656/http://www.amb-express.com/"><span id="home-tab">Home</span></a></li> <li class="current"><a href="/web/20150109205656/http://www.amb-express.com/content"><span id="articles-tab">Articles</span></a></li> <li><a href="/web/20150109205656/http://www.amb-express.com/authors/instructions"><span id="authors-tab">Authors</span></a></li> <li><a href="/web/20150109205656/http://www.amb-express.com/about/reviewers"><span id="reviewers-tab">Reviewers</span></a></li> <li><a href="/web/20150109205656/http://www.amb-express.com/about"><span id="about-tab">About this journal</span></a></li> <li><a href="/web/20150109205656/http://www.amb-express.com/my"><span id="my-tab">My AMB Express</span></a></li> </ul> </div> </div> </div> <hr class="hide"/> <div class="container"> <div id="content" class="overflow-visible" role="main">  <div class="outline-wrapper block mobile-hidden" id="left-article-box"> <ul id="box-outline" class="box"> <ul id="outline" class="outline"> <li> <a href="#">Top</a> </li> <li> <a href="#abs">Abstract</a> </li> <li> <a href="#sec1">Introduction</a> </li> <li> <a href="#sec2">Materials and methods</a> </li> <li> <a href="#sec3">Results</a> </li> <li> <a href="#sec4">Discussion</a> </li> <li> <a href="#sec5">Competing interests</a> </li> <li> <a href="#ack">Acknowledgments</a> </li> <li class="lowest"> <a href="#refs">References</a> </li> </ul> </ul> <dl id="box-outline1"> </dl> </div> <div class="mobile-hidden" id="right-panel"> <div id="mobile-sidebar"> <div id="mobile-sidebar-tab"> <span> <a href="#" id="mobile-sidebar-tab-link"><img src="/web/20150109205656im_/http://www.amb-express.com/images/sidebar-hidden.png"><img style="display:none;" src="/web/20150109205656im_/http://www.amb-express.com/images/sidebar-shown.png"></a> </span> </div> <div id="mobile-sidebar-list"> <div id="article-navigation-bar"> <div class="issue-information block"> <h5><a href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/"><strong>AMB Express</strong></a></h5> <ul class="square normal"> <li><a href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3">Volume 3</a></li> </ul> </div> <div class="article-information block" id="article-info"> <div id="viewing-options-links"> <h5>Viewing options</h5> <ul class="square normal"> <li> <a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/abstract">Abstract</a> </li> <li> <strong>Full text</strong> </li> <li class="pdfFileSize"> <a onclick="_gaq.push(['_trackEvent', 'PDF download', 'Article Sidebar', '/content/3/1/41', 1, true]);" href="/web/20150109205656/http://www.amb-express.com/content/pdf/2191-0855-3-41.pdf">PDF</a> <span>(418KB)</span> </li> <li> <a href="/web/20150109205656/http://www.amb-express.com/content/epub/2191-0855-3-41.epub">ePUB</a> (158KB) </li> <li> <a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/additional">Additional files</a> </li> </ul> </div> <div id="associated-material-links"> <h5>Associated material</h5> <ul class="square normal"> <li> <a href="/web/20150109205656/http://www.amb-express.com/pubmed/23890172">PubMed record</a> </li> <li><a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/about">Article metrics</a></li> <li> <a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/comments">Readers' comments </a> </li> <li> </li> </ul> </div> <div id="related-literature-links"> <h5>Related literature</h5> <ul class="normal"> <li><a href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/about#citations">Cited by</a></li> <li id="google-blog-search"><a href="https://web.archive.org/web/20150109205656/http://www.google.com/search?tbm=blg&hl=en&source=hp&biw=1280&bih=899&q=%22Mercurial-resistance+determinants+in+Pseudomonas+strain+K-62+plasmid+pMR68%22&btnG=Search">Google blog search</a></li> <h6>Other articles by authors</h6> <li> <a class="collapser"><i> </i>on Google Scholar</a> <ul id="authg" class="hidebeforeload"> <li> <a href="https://web.archive.org/web/20150109205656/http://scholar.google.com/scholar?q=author%3A%22Y+Sone%22">Sone Y</a> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://scholar.google.com/scholar?q=author%3A%22Y+Mochizuki%22">Mochizuki Y</a> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://scholar.google.com/scholar?q=author%3A%22K+Koizawa%22">Koizawa K</a> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://scholar.google.com/scholar?q=author%3A%22R+Nakamura%22">Nakamura R</a> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://scholar.google.com/scholar?q=author%3A%22H+Pan-Hou%22">Pan-Hou H</a> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://scholar.google.com/scholar?q=author%3A%22T+Itoh%22">Itoh T</a> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://scholar.google.com/scholar?q=author%3A%22M+Kiyono%22">Kiyono M</a> </li> </ul> </li> <li> <a class="collapser"><i> </i>on PubMed</a> <ul id="authpm" class="hidebeforeload"> <li><a href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/pubmed?term=Sone_Y%20[Author]">Sone Y</a> </li> <li><a href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/pubmed?term=Mochizuki_Y%20[Author]">Mochizuki Y</a> </li> <li><a href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/pubmed?term=Koizawa_K%20[Author]">Koizawa K</a> </li> <li><a href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/pubmed?term=Nakamura_R%20[Author]">Nakamura R</a> </li> <li><a href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/pubmed?term=Pan-Hou_H%20[Author]">Pan-Hou H</a> </li> <li><a href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/pubmed?term=Itoh_T%20[Author]">Itoh T</a> </li> <li><a href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/pubmed?term=Kiyono_M%20[Author]">Kiyono M</a> </li> </ul> </li> </ul> <h6>Related articles/pages</h6> <ul class="square normal"> <li><a href="https://web.archive.org/web/20150109205656/http://www.google.co.uk/search?hl=en&q=related:http://www.amb-express.com/content/3/1/41">on Google</a></li> <li><a href="https://web.archive.org/web/20150109205656/http://scholar.google.com/scholar?q=related:http://www.amb-express.com/content/3/1/41">on Google Scholar</a></li> <li><a href="/web/20150109205656/http://www.amb-express.com/pubmed/related/23890172">on PubMed</a></li> </ul> </div> <h5>Tools</h5> <ul class="square normal"> <li> <a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/citation">Download references</a> </li> <li><a href="/web/20150109205656/http://www.amb-express.com/content/download/xml/2191-0855-3-41.xml">Download XML</a></li> <li> <a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/email?from=standard">Email to a friend</a> </li> <li><a href="https://web.archive.org/web/20150109205656/https://www.odysseypress.com/onlinehost/reprint_order.php?type=A&page=0&journal=738&doi=10.1186/2191-0855-3-41&volume=3&issue=1&title=Mercurial-resistance+determinants+in+Pseudomonas+strain+K-62+plasmid+pMR68&author_name=Yuka Sone&start_page=1&end_page=7">Order reprints</a></li> <li> <a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/postcomment">Post a comment</a> </li> <ul id="download-to-links"> <a class="downloadto_title btn" href="#"><span class="icon"> </span>Download to ...</a> <ul id="downloadto" class="iconlist hidebeforeload" style="display: none;"> <li> <a href="https://web.archive.org/web/20150109205656/http://redirect.papersapp.com/redirect?url=http%3A%2F%2Fwww.amb-express.com%2Fcontent%2F3%2F1%2F41" onclick="largepopup(this.href,'papers',800,600);return false"><span class="share-icons papers"></span>Papers</a> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://www.mendeley.com/import/?url=http://www.amb-express.com/content/3/1/41" onclick="largepopup(this.href,'mendeley',800,600);return false"><span class="share-icons mendeley"></span>Mendeley</a> </li> </ul> </ul> <ul id="mobile-downloadto" class="iconlist"> <h6>Download to ...</h6> <li> <a href="https://web.archive.org/web/20150109205656/http://redirect.papersapp.com/redirect?url=http%3A%2F%2Fwww.amb-express.com%2Fcontent%2F3%2F1%2F41" onclick="largepopup(this.href,'papers',800,600);return false"><span class="share-icons papers"></span>Papers</a> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://www.mendeley.com/import/?url=http://www.amb-express.com/content/3/1/41" onclick="largepopup(this.href,'mendeley',800,600);return false"><span class="share-icons mendeley"></span>Mendeley</a> </li> </ul> </ul> <h5>Share this article</h5> <ul id="social-networking-links"> <li> <div class="fb-like" data-href="http://www.amb-express.com/content/3/1/41" data-send="false" data-layout="button_count" data-width="100" data-show-faces="false" data-action="recommend"></div> </li> <li> <a href="https://web.archive.org/web/20150109205656/http://twitter.com/share" data-url="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41" data-counturl="http://www.amb-express.com/content/3/1/41" data-hashtags="ambexpress " data-text="Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68" class="twitter-share-button">Tweet</a> </li> <li> <g:plusone size="medium" width="100"></g:plusone> </li> <li> <wb:share-button appkey="1RwCAf" addition="number" type="button" ralateuid="2279408463" title="Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68 http://www.amb-express.com/content/3/1/41"></wb:share-button> </li> <a class="sharethis_title btn" href="#"><span class="icon"> </span>More options...</a> <ul class="iconlist hidebeforeload" id="sharethis"> <li> <a onclick="largepopup(this.href,'citeulike_popup_post',800,600);return false" href="https://web.archive.org/web/20150109205656/http://www.citeulike.org/posturl?url=http://www.amb-express.com/content/3/1/41"><span class="share-icons citeulike"></span>Citeulike</a> </li> <li> <a onclick="largepopup(this.href,'linkedin',800,600);return false" href="https://web.archive.org/web/20150109205656/http://www.linkedin.com/shareArticle?mini=true&url=%26%2335%3Bambexpress%0D%0AMercurial-resistance%20determinants%20in%20Pseudomonas%20strain%20K-62%20plasmid%20pMR68%20http%3A%2F%2Fwww.amb-express.com%2Fcontent%2F3%2F1%2F41&title=Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68"><span class="share-icons linkedin"></span>LinkedIn</a> </li> <li> <a onclick="largepopup(this.href,'Del.icio.us',800,600);return false" href="https://web.archive.org/web/20150109205656/http://del.icio.us/post?url=http://www.amb-express.com/content/3/1/41&title=Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68"><span class="share-icons delicious"></span>Del.icio.us</a> </li> <li> <a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/email"><span class="share-icons email"></span>Email</a> </li> <li> <a onclick="largepopup(this.href,'facebook',800,600);return false" href="https://web.archive.org/web/20150109205656/http://www.facebook.com/sharer.php?u=http://www.amb-express.com/content/3/1/41"><span class="share-icons facebook"></span>Facebook</a> </li> <li class="gp"> <div class="googlehider mobile-hide"> <div class="g-plusone" data-annotation="none"></div> </div> <span class="share-icons googleplus mobile-hide"></span> <div class="googlehider2 mobile-hide"> <div class="g-plusone mobile-hide" data-annotation="none"></div> </div> <span class="share-icons googleplus"></span> <span class="gp-link"><a href="#">Google+</a></span> </li> <li> <a onclick="largepopup(this.href,'mendeley',800,600);return false" href="https://web.archive.org/web/20150109205656/http://www.mendeley.com/import/?url=http://www.amb-express.com/content/3/1/41"><span class="share-icons mendeley"></span>Mendeley</a> </li> <li> <a onclick="largepopup(this.href,'twitter',800,600);return false" href="https://web.archive.org/web/20150109205656/http://twitter.com/?status=Mercurial-resistance%20determinants%20in%20Pseudomonas%20strain%20K-62%20plasmid%20pMR68%20http%3A%2F%2Fwww.amb-express.com%2Fcontent%2F3%2F1%2F41+%23ambexpress"><span class="share-icons twitter"></span>Twitter</a> </li> <li><a href="https://web.archive.org/web/20150109205656/http://www.reddit.com/submit" onclick="window.location = 'https://web.archive.org/web/20150109205656/http://www.reddit.com/submit?url=http://www.amb-express.com/content/3/1/41'; return false"> <span class="share-icons reddit"></span>Reddit</a> </li> </ul> </ul> </div> <div id="biome-badge" style="width: 100%"> <script> window.onmessage = function(e) { if(e.data == "biome-failed") { console.log(e); document.getElementById("biome-badge").style.display = "none"; } }; </script> <iframe src="https://web.archive.org/web/20150109205656if_/http://www.biomedcentral.com/sites/9001/biome-widget.html?doi=10.1186/2191-0855-3-41&size=large" width="100%" height="75px">Your browser does not support iframes</iframe> </div> <div id="signup-to-etoc" class="button-collection-margins block mobile-border-bottom"> <h3>SpringerOpen Newsletter</h3> <p>Receive periodic news and updates relating to SpringerOpen.</p> <form id="articleSignupForUpdates" method="post" action="/web/20150109205656/http://www.amb-express.com/signuptoupdates.html"> <div id="message-box"></div> <fieldset class="block-form"> <input type="text" name="emailAddress" onblur="javascript: if (this.value == '') { this.value = 'email address'; }" onfocus="javascript: if (this.value == 'email address') { this.value = ''; }" value="email address" class="text " id="email"/> <input value="" type="hidden" name="returnUrl" id="returnUrl"/> <input value="" type="hidden" name="listName" id="listName"/> <input value="AMB Express" type="hidden" name="journalName" id="journalName"/> <button onclick="_gaq.push('_trackEvent', 'Signup', 'Signup for Email updates', " amb express");" class="w74 right" type="submit" onmouseover="this.className='w74 hover right'" onmouseout="this.className='w74 right'" value="Sign up">Sign up</button> </fieldset> </form> </div> <div id="advert-offset"> <dl class="google-ad "> <dt class="hide"> <a class="skyscraper-ad" href="https://web.archive.org/web/20150109205656/http://www.biomedcentral.com/advertisers/digital_advertising">Advertisement</a> </dt> <dd>  <script type="text/javascript"> OAS_AD('Right3'); </script>  </dd> </dl> <noscript> <dl class="google-ad noscript"> <dt class="hide"><a href="https://web.archive.org/web/20150109205656/http://www.biomedcentral.com/advertisers/digital_advertising">Advertisement</dt> <dd> <a href="//web.archive.org/web/20150109205656/http://oas.biomedcentral.com/RealMedia/ads/click_nx.ads/amb-express.com/article/10.1186/2191/0855/3/41/15323529868@Right3"> <img src="//web.archive.org/web/20150109205656im_/http://oas.biomedcentral.com/RealMedia/ads/adstream_nx.ads/amb-express.com/article/10.1186/2191/0855/3/41/13816698845@Right3" alt="advert"/> </a> </dd> </dl> </noscript> </div> </div> <div class="mobile-sidebar-gradient top"></div> <div class="mobile-sidebar-gradient bottom"></div> </div> </div> </div> <div class="rounded custom white article full-text"> <div class="wrap-inner content"> <div class="padded-inner"> <div id="topmatter"> <a href="https://web.archive.org/web/20150109205656/http://www.springeropen.com/about/access"><img alt="Open Access" src="/web/20150109205656im_/http://www.amb-express.com/images/articles/openaccess-large.png" class="access mr15"/></a> <span class="articletype">Original article</span> <h1>Mercurial-resistance determinants in <em>Pseudomonas</em> strain K-62 plasmid pMR68</h1> <div class="multipleins"> <p class="authors"> <strong>Yuka Sone</strong><sup><a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/#ins1">1</a></sup>, <strong>Yusuke Mochizuki</strong><sup><a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/#ins1">1</a></sup>, <strong>Keita Koizawa</strong><sup><a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/#ins1">1</a></sup>, <strong>Ryosuke Nakamura</strong><sup><a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/#ins1">1</a></sup>, <strong>Hidemitsu Pan-Hou</strong><sup><a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/#ins2">2</a></sup>, <strong>Tomoo Itoh</strong><sup><a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/#ins1">1</a></sup> and <strong>Masako Kiyono</strong><sup><a href="/web/20150109205656/http://www.amb-express.com/content/3/1/41/#ins1">1</a></sup><sup>*</sup> </p> <div id="affiliations"> <div class="module gray inner"> <div class="module-inner padded-inner"> <ul> <li> <p class="authors"> <span>*</span> Corresponding author: Masako Kiyono <a href="https://web.archive.org/web/20150109205656/mailto:kiyonom@pharm.kitasato-u.ac.jp">kiyonom@pharm.kitasato-u.ac.jp</a> </p> </li> </ul> <p class="options"><a class="affiliations-toggle" href="#"><i class="arrow"></i>Author Affiliations</a></p> <section> <div class="collapsible-content"> <div id="ins_container" style="display: block;"> <p> <sup id="ins1">1</sup> Department of Public Health and Molecular Toxicology, School of Pharmacy, Kitasato University, 5-9-1 Shirokane, Tokyo, Minato-ku 108-8641, Japan </p> <p> <sup id="ins2">2</sup> Faculty of Pharmaceutical Sciences, Setsunan University, 45-1 Nagaotoge-cho, Osaka, Hirakata 573-0101, Japan </p> </div> <p id="authoremails"> For all author emails, please <a href="/web/20150109205656/http://www.amb-express.com/logon">log on</a>. </p> </div> </section> </div> </div> </div> </div> <section class="cit"> <div class="collapsible-content"> <p><em>AMB Express</em> 2013, <strong>3</strong>:41  <span class="pseudotab">doi:10.1186/2191-0855-3-41</span></p> <p>The electronic version of this article is the complete one and can be found online at: <a href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41">http://www.amb-express.com/content/3/1/41</a></p> <br/> <table cellspacing="0" cellpadding="0"> <tbody> <tr><td>Received:</td><td>5 July 2013</td></tr> <tr><td>Accepted:</td><td>24 July 2013</td></tr> <tr><td>Published:</td><td>28 July 2013</td></tr> </tbody> </table>  <div style="line-height:140%"> <p> © 2013 Sone et al.; licensee Springer. <br/> </p> <p> This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<a href="https://web.archive.org/web/20150109205656/http://creativecommons.org/licenses/by/2.0">http://creativecommons.org/licenses/by/2.0</a>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. </p> </div> </section> </div> <div id="article-body"> <section><a name="abs"></a><h3>Abstract</h3> <div class="collapsible-content"> <p style="line-height:160%">We report the complete nucleotide sequence of plasmid pMR68, isolated from <em>Pseudomonas</em> strain K-62, two plasmids contribute to broad-spectrum mercury resistance and that the <em>mer</em> operon from one of them (pMR26) has been previously characterized. The plasmid was 71,020 bp in length and contained 75 coding regions. Three <em>mer</em> gene clusters were identified. The first comprised <em>merR-orf4-orf5-merT1-merP1-merF-merA-merB1</em>, which confers bacterial resistance to mercuric ions and organomercury. The second and third clusters comprised <em>merT2-merP2</em>, which encodes a mercury transport system, and <em>merB2</em>, which encodes an organomercurial lyase, respectively. The deduced amino acid sequences for the proteins encoded by each of the <em>mer</em> genes identified in pMR68 bore greater similarity to sequences from <em>Methylobacterium extorquens</em> AM1 than to those from pMR26, a second mercury-resistance plasmid from <em>Pseudomonas</em> strain K-62. <em>Escherichia coli</em> cells carrying pMKY12 (containing <em>merR-orf4-orf5-merT1-merP1-merF-merA-merB1</em> cloned from pMR68) and cells carrying pMRA114 (containing <em>merR-merT-merP-merA-merG-merB1</em> cloned from plasmid pMR26) were more resistant to, and volatilized more, mercury from mercuric ions and phenylmercury than the control cells. The present results, together with our earlier findings, indicate that the high phenylmercury resistance noted for <em>Pseudomonas</em> strain K-62 seems to be achieved by multiple genes, particularly by the multiple <em>merB</em> encoding organomercurial lyase and one <em>merG</em> encoding cellular permeability to phenylmercury. The novel <em>mer</em> gene identified in pMR68 may help us to design new strategies aimed at the bioremediation of mercurials. </p> </div> </section><span id="keywords"> <h5 class="inline">Keywords: </h5>Mercury resistance; <em>mer</em> operon; Plasmid pMR68; <em>Pseudomonas</em> strain K-62</span><section><a name="sec1"></a><h3>Introduction</h3> <div class="collapsible-content"> <p style="line-height:160%"><em>Pseudomonas</em> strain K-62, a bacterial strain isolated from phenylmercury-polluted soil, is about 1,000 times more resistant to phenylmercury than sensitive strains of <em>Escherichia coli</em> (Tonomura et al. <a name="d66669e217"></a><a onclick="LoadInParent('#B25'); return false;" href="#B25">1968</a>). A study performed about 40 years ago showed that the biochemical mechanism underlying this mercurial resistance is based on the enzymatic degradation of organomercurials and the subsequent reduction of the resulting mercuric ions to the less toxic and more volatile metallic mercury (Tonomura et al. <a name="d66669e220"></a><a onclick="LoadInParent('#B25'); return false;" href="#B25">1968</a>). Two separate organomercurial lyases, designated S-1 and S-2, each showing somewhat different physical properties and substrate specificities, are thought to be responsible for the resistance of <em>P.</em> K-62 to phenylmercury (Tezuka and Tonomura <a name="d66669e226"></a><a onclick="LoadInParent('#B23'); return false;" href="#B23">1976</a>;Tezuka and Tonomura <a name="d66669e230"></a><a onclick="LoadInParent('#B24'); return false;" href="#B24">1978</a>). The organomercurial resistance of this soil strain is encoded by two plasmids, pMR26 and pMR68 (Kiyono et al. <a name="d66669e233"></a><a onclick="LoadInParent('#B11'); return false;" href="#B11">1995b</a>). In addition, pMR26 contains two <em>mer</em> operons that map about 1 kb apart (Kiyono et al. <a name="d66669e239"></a><a onclick="LoadInParent('#B12'); return false;" href="#B12">1997</a>). One comprises <em>merR-</em>o/p-<em>merT</em>-<em>merP</em>-<em>merA</em>-<em>merG</em>-<em>merB1</em>. The other is a defective <em>mer</em> operon comprising <em>merR</em>-o/p-<em>merB2-merD</em> (Kiyono and Pan-Hou <a name="d66669e271"></a><a onclick="LoadInParent('#B8'); return false;" href="#B8">1999a</a>). </p> <p style="line-height:160%">Studies suggest that <em>merR</em> is a regulatory gene that both negatively and positively controls the transcription of <em>merTPABD</em> (Ansari et al. <a name="d66669e282"></a><a onclick="LoadInParent('#B1'); return false;" href="#B1">1995</a>;Brown et al. <a name="d66669e285"></a><a onclick="LoadInParent('#B3'); return false;" href="#B3">2003</a>), whereas <em>MerD</em> is a transcriptional co-regulator (Hobman and Brown <a name="d66669e292"></a><a onclick="LoadInParent('#B7'); return false;" href="#B7">1997</a>;Kiyono et al. <a name="d66669e295"></a><a onclick="LoadInParent('#B10'); return false;" href="#B10">1995a</a>;Lund and Brown <a name="d66669e298"></a><a onclick="LoadInParent('#B16'); return false;" href="#B16">1987</a>). <em>MerT</em>, <em>merP</em>, <em>merA</em>, and <em>merB</em> encode a membrane Hg<sup>2+</sup>-transport protein (Hobman and Brown <a name="d66669e317"></a><a onclick="LoadInParent('#B7'); return false;" href="#B7">1997</a>;Kiyono et al. <a name="d66669e320"></a><a onclick="LoadInParent('#B10'); return false;" href="#B10">1995a</a>;Lund and Brown <a name="d66669e323"></a><a onclick="LoadInParent('#B16'); return false;" href="#B16">1987</a>), a periplasmic Hg<sup>2+</sup>-binding protein (Hobman and Brown <a name="d66669e330"></a><a onclick="LoadInParent('#B7'); return false;" href="#B7">1997</a>;Kiyono et al. <a name="d66669e333"></a><a onclick="LoadInParent('#B10'); return false;" href="#B10">1995a</a>;Kiyono et al. <a name="d66669e336"></a><a onclick="LoadInParent('#B13'); return false;" href="#B13">2000</a>;Lund and Brown <a name="d66669e339"></a><a onclick="LoadInParent('#B16'); return false;" href="#B16">1987</a>), a mercuric reductase (Hobman and Brown <a name="d66669e342"></a><a onclick="LoadInParent('#B7'); return false;" href="#B7">1997</a>; Schiering et al. <a name="d66669e345"></a><a onclick="LoadInParent('#B20'); return false;" href="#B20">1991</a>; Silver and Phung <a name="d66669e349"></a><a onclick="LoadInParent('#B22'); return false;" href="#B22">1996</a>), and a organomercurial lyase (Griffin et al. <a name="d66669e352"></a><a onclick="LoadInParent('#B6'); return false;" href="#B6">1987</a>;Lafrance-Vanasse et al. <a name="d66669e355"></a><a onclick="LoadInParent('#B14'); return false;" href="#B14">2009</a>;Miller <a name="d66669e358"></a><a onclick="LoadInParent('#B17'); return false;" href="#B17">1999</a>), respectively. <em>merG</em>, identified in pMR26, is a newly-identified <em>mer</em>-gene involved in phenylmercury resistance, which is thought to act by reducing cell permeability to phenylmercury (Kiyono and Pan-Hou <a name="d66669e368"></a><a onclick="LoadInParent('#B9'); return false;" href="#B9">1999b</a>). Taken together, these findings suggest that the high resistance to phenylmercury shown by <em>P.</em> K-62 is mediated by the two functional organomercurial lyase enzymes encoded by pMR26 <em>merB1</em> and <em>merB2</em> (Kiyono et al. <a name="d66669e380"></a><a onclick="LoadInParent('#B11'); return false;" href="#B11">1995b</a>; Kiyono and Pan-Hou <a name="d66669e383"></a><a onclick="LoadInParent('#B8'); return false;" href="#B8">1999a</a>), by changes in cellular permeability to phenylmercury mediated by <em>merG</em> (Kiyono and Pan-Hou <a name="d66669e390"></a><a onclick="LoadInParent('#B9'); return false;" href="#B9">1999b</a>), and by an presumptive <em>mer</em> operon located on plasmid pMR68 (Kiyono et al. <a name="d66669e396"></a><a onclick="LoadInParent('#B11'); return false;" href="#B11">1995b</a>) However, no mercurial-resistance loci have been identified in pMR68; indeed, a previous study shows that removal of pMR26 from strain K-62 does not alter its mercurial-resistant phenotype nor prevent it from volatilizing Hg<sup>2+</sup> and organomercurials (Kiyono et al. <a name="d66669e402"></a><a onclick="LoadInParent('#B11'); return false;" href="#B11">1995b</a>). </p> <p style="line-height:160%">To fully explain the high resistance to phenylmercury observed in this strain of soil bacteria, it is essential to understand the <em>mer</em> genes expressed by pMR68. The aim of the present study was to completely identify the mercury resistance genes of plasmid pMR68 isolated from strain K-62. The <em>mer</em> genes encoded by pMR68 were then cloned and analyzed. </p> </div> </section> <section><a name="sec2"></a><h3>Materials and methods</h3> <div class="collapsible-content"> <h4>Bacterial strains and culture conditions</h4> <p style="line-height:160%"><em>P.</em> strain K-62, isolated from phenylmercury-polluted soil in Japan (Tonomura et al. <a name="d66669e425"></a><a onclick="LoadInParent('#B25'); return false;" href="#B25">1968</a>) and deposited in a culture collection belonging to the WDCM56, was kindly supplied by Dr. K. Tonomura and grown in nutrient broth as previously described (Tezuka and Tonomura <a name="d66669e428"></a><a onclick="LoadInParent('#B23'); return false;" href="#B23">1976</a>) (see Table <a name="d66669e431"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T1">1</a>). <em>E. coli</em> XL1-Blue was grown at 37°C in Luria-Bertani (LB) medium. Antibiotics or mercuric chloride were added to the medium at the following concentrations when appropriate: ampicillin, 100 μg/ml (<em>E. coli</em>); mercuric chloride, 40 μg/ml. </p><div class="figs"> <div class="table"><p><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T1','T1',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T1"><strong>Table 1.</strong></a> <strong>Strains and plasmids used in this study</strong></div></div> <h4>DNA purification</h4> <p style="line-height:160%">Six plasmids (8.5–82 kb) (Kiyono et al. <a name="d66669e659"></a><a onclick="LoadInParent('#B11'); return false;" href="#B11">1995b</a>) were purified from strain K-62 grown in nutrient broth for 3 days at 30°C according to the method of Sasakawa et al. (Sasakawa et al. <a name="d66669e662"></a><a onclick="LoadInParent('#B19'); return false;" href="#B19">1986</a>). The purified plasmids were loaded into the wells of a 0.7% low-melting temperature agarose gel (SeaPlaque GTG agarose, Lonza Rockland, Inc., Rockland, ME) and electrophoresed in 0.5 × TBE (45 mM Tris HCl, 45 mM boric acid, 1 mM EDTA) in a contour clamped homogeneous electric field (CHEF) DRII device (Bio-Rad Laboratories, Hercules, CA) with the pulse-time ramped from 10 to 60 s (6 V/cm) for 16 h at 14°C. The gels were then stained with ethidium bromide. The band corresponding to the pMR68 plasmid was excised and equilibrated in small amount of buffer (10 mM Tris HCl pH 7.5, 0.25 mM EDTA, 100 mM NaCl). The agarose was melted at 68°C and digested with ß-agarase (New England Biolabs, Hertfordshire, England). The pMR68 plasmid was then concentrated by ethanol precipitation. </p> <h4>DNA sequencing</h4> <p style="line-height:160%">Purified pMR68 plasmid DNA (15 μg) was sequenced by Eurofins MWG Operon (Ebersberg, Germany) using a Genome Sequencer FLX Titanium system (Roche, Basel, Switzerland). Shotgun sequencing was then performed on the range of one region of a 16-region picotiter plate, resulting in 33,964 reads with an average length of 340 bp. The sequences were assembled using Celera Assembler Version 5.3, generating 18 contigs of at least 1,000 bp in length, some of which were high coverage (>100-fold). Connections between these contigs and adjacent contigs with similarly high coverage were identified by looking for sequencing reads that were split between contigs by the assembly software. Using this process, a chain of seven contigs was assembled into a 71,020 bp sequence. The joins between the seven contigs were checked by PCR using the following primer pairs: 1U-68 kb-15850 and 8 L-68 kb-16600; 2U-68 kb-18520 and 9 L-68 kb-19216; 3U-68 kb-19421 and 10 L-68 kb-20259; 4U-68 kb-38451 and 11 L-68 kb-39477; 5U-68 kb-42220 and 12 L-68 kb-43396; 6U-68 kb-67929 and 13 L-68 kb-68480; and 7U-68 kb-70484 and 14 L-68 kb-457 (see Additional file <a name="d66669e671"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S1','',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S1">1</a>: Table S1). </p><div class="figs"> <div class="addfile"><p><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S1','S1',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S1"></a><strong>Additional file 1: Table S1.</strong> Oligonucleotide primers used in this study.</p><p> Format: PDF Size: 30KB <a href="/web/20150109205656/http://www.amb-express.com/content/supplementary/2191-0855-3-41-s1.pdf">Download file</a></p><p>This file can be viewed with: <a onclick="largepopup('https://web.archive.org/web/20150109205656/http://www.adobe.com/products/acrobat/readstep.html','Help');return false;" href="https://web.archive.org/web/20150109205656/http://www.adobe.com/products/acrobat/readstep.html">Adobe Acrobat Reader</a><span class="open-data-icon"><a href="/web/20150109205656/http://www.amb-express.com/about/access/#opendata"><img title="Open Data" alt="Open Data" src="/web/20150109205656im_/http://www.amb-express.com/bmcimages/article/opendata.gif"></a></span></div></div> <p style="line-height:160%">After the complete nucleotide sequence of pMR68 was obtained, potential open reading frames (ORFs) was searched using the program of genetic information processing software (Genetyx corporation, Tokyo, Japan) and using protein BLAST (<a href="https://web.archive.org/web/20150109205656/http://blast.ncbi.nlm.nih.gov/Blast.cgi">http://blast.ncbi.nlm.nih.gov/Blast.cgi</a> <a href="https://web.archive.org/web/20150109205656/http://www.webcitation.org/query.php?url=http://blast.ncbi.nlm.nih.gov/Blast.cgi&refdoi=10.1186/2191-0855-3-41" alt="" title="Archive copy of webpage" class="xpushbutton">webcite</a>) to confirm the results. Conserved domains were identified searching for Clusters of Orthologous Groups of proteins (COGs) in the NCBI data base. The molecular weights of the encoded proteins were determined by ProtParam (Swiss Institute of Bioinformatics; <a href="https://web.archive.org/web/20150109205656/http://www.expasy.ch/tools/protparam.html">http://www.expasy.ch/tools/protparam.html</a> <a href="https://web.archive.org/web/20150109205656/http://www.webcitation.org/query.php?url=http://www.expasy.ch/tools/protparam.html&refdoi=10.1186/2191-0855-3-41" alt="" title="Archive copy of webpage" class="xpushbutton">webcite</a>). The annotated sequence of pMR68 was deposited in the NCBI database under Accession No. NC019309. </p> <h4>Gene cloning and analysis of the <em>mer</em> operon </h4> <p style="line-height:160%">Plasmid pMKY12 was constructed as follows: Plasmid pMR68 (accession no. NC019309) was used as the template for PCR amplification (PrimeSTAR GXL DNA polymerase, Takara Bio, Inc., Otsu, Japan) of a 10.3 kb fragment containing the <em>merR-</em>o/p-<em>ofr4-orf5-merT1-merP1-merF-merA-merB1</em> genes. The primers used were 16U-68 kb-2393 and 21 L-68 kb-9566 (Additional file <a name="d66669e707"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S1','',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S1">1</a>: Table S1). After blunting and 5'-phosphorylation of the DNA fragment using a Mighty Cloning Kit (Blunt End) (Takara Bio, Inc., Otsu, Japan), the DNA fragment was cloned into the blunt-ended (<em>Hin</em>c II) vector, pUC118 (Vieira and Messing <a name="d66669e713"></a><a onclick="LoadInParent('#B27'); return false;" href="#B27">1987</a>). </p> <p style="line-height:160%">Plasmid pMRA114 was constructed as follows: Plasmid pMRA17, containing a 6.6 kb <em>merR-</em>o/p<em>-merT-merP-merA-merG-merB1</em> fragment from pMR26 (accession no. D83080), which contains restriction sites for <em>Sac</em>I, was used as the starting material. After digestion with <em>Sac</em>I, the 6.6 kb fragment was cloned into the corresponding sites in pUC118. The integrity of all cloned fragments was confirmed by sequencing. </p> <h4>Mercury susceptibility tests and volatilization activity tests</h4> <p style="line-height:160%">The resistance of <em>E. coli</em> XL1-Blue carrying pUC118 (control vector), pMRA114, or pMKY12 to HgCl<sub>2</sub> or C<sub>6</sub>H<sub>5</sub>HgOCOCH<sub>3</sub> was determined in liquid medium. <em>E. coli</em> cells carrying the control or recombinant plasmids were grown overnight in LB medium at 37°C. Cells were harvested and suspended in LB medium (1.6 × 10<sup>7</sup> cells/200 μL/well) containing HgCl<sub>2</sub> or C<sub>6</sub>H<sub>5</sub>HgOCOCH<sub>3</sub> at various concentrations. After incubation at 37°C for 16 h, the absorbance of each culture was read at A<sub>600</sub> to measure cell growth. </p> <p style="line-height:160%">The mercury volatilization assay was performed as follows: <em>E. coli</em> cells carrying the control or recombinant plasmids were grown to mid-exponential phase and then suspended in LB medium containing 50 μM HgCl<sub>2</sub> or 5 μM C<sub>6</sub>H<sub>5</sub>HgOCOCH<sub>3</sub>. After incubating at 37°C for 16 h, the samples were digested with concentrated nitric acid for 2 h at 90°C and the amount of mercury remaining in the medium was determined by flameless cold-vapour atomic adsorption spectrometry using an atomic mercury analyser (HG-310; Hiranuma, Japan). </p> </div> </section> <section><a name="sec3"></a><h3>Results</h3> <div class="collapsible-content"> <h4>General features of plasmid pMR68</h4> <p style="line-height:160%">The complete nucleotide sequence of plasmid pMR68 was assembled into a circular DNA sequence comprising 71,020 bp, with an overall G + C content of 64.5%. The sequence showed that pMR68 was 3 kb larger than previously calculated on the basis of agarose gel electrophoresis (Kiyono et al. <a name="d66669e801"></a><a onclick="LoadInParent('#B11'); return false;" href="#B11">1995b</a>). Figure <a name="d66669e804"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1">1</a> shows a detailed genetic map of pMR68. The predicted coding regions showed a particular genetic organization, highlighting two well-defined regions that corresponded to genomic islands (comprising 41 kb of the complete plasmid). The first region possessed a 21 kb island (pMR68 co-coordinates: 59,285–71,020 and 1–9,472), which contained genes involved in mercurial resistance and mobility (Figure <a name="d66669e807"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1">1</a>). The second region possessed a 20 kb island (pMR68 co-coordinates; 10,189–30,567), which contained plasmid transposable elements (Figure <a name="d66669e810"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1">1</a>). A summary of the sequence data for pMR68, including the length and molecular mass of the predicted proteins and their sequence homology with known proteins, is shown in Additional file <a name="d66669e813"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2','',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2">2</a>: Table S2. </p><div class="figs"> <div class="fig"><p><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1','F1',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1"><img align="top" src="/web/20150109205656im_/http://www.amb-express.com/content/figures/2191-0855-3-41-1.gif" alt="thumbnail" class="thumbnail"><strong>Figure 1.</strong></a> <strong>Genetic map of the </strong><strong><em>P. </em></strong><strong>strain K-62 plasmid, pMR68.</strong> The deduced coding regions are shown by open arrows indicating the direction of transcription. The circular positions are indicated at intervals of 20,000 bp. The gene clusters responsible for mercurial resistance, transposable elements, metabolizing enzymes, and hypothetical proteins are indicated by the black, gray, open and shaded arrows, respectively. </div> <div class="addfile"><p><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2','S2',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2"></a><strong>Additional file 2: Table S2.</strong> Summary of location of predicted coding regions on plasmid pMR68.</p><p> Format: PDF Size: 71KB <a href="/web/20150109205656/http://www.amb-express.com/content/supplementary/2191-0855-3-41-s2.pdf">Download file</a></p><p>This file can be viewed with: <a onclick="largepopup('https://web.archive.org/web/20150109205656/http://www.adobe.com/products/acrobat/readstep.html','Help');return false;" href="https://web.archive.org/web/20150109205656/http://www.adobe.com/products/acrobat/readstep.html">Adobe Acrobat Reader</a><span class="open-data-icon"><a href="/web/20150109205656/http://www.amb-express.com/about/access/#opendata"><img title="Open Data" alt="Open Data" src="/web/20150109205656im_/http://www.amb-express.com/bmcimages/article/opendata.gif"></a></span></div></div> <h4>Mercury-resistance (Hg<sup>R</sup>) determinants </h4> <p style="line-height:160%">The pMR68 plasmid contained three putative mercury-resistance (<em>mer</em>) gene clusters (Figure <a name="d66669e859"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1">1</a>): Cluster 1) a potential <em>mer</em> operon, consisting of the <em>merR-orf4-orf5-T1-P1-F-A-B1</em> genes (ORFs 3 and 6–10); Cluster 2) mercury transport genes, <em>merT2-P2</em> (ORFs 62 and 63); and Cluster 3) an organomercurial lyase gene, <em>merB2</em> (ORF 72) (Additional file <a name="d66669e875"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2','',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2">2</a>: Table S2 and Figures <a name="d66669e878"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1">1</a> and <a name="d66669e881"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2">2</a>). The potential <em>mer</em> operon within pMR68 was located between putative transposable elements, and flanked by genes encoding a transposase IS4 family protein (ORF 75) and a transposase IS5 family protein (ORF 11) (Additional file <a name="d66669e887"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2','',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2">2</a>: Table S2). The incomplete <em>mer</em> operon (cluster 2) within pMR68 was also located between putative transposable elements, and flanked by genes encoding a transposase IS30 family protein (ORF 56) and a transposase IS116 family protein (ORF 68) (Additional file <a name="d66669e894"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2','',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2">2</a>: Table S2). The DNA sequence showed the presence of putative promoters upstream of the <em>merT1</em> genes within the complete <em>mer</em> operon of cluster 1 (Figure <a name="d66669e903"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2">2</a>). Upstream of <em>merR</em> and upstream of <em>merT1</em> were sequences containing potential −35 (ATCAGA) and −10 (GATTAT) and −35 (TTGCAC) and −10 (CATAAT) sequences, and a dyad symmetrical sequence (GCACCTGTAGCCGCTACAGGTTG), respectively, which could be interpreted as an operator/promoter (o/p) sequence (cluster 1, Figure <a name="d66669e913"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2">2</a>). </p><div class="figs"> <div class="fig"><p><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2','F2',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2"><img align="top" src="/web/20150109205656im_/http://www.amb-express.com/content/figures/2191-0855-3-41-2.gif" alt="thumbnail" class="thumbnail"><strong>Figure 2.</strong></a> <strong>Organization of the </strong><strong><em>mer </em></strong><strong>operon of pMR68 and its homology with the corresponding </strong><strong><em>mer </em></strong><strong>genes identified in pMR68.</strong><em>merR</em>, regulatory gene; <em>merT and merF</em>, mercury transport genes; <em>merP</em>, mercury binding gene; <em>merA</em>, mercuric reductase gene; <em>merB</em>, organomercurial lyase gene; <em>orf</em>, unknown open reading frame. </div></div> <p style="line-height:160%">ORF4 (encoding a hypothetical protein (HP)) and ORF5 (showing 63% identity to phosphoribosyl-AMP cyclohydrolase from <em>Parvibaculum lavamentivorans</em> DS-1) were located between MerR and MerT1. Two sets of <em>merT</em>, <em>merP</em>, and <em>merB</em> genes were found in pMR68, and the similarities between <em>merT1</em> and <em>merT2</em>, <em>merP1</em> and <em>merP2</em>, and <em>merB1</em> and <em>merB2</em> ranged from 27% to 69% at both the nucleic acid and amino acid levels (Figure <a name="d66669e996"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2">2</a>). The sequence similarity between the pMR68 and pMR26 proteins (<a name="d66669e1000"></a><a onclick="LoadInParent('#B12'); return false;" href="#B12">Kiyono et al. 1997</a>;Kiyono and Pan-Hou <a name="d66669e1003"></a><a onclick="LoadInParent('#B8'); return false;" href="#B8">1999a</a>) from strain K-62 or the well-known pDU1358 (Griffin et al. <a name="d66669e1006"></a><a onclick="LoadInParent('#B6'); return false;" href="#B6">1987</a>) and Tn<em>21</em> (Gilbert and Summers <a name="d66669e1012"></a><a onclick="LoadInParent('#B5'); return false;" href="#B5">1988</a>;Liebert et al. <a name="d66669e1015"></a><a onclick="LoadInParent('#B15'); return false;" href="#B15">1999</a>) proteins from Gram-negative bacteria was low (Table <a name="d66669e1019"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T2','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T2">2</a>)<em>.</em></p><div class="figs"> <div class="table"><p><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T2','T2',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T2"><strong>Table 2.</strong></a> <strong>Amino acid sequence homology of </strong><strong><em>mer </em></strong><strong>genes between pMR68 and pMR26, pDU1358, Tn</strong><strong><em>21 </em></strong><strong>or </strong><strong><em>M. extorquens </em></strong><strong>AM1 putative </strong><strong><em>mer </em></strong><strong>operon</strong></div></div> <h4>Gene cloning and analysis of the <em>mer</em> operon </h4> <p style="line-height:160%">To identify the physiological role played by the <em>mer</em> operons in pMR68 and pMR26 in <em>E. coli</em>, we constructed recombinant plasmids pMKY12 and pMRA114, which contained the <em>merR-orf4-orf5-merT1-merP1-merF-merA-merB1</em> genes from pMR68 and the <em>merR-merT-merP-merA-merG-merB1</em> genes from pMR26, respectively (Table <a name="d66669e1261"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T1">1</a>). Bacteria containing pMKY12 showed greater resistance to Hg(II) than control cells carrying plasmid pUC118; the level of resistance was almost the same as that shown by cells containing pMRA114 (Figure <a name="d66669e1265"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F3','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F3">3</a>A). </p><div class="figs"> <div class="fig"><p><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F3','F3',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F3"><img align="top" src="/web/20150109205656im_/http://www.amb-express.com/content/figures/2191-0855-3-41-3.gif" alt="thumbnail" class="thumbnail"><strong>Figure 3.</strong></a> <strong>Susceptibility to mercurials.</strong><em>E. coli</em> cells carrying pUC118 (filled triangles), pMKY12 (filled circles), or pMRA114 (filled diamonds) were grown in liquid medium containing varying concentrations of HgCl<sub>2</sub><strong>(A)</strong> or C<sub>6</sub>H<sub>5</sub>HgOCOCH<sub>3</sub><strong>(B)</strong>. Growth was estimated by measuring the turbidity at 600 nm. Data represent the mean ± S.D. of triplicate measurements from three independent experiments. *<em>p <</em> 0.05 <em>vs.</em> control. **<em>p <</em> 0.01 <em>vs.</em> control. <sup>##</sup><em>p <</em> 0.01 <em>vs.</em> pMRA114. </div></div> <p style="line-height:160%">We next examined the volatilization of mercury from Hg(II) and C<sub>6</sub>H<sub>5</sub>Hg(I) by cells containing a control vector (pUC118) or the pMKY12 or pMRA114 plasmids. As shown in Figure <a name="d66669e1329"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F4','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F4">4</a>, cells carrying both pMKY12 and pMRA114 were able to volatilize mercury from both Hg(II) and C<sub>6</sub>H<sub>5</sub>Hg(I). Volatilization of Hg(II) was similar between cells carrying pMKY12 or pMRA114; however, volatilization of C<sub>6</sub>H<sub>5</sub>Hg(I) was significantly higher in cells carrying pMKY12 than in those carrying pMRA114 (Figure <a name="d66669e1345"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F4','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F4">4</a>B). A volatilization test indicated that the cells carrying pMKY12 were able to volatilize almost 90% of the total phenylmercury. </p><div class="figs"> <div class="fig"><p><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F4','F4',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F4"><img align="top" src="/web/20150109205656im_/http://www.amb-express.com/content/figures/2191-0855-3-41-4.gif" alt="thumbnail" class="thumbnail"><strong>Figure 4.</strong></a> <strong>Volatilization of mercury from Hg(II) and C</strong><sub><strong>6</strong></sub><strong>H</strong><sub><strong>5</strong></sub><strong>Hg(I).</strong><em>E. coli</em> cells carrying pUC118 (empty bar), pMRA114 (shaded bar), or pMKY12 (black bar) were grown in liquid medium containing 50 μM HgCl<sub>2</sub><strong>(A)</strong> or 5 μM C<sub>6</sub>H<sub>5</sub>HgOCOCH<sub>3</sub><strong>(B)</strong>. After incubation at 37°C for 16 h, the amount of mercury remaining in the medium was measured as described in “Materials and Methods”. Data represent the mean ± S.D. of triplicate measurements from three independent experiments. **<em>p <</em> 0.01 <em>vs.</em> control. <sup>##</sup><em>p <</em> 0.01 <em>vs.</em> pMRA114. </div></div> </div> </section> <section><a name="sec4"></a><h3>Discussion</h3> <div class="collapsible-content"> <p style="line-height:160%">The present study determined the complete nucleotide sequence of plasmid pMR68 (isolated from <em>P.</em> strain K-62). In addition, the <em>mer</em> genes in pMR68 and pMR26 were identified, sequenced, and cloned in <em>E. coli</em>. The pMR68 sequence contained 75 complete coding regions; however, we were not able to identify a predicted origin of replication (Additional file <a name="d66669e1426"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2','',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2">2</a>: Table S2 and Figure <a name="d66669e1429"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1">1</a>). Although most of the identified genes (44%) encoded mobile elements related to transfer functions, 12% encoded mercurial-resistance determinants, 16% encoded metabolism-related genes, and 28% encoded hypothetical proteins (HPs). </p> <p style="line-height:160%">One of the three <em>mer-</em>gene clusters in pMR68 (<em>merR-orf4-orf5-merT1-merP1-merF-merA-merB1</em>) was identified as a potential <em>mer</em> operon, which confers bacterial resistance to both inorganic and organic mercury (Additional file <a name="d66669e1443"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2','',630,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/suppl/S2">2</a>: Table S2 and Figure <a name="d66669e1446"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F3','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F3">3</a>). The number and order of the <em>mer</em> genes on this potential <em>mer</em> operon were different to those of <em>merR1-</em>o/p<em>-T-P-A-G-B1</em> of pMR26 (which encodes resistance to both inorganic and organic mercury) and <em>merR2-</em>o/p<em>-B2-D</em> of pMR26 (which confers bacterial hypersensitivity to organomercury compounds) (Table <a name="d66669e1469"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T2','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T2">2</a> and Figures <a name="d66669e1472"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F1">1</a> and <a name="d66669e1475"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F2">2</a>) (Kiyono et al. <a name="d66669e1478"></a><a onclick="LoadInParent('#B12'); return false;" href="#B12">1997</a>;Kiyono and Pan-Hou <a name="d66669e1481"></a><a onclick="LoadInParent('#B8'); return false;" href="#B8">1999a</a>;Kiyono et al. <a name="d66669e1484"></a><a onclick="LoadInParent('#B12'); return false;" href="#B12">1997</a>)<em>.</em> The deduced amino acid sequences for the proteins encoded by the <em>mer</em> genes in pMR68 were more similar (67–84%) to those of a putative <em>mer</em> operon in <em>Methylobacterium extorquens</em> AM1, which lacks the <em>merB</em> gene (Vuilleumier et al. <a name="d66669e1503"></a><a onclick="LoadInParent('#B28'); return false;" href="#B28">2009</a>), than to those in pMR26 (21–47%) (Table <a name="d66669e1507"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T2','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/table/T2">2</a>). </p> <p style="line-height:160%">We identified potential −35 and −10 sequences and a dyad symmetrical sequence lying upstream of pMR68 <em>merR</em> and upstream of <em>merT1,</em> respectively; these sequences may represent putative promoters of the <em>mer</em> operon of cluster 1 in pMR68. The distance between the −35 and −10 positions within the putative pMR68 <em>merR</em> promoter was 19 bp. The spacing between the <em>merR</em> promoter and Tn<em>21</em> in pMR26 was also 19 bp, which is essential for the “twist and bend” mechanism underlying transcriptional activation (Ansari et al. <a name="d66669e1531"></a><a onclick="LoadInParent('#B1'); return false;" href="#B1">1995</a>;Kiyono et al. <a name="d66669e1534"></a><a onclick="LoadInParent('#B12'); return false;" href="#B12">1997</a>;Kiyono and Pan-Hou <a name="d66669e1537"></a><a onclick="LoadInParent('#B8'); return false;" href="#B8">1999a</a>). Taken together, these observations suggest that <em>merT1-P1-F-A-B1</em> is regulated by both the <em>merR</em> gene and the <em>mer</em> operator. </p> <p style="line-height:160%">Volatilization of mercury from organomercurials is thought to result from the degradation of organic mercury by the organomercurial lyase encoded by <em>merB,</em> followed by the reduction of the resulting Hg<sup>2+</sup> to volatile Hg<sup>0</sup> by the mercuric reductase encoded by <em>merA</em> (Barkay et al. <a name="d66669e1564"></a><a onclick="LoadInParent('#B2'); return false;" href="#B2">2003</a>;Silver and Phung le <a name="d66669e1568"></a><a onclick="LoadInParent('#B21'); return false;" href="#B21">2005</a>). Cells carrying pMKY12 (containing <em>merR-orf4-orf5-merT1-merP1-merF-merA-merB1</em> cloned from pMR68) and cells carrying pMRA114 (containing <em>merR-merT-merP-merA-merG-merB1</em> cloned from plasmid pMR26) were more resistant to, and volatilized more, mercury from mercuric chloride and phenylmercuric acetate than the control cells (Figures <a name="d66669e1577"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F3','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F3">3</a> and <a name="d66669e1580"></a><a onclick="popup('https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F4','',800,470); return false;" href="https://web.archive.org/web/20150109205656/http://www.amb-express.com/content/3/1/41/figure/F4">4</a>). </p> <p style="line-height:160%">The present results, together with those of our previous study, suggest that the high resistance to phenylmercury shown by strain K-62 may be due to the following: [1] the functional organomercurial lyase enzymes encoded by pMR26 <em>merB1</em> and <em>merB2</em> (Kiyono et al. <a name="d66669e1591"></a><a onclick="LoadInParent('#B11'); return false;" href="#B11">1995b</a>;Kiyono et al. <a name="d66669e1594"></a><a onclick="LoadInParent('#B12'); return false;" href="#B12">1997</a>;Kiyono and Pan-Hou <a name="d66669e1597"></a><a onclick="LoadInParent('#B8'); return false;" href="#B8">1999a</a>), and pMR68 <em>merB1</em>; [2] the two functional mercuric reductases encoded by pMR26 <em>merA</em> (Kiyono et al. <a name="d66669e1607"></a><a onclick="LoadInParent('#B11'); return false;" href="#B11">1995b</a>;Kiyono and Pan-Hou <a name="d66669e1610"></a><a onclick="LoadInParent('#B8'); return false;" href="#B8">1999a</a>) and pMR68 <em>merA</em>; [3] the multi-functional transporters encoded by pMR26 <em>merT</em> and <em>merP</em> (Kiyono et al. <a name="d66669e1623"></a><a onclick="LoadInParent('#B10'); return false;" href="#B10">1995a</a>;Kiyono et al. <a name="d66669e1626"></a><a onclick="LoadInParent('#B13'); return false;" href="#B13">2000</a>;Nagata et al. <a name="d66669e1629"></a><a onclick="LoadInParent('#B18'); return false;" href="#B18">2006</a>;Uno et al. <a name="d66669e1632"></a><a onclick="LoadInParent('#B26'); return false;" href="#B26">1997</a>), and by pMR68 <em>merT1</em>-<em>merP1</em>-<em>merF</em>; and [4] alterations in cellular permeability to phenylmercury mediated by pMR26 <em>merG</em> (Kiyono and Pan-Hou <a name="d66669e1648"></a><a onclick="LoadInParent('#B9'); return false;" href="#B9">1999b</a>)<em>.</em> Further analysis of <em>orf4</em> and <em>orf5</em> within pMR68 is currently on-going. </p> <p style="line-height:160%">In conclusion, sequence analysis of pMR68 showed that the plasmid contains novel genes that may provide <em>Pseudomonas</em> strains with the means to adapt to a wide variety of challenging environments, including exposure to heavy metals. Such resistance mechanisms are likely to be linked to the evolution of the bacterial hosts. The novel <em>mer</em> gene identified in pMR68 may help us to design new strategies aimed at the bioremediation of mercury-containing compounds present in the environment. </p> </div> </section> <section><a name="sec5"></a><h3>Competing interests</h3> <div class="collapsible-content"> <p style="line-height:160%">The authors declare that they have no competing interests.</p> </div> </section> <section><a name="ack"></a><h3>Acknowledgments</h3> <div class="collapsible-content"> <p style="line-height:160%">We thank Miss M. Suzuki, Mr. M. Saito and Mr. I. Okuno for their technical assistance. This work was supported in part by a Grant-in-Aid for Young Scientists (B) (No. 24790128) to Y.S. and a Grant-in-Aid for Scientific Research (C) (No. 24510104) to M.K. from the Ministry of Education, Science and Culture, Japan. </p> </div> </section> <section><a name="refs"></a><h3>References</h3> <div id="article-references" class="collapsible-content"> <ul id="references"> <li id="B1"> <p><a name="B1"></a>Ansari AZ, Bradner JE, O'Halloran TV (1995) DNA-bend modulation in a repressor-to-activator switching mechanism. Nature 374(6520):371-375 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/7885478">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=7885478">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B1" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B1','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B2"> <p><a name="B2"></a>Barkay T, Miller SM, Summers AO (2003) Bacterial mercury resistance from atoms to ecosystems. FEMS Microbiol Rev 27(2–3):355-384 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/12829275">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://dx.doi.org/10.1016/s0168-6445(03)00046-9">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B2" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B2','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B3"> <p><a name="B3"></a>Brown NL, Stoyanov JV, Kidd SP, Hobman JL (2003) The MerR family of transcriptional regulators. FEMS Microbiol Rev 27(2–3):145-163 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/12829265">PubMed Abstract</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B3" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B3','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B4"> <p><a name="B4"></a>Bullock WO, Fernandez JM, Short JM (1987) XL1-Blue: A high efficiency plasmid transforming <em>recA Escherichia coli</em> strain with beta-galactosidase selection. Biotechniques 5(4):376-379 <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B4" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B4','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B5"> <p><a name="B5"></a>Gilbert MP, Summers AO (1988) The distribution and divergence of DNA sequences related to the Tn<em>21</em> and Tn<em>501 mer</em> operons. Plasmid 20(2):127-136 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/2853392">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=2853392">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B5" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B5','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B6"> <p><a name="B6"></a>Griffin HG, Foster TJ, Silver S, Misra TK (1987) Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358. Proc Natl Acad Sci USA 84(10):3112-3116 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/3033633">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=3033633">Publisher Full Text</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=3033633">PubMed Central Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B6" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B6','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B7"> <p><a name="B7"></a>Hobman JL, Brown NL (1997) bacterial mercury-resistance genes. Met Ions Biol Syst 34:527-568 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/9046583">PubMed Abstract</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B7" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B7','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B8"> <p><a name="B8"></a>Kiyono M, Pan-Hou H (1999) DNA sequence and expression of a defective <em>mer</em> operon from <em>Pseudomonas</em> K-62 plasmid pMR26. Biol Pharm Bull 22(9):910-914 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/10513611">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://dx.doi.org/10.1248/bpb.22.910">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B8" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B8','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B9"> <p><a name="B9"></a>Kiyono M, Pan-Hou H (1999) The <em>merG</em> gene product is involved in phenylmercury resistance in <em>Pseudomonas</em> strain K-62. J Bacteriol 181(3):726-730 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/9922233">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=9922233">Publisher Full Text</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=9922233">PubMed Central Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B9" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B9','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B10"> <p><a name="B10"></a>Kiyono M, Omura T, Fujimori H, Pan-Hou H (1995) Lack of involvement of <em>merT</em> and <em>merP</em> in methylmercury transport in mercury resistant <em>Pseudomonas</em> K-62. FEMS Microbiol Lett 128(3):301-306 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/7781979">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://dx.doi.org/10.1111/j.1574-6968.1995.tb07540.x">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B10" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B10','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B11"> <p><a name="B11"></a>Kiyono M, Omura T, Fujimori H, Pan-Hou H (1995) Organomercurial resistance determinants in <em>Pseudomonas</em> K-62 are present on two plasmids. Arch Microbiol 163(4):242-247 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/7763132">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://dx.doi.org/10.1007/BF00393375">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B11" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B11','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B12"> <p><a name="B12"></a>Kiyono M, Omura T, Inuzuka M, Fujimori H, Pan-Hou H (1997) Nucleotide sequence and expression of the organomercurial-resistance determinants from a <em>Pseudomonas</em> K-62 plasmid pMR26. Gene 189(2):151-157 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/9168120">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=9168120">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B12" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B12','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B13"> <p><a name="B13"></a>Kiyono M, Uno Y, Omura T, Pan-Hou H (2000) Role of MerT and MerP from <em>Pseudomonas</em> K-62 plasmid pMR26 in the transport of phenylmercury. Biol Pharm Bull 23(3):279-282 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/10726879">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://dx.doi.org/10.1248/bpb.23.279">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B13" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B13','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B14"> <p><a name="B14"></a>Lafrance-Vanasse J, Lefebvre M, Di Lello P, Sygusch J, Omichinski JG (2009) Crystal structures of the organomercurial lyase MerB in its free and mercury-bound forms: insights into the mechanism of methylmercury degradation. J Biol Chem 284(2):938-944 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/19004822">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=19004822">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B14" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B14','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B15"> <p><a name="B15"></a>Liebert CA, Hall RM, Summers AO (1999) Transposon Tn<em>21</em>, flagship of the floating genome. Microbiol Mol Biol Rev 63(3):507-522 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/10477306">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=10477306">Publisher Full Text</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=10477306">PubMed Central Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B15" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B15','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B16"> <p><a name="B16"></a>Lund PA, Brown NL (1987) Role of the <em>merT</em> and <em>merP</em> gene products of transposon Tn<em>501</em> in the induction and expression of resistance to mercuric ions. Gene 52(2–3):207-214 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/3038684">PubMed Abstract</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B16" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B16','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B17"> <p><a name="B17"></a>Miller SM (1999) Bacterial detoxification of Hg(II) and organomercurials. Essays Biochem 34:17-30 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/10730186">PubMed Abstract</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B17" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B17','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B18"> <p><a name="B18"></a>Nagata T, Kiyono M, Pan-Hou H (2006) Involvement of aromatic amino acids in phenylmercury trasport by MerT protein. J Health Sci 52(4):475-477 <a target="_blank" href="https://web.archive.org/web/20150109205656/http://dx.doi.org/10.1248/jhs.52.475">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B18" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B18','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B19"> <p><a name="B19"></a>Sasakawa C, Kamata K, Sakai T, Murayama SY, Makino S, Yoshikawa M (1986) Molecular alteration of the 140-megadalton plasmid associated with loss of virulence and Congo red binding activity in <em>Shigella flexneri</em>. Infect Immun 51(2):470-475 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/3002985">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=3002985">Publisher Full Text</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=3002985">PubMed Central Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B19" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B19','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B20"> <p><a name="B20"></a>Schiering N, Kabsch W, Moore MJ, Distefano MD, Walsh CT, Pai EF (1991) Structure of the detoxification catalyst mercuric ion reductase from <em>Bacillus</em> sp. strain RC607. Nature 352(6331):168-172 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/2067577">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=2067577">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B20" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B20','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B21"> <p><a name="B21"></a>Silver S, le Phung T (2005) A bacterial view of the periodic table: genes and proteins for toxic inorganic ions. J Ind Microbiol Biotechnol 32(11–12):587-605 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/16133099">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=16133099">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B21" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B21','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B22"> <p><a name="B22"></a>Silver S, Phung LT (1996) Bacterial heavy metal resistance: new surprises. Annu Rev Microbiol 50:753-789 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/8905098">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=8905098">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B22" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B22','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B23"> <p><a name="B23"></a>Tezuka T, Tonomura K (1976) Purification and properties of an enzyme catalyzing the splitting of carbon-mercury linkages from mercury-resistant <em>Pseudomonas</em> K-62 strain. I. Splitting enzyme 1. J Biochem 80(1):79-87 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/9382">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=9382">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B23" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B23','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B24"> <p><a name="B24"></a>Tezuka T, Tonomura K (1978) Purification and properties of a second enzyme catalyzing the splitting of carbon-mercury linkages from mercury-resistant <em>Pseudomonas</em> K-62. J Bacteriol 135(1):138-143 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/27499">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=27499">Publisher Full Text</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=27499">PubMed Central Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B24" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B24','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B25"> <p><a name="B25"></a>Tonomura K, Maeda K, Futai F, Nakagami T, Yamada M (1968) Stimulative vaporization of phenylmercuric acetate by mercury-resistant bacteria. Nature 217(5129):644-646 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/5637736">PubMed Abstract</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B25" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B25','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B26"> <p><a name="B26"></a>Uno Y, Kiyono M, Tezuka T, Pan-Hou H (1997) Phenylmercury transport mediated by <em>merT-merP</em> genes of <em>Pseudomonas</em> K-62 plasmid pMR26. Biol Pharm Bull 20(1):107-109 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/9013821">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://dx.doi.org/10.1248/bpb.20.107">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B26" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B26','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B27"> <p><a name="B27"></a>Vieira J, Messing J (1987) Production of single-stranded plasmid DNA. Methods Enzymol 153:3-11 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/3323803">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=3323803">Publisher Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B27" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B27','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> <li id="B28"> <p><a name="B28"></a>Vuilleumier S, Chistoserdova L, Lee MC, Bringel F, Lajus A, Zhou Y, Gourion B, Barbe V, Chang J, Cruveiller S, Dossat C, Gillett W, Gruffaz C, Haugen E, Hourcade E, Levy R, Mangenot S, Muller E, Nadalig T, Pagni M, Penny C, Peyraud R, Robinson DG, Roche D, Rouy Z, Saenampechek C, Salvignol G, Vallenet D, Wu Z, Marx CJ, Vorholt JA, Olson MV, Kaul R, Weissenbach J, Medigue C, Lidstrom ME (2009) Methylobacterium genome sequences: a reference blueprint to investigate microbial metabolism of C1 compounds from natural and industrial sources. PLoS One 4(5):e5584 <a target="_blank" href="/web/20150109205656/http://www.amb-express.com/pubmed/19440302">PubMed Abstract</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&cmd=prlinks&retmode=ref&id=19440302">Publisher Full Text</a> | <a target="_blank" href="https://web.archive.org/web/20150109205656/http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=19440302">PubMed Central Full Text</a> <a href="/web/20150109205656/http://www.amb-express.com/sfx_links?ui=2191-0855-3-41&bibl=B28" onclick="popup('/sfx_links?ui=2191-0855-3-41&bibl=B28','SFXMenu','460','420'); return false;"><img src="/web/20150109205656im_/http://www.amb-express.com/sfx_links?getImage" alt="OpenURL" align="absmiddle"></a></p> <p class="totext"><script type="text/javascript">totext()</script></p> </p> </li> </ul> </div> </section> <br class="clearall"> <div class="article-alert-signup-div"> <a class="close png_bg" id="closeHelpBox">close</a> <div class="article-alert-signup rounded"> <span class="blurb left">Sign up to receive new article alerts from <em>AMB Express</em></span> <button name="articleAlertPreference.status" type="button" class="w74 right" onclick="window.location='/my/preferences'">Sign up</button> </div> </div></div> </div></div> </div> </div> </div> <hr class="hide"/> <div id="footer"> <span class="views"><a id="mobile-view" href="?fmt_view=mobile">Mobile view</a> | <strong>Desktop view</strong></span> <div class="content"> <div class="rounded "> <div class="wrap-inner "> <ul class="desktop"> <li class="noborder"><a href="https://web.archive.org/web/20150109205656/http://springeropen.com/about/tandc">Terms and Conditions</a></li> <li><a href="https://web.archive.org/web/20150109205656/http://springeropen.com/about/privacy">Privacy statement</a></li> <li><a href="https://web.archive.org/web/20150109205656/http://springeropen.com/about/imprint">Imprint</a></li> <li><a href="/web/20150109205656/http://www.amb-express.com/support">Support</a></li> <li><a href="/web/20150109205656/http://www.amb-express.com/about/contact">Contact us</a></li> </ul> <p id="copyright">© 2015 Springer unless otherwise stated. Part of Springer Science+Business Media.</p> </div> </div> </div> </div> <div class="springer"> <a href="https://web.archive.org/web/20150109205656/http://www.springer.com/" target="blank"><img style="float:right; margin:0;" src="//web.archive.org/web/20150109205656im_/http://www.biomedcentral.com/images/Springer_Branding_footer_logo.png"/></a> </div> <script>window.bmcIsMobile = "classic";</script> <script> // getElementsByClassName Polyfill var getElementsByClassName=function(e,t,n){if(document.getElementsByClassName){getElementsByClassName=function(e,t,n){n=n||document;var r=n.getElementsByClassName(e),i=t?new RegExp("\\b"+t+"\\b","i"):null,s=[],o;for(var u=0,a=r.length;u<a;u+=1){o=r[u];if(!i||i.test(o.nodeName)){s.push(o)}}return s}}else if(document.evaluate){getElementsByClassName=function(e,t,n){t=t||"*";n=n||document;var r=e.split(" "),i="",s="http://www.w3.org/1999/xhtml",o=document.documentElement.namespaceURI===s?s:null,u=[],a,f;for(var l=0,c=r.length;l<c;l+=1){i+="[contains(concat(' ', @class, ' '), ' "+r[l]+" ')]"}try{a=document.evaluate(".//"+t+i,n,o,0,null)}catch(h){a=document.evaluate(".//"+t+i,n,null,0,null)}while(f=a.iterateNext()){u.push(f)}return u}}else{getElementsByClassName=function(e,t,n){t=t||"*";n=n||document;var r=e.split(" "),i=[],s=t==="*"&&n.all?n.all:n.getElementsByTagName(t),o,u=[],a;for(var f=0,l=r.length;f<l;f+=1){i.push(new RegExp("(^|\\s)"+r[f]+"(\\s|$)"))}for(var c=0,h=s.length;c<h;c+=1){o=s[c];a=false;for(var p=0,d=i.length;p<d;p+=1){a=i[p].test(o.className);if(!a){break}}if(a){u.push(o)}}return u}}return getElementsByClassName(e,t,n)} </script> <script type="text/javascript"> if (typeof jQuery == 'undefined') { document.write(decodeURIComponent("%3Cscript src='/javascript/plugins/jquery.min.js' type='text/javascript'%3E%3C/script%3E")); } document.documentElement.id = "js"; var site = { abbreviation: "", type: "BMC_NICHE", portalId: "9014", section: "browse", page: "fulltext", homePortal: "springeropen.com", siteShowAds: "true", showAds: "true", url: "amb-express.com", portal: false, adpage_url: "amb-express.com/article/10.1186/2191/0855/3/41", id: "10217", name: "AMB Express", plugins: { scrollable: (getElementsByClassName("scrollable").length > 0), flowplayer: ((document.getElementById("flowplayer") != null) || (getElementsByClassName("myPlayer").length > 0) || (document.getElementById("videoarticle") != null) || (getElementsByClassName("flowplayer").length > 0) || (document.getElementById("audio") != null) || (document.getElementById("elifeplayer") != null)), lightbox: ((document.getElementById("image-highlight") != null) || (getElementsByClassName("lightbox").length > 0)), thickbox: (getElementsByClassName("thickbox").length > 0), altmetric: ((document.getElementById("altmetric") != null) || (getElementsByClassName("altmetric").length > 0)) } }; if(typeof quoteSearchUri == "undefined") { quoteSearchUri=null; } </script> <script type="text/javascript" src="https://web.archive.org/web/20150109205656js_/http://www.bmcimg.com/javascript/journals/behaviours-0.js"></script> <script> if (site.plugins.scrollable == true) { document.write(decodeURIComponent("%3Cscript src='/javascript/plugins/jquery.scrollable-1.0.1.min.js' %3E%3C/script%3E")); document.write(decodeURIComponent("%3Cscript src='/javascript/plugins/jquery.tools.min.js'%3E%3C/script%3E")); } if (site.plugins.flowplayer == true) { document.write(decodeURIComponent("%3Cscript src='/javascript/plugins/flowplayer-3.2.6.min.js'%3E%3C/script%3E")); } if (site.plugins.lightbox == true) { document.write(decodeURIComponent("%3Cscript src='/javascript/plugins/browse_imagehighlight.js'%3E%3C/script%3E")); document.write(decodeURIComponent("%3Cscript src='/javascript/plugins/jquery.colorbox.js' %3E%3C/script%3E")); } if (site.plugins.thickbox == true) { document.write(decodeURIComponent("%3Cscript src='/javascript/plugins/thickbox-compressed.js' %3E%3C/script%3E")); document.write(decodeURIComponent("%3Cscript src='/javascript/plugins/thickbox-flashhidden-patch.js' %3E%3C/script%3E")); } </script> <script type="text/javascript" src="https://web.archive.org/web/20150109205656js_/http://www.bmcimg.com/javascript/plugins/jquery.fancybox-1.3.1.pack-0.js"></script> <script type="text/javascript" src="https://web.archive.org/web/20150109205656js_/http://www.bmcimg.com/javascript/plugins/jquery.debug-0.js"></script> <script type="text/javascript" src="https://web.archive.org/web/20150109205656js_/http://www.bmcimg.com/javascript/email_preferences/email_preferences-0.js"></script> <script type="text/javascript" src="https://web.archive.org/web/20150109205656js_/http://www.bmcimg.com/javascript/articles/articles-0.js"></script> <div id="fb-root"></div> <script type="text/javascript" src="/web/20150109205656js_/http://www.amb-express.com/javascript/plugins/jquery.tagcloud.min-0.js"></script>   <div class="hide"> <dl class="google-ad" id="x96banner"> <dt style="display: block;" class="hide"> <a class="skyscraper-ad" href="https://web.archive.org/web/20150109205656/http://www.biomedcentral.com/advertisers/digital_advertising">Advertisement</a> </dt> <dd>  <script type="text/javascript"> OAS_AD('x96'); </script> </dd> </dl> </div> </body> </html>

CINXE.COM

AMB Express | Full text | Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68